Determination of extended spectrum beta-lactamases, metallo-beta-lactamases and AmpC-beta-lactamases among carbapenem resistant Pseudomonas aeruginosa isolated from burn patients

JBUR-4303; No. of Pages 6 burns xxx (2014) xxx–xxx

Available online at www.sciencedirect.com

ScienceDirect journal homepage: www.elsevier.com/locate/burns

Determination of extended spectrum betalactamases, metallo-beta-lactamases and AmpCbeta-lactamases among carbapenem resistant Pseudomonas aeruginosa isolated from burn patients Davood Kalantar Neyestanaki a, Akbar Mirsalehian a, Fereshteh Rezagholizadeh a, Fereshteh Jabalameli a, Morovat Taherikalani b, Mohammad Emaneini a,* a b

Department of Microbiology, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran Clinical Microbiology Research Center, Ilam University of Medical Sciences, Ilam, Iran

article info

abstract

Article history:

Background: Pseudomonas aeruginosa is an important cause of morbidity and mortality in

Accepted 12 February 2014

patients with burns. Method: A total of 214 nonduplicated burn wound isolates of P. aeruginosa were recovered

Keywords:

from burn patients. Identification of carbapenem resistant isolates and their antimicrobial

Pseudomonas aeruginosa

susceptibility pattern was carried out using the phenotypic methods. The presence of genes

ESBLs

encoding extended spectrum beta-lactamases (ESBLs) and metallo-beta-lactamases (MBLs)

MBLs

enzymes were determined by PCR. The genetic relationships between carbapenem resistant

AmpC

isolates were determined by Random Amplified Polymorphic DNA (RAPD)-PCR.

Burn patients

Results: Of 214 investigated P. aeruginosa isolates, 100 (46.7%) were carbapenem resistant. All carbapenem resistant P. aeruginosa were resistant to imipenem, meropenem, ertapenem, carbenicillin, aztreonam, gentamicin and ciprofloxacin but susceptible to polymyxin B. Among 100 carbapenem resistant P. aeruginosa isolates, 3%, 65% and 52% were identified as ESBLs, carbapenemase and AmpC overproduction positive isolates respectively. The most prevalent ESBLs and MBLs genes included blaOXA-10 (97%), blaTEM (61%), blaVIM (55%), blaPER (13%), blaIMP (3%) and blaAIM (1%). RAPD analysis yielded 13 distinct profiles among 92 isolates. A dominant RAPD type was designated as A that consisting of 80 isolates. Conclusion: This is the first report of Adelaide IMipenmase (AIM) MBLs producing P. aeruginosa from Iran and also of the high prevalence of AmpC overproduction isolates. According to the results of current study, P. aeruginosa isolates producing OXA-10, TEM, VIM, PER and IMP beta-lactamases are frequent and the population structures of these isolates are highly similar. # 2014 Elsevier Ltd and ISBI. All rights reserved.

* Corresponding author at: Department of Microbiology, School of Medicine, Tehran University of Medical Sciences 100 Poursina St., Keshavarz Blvd., Tehran, Iran. Tel.: +98 021 8895 5810; fax: +98 021 8895 5810. E-mail addresses: [email protected], [email protected] (M. Emaneini). http://dx.doi.org/10.1016/j.burns.2014.02.010 0305-4179/# 2014 Elsevier Ltd and ISBI. All rights reserved.

Please cite this article in press as: Neyestanaki DK, et al. Determination of extended spectrum beta-lactamases, metallo-beta-lactamases and AmpC-beta-lactamases among carbapenem resistant Pseudomonas aeruginosa isolated from burn patients. Burns (2014), http://dx.doi.org/ 10.1016/j.burns.2014.02.010

JBUR-4303; No. of Pages 6

2

burns xxx (2014) xxx–xxx

1.

Introduction

Patients with thermal injuries are usually at a high risk of nosocomial infection. Pseudomonas aeruginosa is known as an important cause of morbidity and mortality in patients with burns [1]. Carbapenems are the most important therapeutic options that effect against serious infections caused by P. aeruginosa strains producing extended spectrum beta-lactamases (ESBLs) and chromosomal cephalosporinases (AmpC-beta-lactamases) [2]. However, the emergence of carbapenem resistance among P. aeruginosa is an increasing problem in many parts of the world [3,4]. Resistance against carbapenem by P. aeruginosa may be occurred through different mechanisms including: loss of the outer membrane porin OprD protein, reduced levels of drug accumulation due to efflux-pumps over-expression and increased production of AmpC beta-lactamases. Also, P. aeruginosa may obtain genes encoding carbapenemase enzymes such as metallo-beta-lactamases (MBLs) or Klebsiella pneumoniae carbapenemase (KPC) [2,5,6]. The MBL enzymes are able to hydrolyze carbapenems efficiently and thus they are considered the most clinically significant mechanism of carbapenem resistance in P. aeruginosa isolates [6–9]. Multi-drug resistant P. aeruginosa has emerged as an important pathogen in Iran compared to other countries, which confronted clinicians with serious challenges for treating infected patients. There are several reports on the prevalence of blaVIM and blaIMP among carbapenem resistant P. aeruginosa strains isolates from burn patients in Iran but the characteristics of other mechanisms of resistance to carbapenems such as AmpC producer (AmpC overproducer) and KPC are unknown [4,10,11]. This study was designed to determine the existence of different genes encoding betalactamase among carbapenem resistant P. aeruginosa isolated from burn patients in Tehran, Iran in a period of two years.

2.

Materials and methods

2.1.

Bacterial strains

A collection of 214 isolates of P. aeruginosa were recovered from burn patients who were admitted to Shahid Motahari Hospital of Tehran University of Medical Sciences during 2011 and 2012. All the strains were isolated from burn wounds and only one isolate per patient (according to patient’s names and ID) was included in the study. Bacterial identification was performed by standard biochemical tests [12]. Briefly was based on colony morphology, Gram staining, ability to produce oxidase and catalase, no acid production in the slant or butt of Kligler iron agar, oxidative-fermentative (OF) test, pigment production and growth in 42 8C. Isolates identified as carbapenem resistant P. aeruginosa were investigated in accordance to the aims of study.

2.2.

Antimicrobial susceptibility testing

Carbapenem resistant isolates and their antimicrobial susceptibility patterns were investigated using the disk diffusion

method according to the Clinical and Laboratory Standard Institute (CLSI) guidelines [13]. The following antibiotics (MAST, UK) were tested: Imipenem (10 mg), meropenem (10 mg), ertapenem (10 mg), polymyxin B (300 Unit), cefotaxime (30 mg), ceftazidime (30 mg), cefepime (30 mg), cefoxitin (30 mg), gentamicin (10 mg), ceftriaxone (30 mg), carbenicillin (30 mg), aztreonam (30 mg) and ciprofloxacin (5 mg). ESBLs producing strains were detected using the combined double-disk test [4,13]. Organisms were also screened for carbapenemase production by the modified Hodge test [13]. The minimum inhibitory concentrations (MICs) of imipenem (IMI), meropenem (MEM) and ceftazidime (CAZ) were determined by the microbroth dilution method. Susceptibility breakpoints were defined according to CLSI recommendations. P. aeruginosa ATCC 27853, Escherichia coli ATCC 25922 and K. pneumoniae 700603 were used as controls. AmpC overproduction was confirmed according to the method of Rodrı´guez-Martı´nez et al. [8]. The isolates were considering as AmpC overproduction when there was at least a twofold dilution difference between the MICs of CAZ, IMI and MEM and the MICs of CAZ, IMI and MEM plus cloxacillin.

2.3. genes

DNA extraction and PCR detection of b-lactamases

The whole genomic DNA from cultured strains was prepared using genomic DNA Extraction Kit (tip 100; Bioneer, Korea) according to the manufacturer’s instructions. The blaTEM, blaSHV, blaPER, blaPSE, blaCTX-M, blaOXA-10, blaOXA-48, blaKPC, blaGES, blaVIM, blaIMP, blaGIM, blaAIM, blaSPM, blaNDM and blaSIM genes were detected by PCR method using specific oligonucleotide primers listed in Table 1. The PCR mixtures (25 ml) contained 3 ml of DNA, 12.5 ml of PCR master mix (Sinaclon, Iran), and 0.5 mM of each primer; Reaction conditions for all the primers were as follows: initial denaturation at 95 8C for 5 min; 30 cycles of denaturation at 95 8C for 1 min, primer annealing at 47 8C to 61 8C (Table 1) for 1 min and extension at 72 8C for 1 min; followed by a final extension step of 72 8C for 5 min. Amplicons were revealed by electrophoresis on a 1.2% agarose gel and a subsequent exposure to UV light in the presence of KBC power load dye (GelRed Nucleic Acid Gel Stain, 10,000 in water, Kawsar Biotech Co., Tehran, Iran).

2.4.

RAPD PCR amplification

The primer used for Random Amplified Polymorphic DNA (RAPD) PCR were RAPD-208 (50 -AGCGGGCCAA-30 ) and 272 (50 ACGGCCGACC-30 ) [20,21]. The RAPD PCR amplification was carried out in T-100 (BioRad) by using PCR Master Kit (Sinaclon Inc., Tehran, Iran) according to manufacture guideline. PCR conditions were as follows: initial denaturation at 95 8C for 5 min followed by 30 cycles of denaturation at 95 8C for 1 min, annealing at 38.5 8C for 1 min, extension at 72 8C for 2 min. The final extension step was continued for another 10 min at 72 8C. PCR products were then separated by electrophoresis in 1.5% agarose gels with 0.5 TBE buffer. DNA bands were observed by staining with KBC power load dye and photographed under UV illumination. RAPD patterns were analyzed visually and any pattern differing by one or more bands was classified as a distinct RAPD type.

Please cite this article in press as: Neyestanaki DK, et al. Determination of extended spectrum beta-lactamases, metallo-beta-lactamases and AmpC-beta-lactamases among carbapenem resistant Pseudomonas aeruginosa isolated from burn patients. Burns (2014), http://dx.doi.org/ 10.1016/j.burns.2014.02.010

JBUR-4303; No. of Pages 6

3

burns xxx (2014) xxx–xxx

Table 1 – Primers used for the amplification of different beta-lactamase genes among carbapenem-resistant Pseudomonas aeruginosa isolates. Gene target blaSHV blaTEM blaOXA-10 blaPER blaPSE blaVIM blaGES blaAIM blaOXA-48 blaNDM blaSIM blaGIM blaSPM blaIMP blaKPC blaCTX-M

3.

Primer sequence (5’-3’)

Annealing temperature (8C)

F - TCAGCGAAAAACACCTTG R - TCCCGCAGATAAATCACC F - CTTCCTGTTTTTGCTCAC C R - AGCAATAAACCAGCCAGC F - TCAACAAATCGCCAGAGAAG R - TCCCACACCAGAAAAACCAG F - GGGACARTCSKATGAATGTCA R - GGYSGCTTAGATAGTGCTGAT F - AATGGCAATCAGCGCTTC R - GCGCGACTGTGATGTATA F - ATGTTAAAAGTTATTAGTAGT R - CTACTCGGCGACTGAGCGAT F - ATGCGCTTCATTCACGCAC R - CTATTTGTCCGTGCTCAGG F - CTGAAGGTGTACGGAAACAC R - GTTCGGCCACCTCGAATTG F - GCGTGGTTAAGGATGAACAC R - CATCAAGTTCAACCCAACCG F - GGTTTGGCGATCTGGTTTTC R - CGGAATGGCTCATCACGATC F - TACAAGGGATTCGGCATCG R - TAATGGCCTGTTCCCATGTG F - TCGACACACCTTGGTCTGAA R - AACTTCCAACTTTGCCATGC F - AAAATCTGGGTACGCAAACG R - ACATTATCCGCTGGAACAGG F - GGAATAGAGTGGCTTAAYTCTC R - GGTTTAAYAAAACAACCACC F - CGTCTAGTTCTGCTGTCTTG R - CTTGTCATCCTTGTTAGGCG F - GCGATGGGCAGTACCAGTAA R - TTACCCAGCGTCAGATTCCG

Results

Amongst 214 detected P. aeruginosa isolates, 100 (46.7%) identified as carbapenem resistant strains. All carbapenem resistant P. aeruginosa were resistant to imipenem, meropenem, ertapenem, carbenicillin, aztreonam, gentamicin, and ciprofloxacin. All isolates were susceptible to polymyxin B. Fewer than 84% were resistant to ceftazidime, but more than 98% were resistant to cefepime. By the compound disk test, the modified Hodge test and determination of MICs of betalactams, among the 100 carbapenem resistant P. aeruginosa isolates, 2 (2%) were ESBLs producing strains, 37 (37%) were carbapenemase producers and 23 (23%) showed AmpC overproduction respectively. One (1%) isolate was both ESBLs and AmpC positive and 28 (28%) isolates were carbapenemase and AmpC positive simultaneously. The prevalence of resistance genes, RAPD types and MIC of carbapenem resistant P. aeruginosa isolates have been summarized in Table 2. Of the 16 studied bla genes, only 6 were detected and 97% of the test strains carried the blaOXA-10 gene, 61% the blaTEM gene, 55% the blaVIM gene, 13% the blaPER gene, 3% the blaIMP gene and finally 1% of the test strains possessed the blaAIM gene. Out of 100 carbapenem resistant P. aeruginosa strains, 92 isolates were typed by RAPD typing method. RAPD analysis yielded 13 distinct profiles among 92 investigated isolates. Two clusters of isolates shared the same RAPD

Product size (bp)

Reference

51

472

[14]

54

636

[14]

56

276

[15]

47

926

[15]

48

698

[16]

53

801

[17]

56

844

[18]

59

322

[19]

58

438

58

621

61

570

58.5

477

59

271

58

232

58

798 and 232

60

392

This study

patterns, while 11 isolates had unique RAPD patterns. A dominant RAPD type designated as A that consisting of 80 isolates.

4.

Discussion

The high prevalence of carbapenem resistant P. aeruginosa, which accounts for 38–66% of all P. aeruginosa isolates, causing burn infections in Iranian hospitals, has greatly affected infection control and medical treatment [4,10,11]. In this study the rate of carbapenem resistance among P. aeruginosa isolates was 46.7%, which was higher than similar report from Kuwait (10.4%) but lower than what was reported from Saudi Arabia (70%) [22,23]. However, carbapenem resistant P. aeruginosa rates vary greatly among different area which may reflect differences in infection control policies and other factors [8,24]. According to phenotypic method, in the current study, the prevalence of ESBLs producing isolates was low (3%) but according to genotypic method, more than 97% of isolates carried at least one gene encoding ESBLs. This may be related to the phenotypic ESBLs detection methods. The current ESBLs detection methods for P. aeruginosa are unreliable and because of mutational derepression of the chromosomally mediated AmpC enzyme, up-regulation of efflux system and decreased outer membrane permeability, the reported numbers of ESBLs producers are usually low [25–27].

Please cite this article in press as: Neyestanaki DK, et al. Determination of extended spectrum beta-lactamases, metallo-beta-lactamases and AmpC-beta-lactamases among carbapenem resistant Pseudomonas aeruginosa isolated from burn patients. Burns (2014), http://dx.doi.org/ 10.1016/j.burns.2014.02.010

JBUR-4303; No. of Pages 6

4

burns xxx (2014) xxx–xxx

Table 2 – Distribution of the ESBL and MBL genes, antimicrobial MIC and RAPD types among carbapenem-resistant Pseudomonas aeruginosa isolates. Resistance genes

Number of isolates

Range of MIC (mg/ml) IMI

OXA-10 OXA-10 IMP TEM TEM + VIM OXA-10 + IMP OXA-10 + TEM OXA-10 + TEM OXA-10 + TEM OXA-10 + TEM OXA-10 + TEM OXA-10 + VIM OXA-10 + VIM OXA-10 + VIM OXA-10 + TEM + PER OXA-10 + TEM + PER OXA-10 + TEM + PER OXA-10 + TEM + PER OXA-10 + TEM + PER OXA-10 + TEM + VIM OXA-10 + TEM + VIM OXA-10 + TEM + VIM OXA-10 + TEM + VIM OXA-10 + TEM + VIM OXA-10 + PER + VIM OXA-10 +TEM + PER + VIM OXA-10 + TEM + PER + AIM a b

14 1 1 1 1 2 14 1 1 1 2 15 1 2 2 1 1 1 1 26 1 1 1 2 3 2 1

a

16–64 16 32 16 16 32 16–64 32 64 32 32 32–256 64 16–64 64 64 16 64 64 32–512 32 128 32 64–128 64 64 32

RAPD type

IMI + COL

MEM

MEM + COL

CAZ

CAZ + COL

4–64 4 8 8 4 8 4–32 8 32 16 2–16 4–256 16 8–32 32 32 16 32 16 4–256 8 32 8 16–64 16–32 16 4

4–64 16 32 32 32 16 8–128 32 32 64 32 4–128 8 16–64 64–128 32 64 32 16 4–256 32 64 16 4–64 16–32 16–32 4

2–64 16 32 32 32 16 4–128 16 32 64 16–32 2–128 4 16–64 64–128 32 64 32 16 2–256 32 64 16 4–64 16 16–32 4

2–2048 8 16 4096 2 4–8 4–4096 4 4096 512 8–2048 8–4096 2048 1024 4096 2048 4096 2048 32 2–4096 16 4096 16 2048–4096 32–2048 2048 2048

2–4096 8 16 1024 32 2–4 4–4096 4 1024 512 8–2048 8–4096 512 512 4096 2048 4096 2048 32 2–4096 16 4096 16 1024–4096 32–1024 1024–2048 2048

A NTb A NT A A A B C G NT A B NT A I K L M A D F H NT A A E

IMI: imipenem; COL: cloxacillin; MEM: meropenem; CAZ: ceftazidime. NT: not typeable.

To date, different families of class A ESBLs (TEM, SHV, CTXM, PER, VEB, GES and IBC families) were reported in P. aeruginosa isolates [4]. In the present study, the most prevalent ESBLs genes were blaOXA-10, blaTEM and blaPER accounted for 97%, 61% and 13% of isolates respectively. OXA-10 is responsible for high level of resistance to carboxypenicillines, uriedopenicillines and cephalosporins [23]. OXA type ESBLs were the predominant ESBLs in P. aeruginosa reported by a number of studies from Iran [4,15]. However, the rates of genes encoding ESBLs among P. aeruginosa vary greatly among different locations in one or more countries [23,24]. Carbapenemase production is increasing worldwide as a major mechanism of carbapenem resistance among P. aeruginosa isolates [26,29], and this mechanism is seen commonly in Iran [10,11]. In the present study, 65% of isolates were found to produce carbapenemase. The VIM enzymes were the most common MBLs found in carbapenem-resistant bacteria, including carbapenem-resistant P. aeruginosa [24,26]. The blaVIM or blaIMP gene carrying P. aeruginosa were previously recognized in Tehran and other regions of Iran [10,11,28] like those in the present study, these genes were the most prevalent genes encoding carbapenemase enzymes, however to our knowledge; this is the first report of detection of blaAIM MBLs gene from P. aeruginosa isolates in Iran. The addition of a new resistance determinant makes a serious problem on the therapeutic choices existing for treatment of infections caused by P. aeruginosa.

In the absence of MBLs enzymes carbapenem resistance is frequently multifactorial including increased production of AmpC chromosome-encoded cephalosporinase [8]. AmpC beta-lactamases can confer resistance to aminopenicillins, cephalosporins, oxyimino-cephalosporins, cephamycins, carbapenems and monobactams. In the present study, 52% of isolates showed AmpC overproduction. Therefore, the production of MBLs enzyme and AmpC beta-lactamases are the major emerging mechanism of resistance carbapenem among P. aeruginosa isolates in Tehran, Iran. Compatible with other studies from Iran our isolates were negative for the blaPSE, blaCTX-M, blaOXA-48, blaKPC, blaGES, blaGIM, blaSPM, blaNDM, and blaSIM genes [10,11]. Concerning antimicrobial susceptibility, all the carbapenem-resistant P. aeruginosa investigated in this study retained susceptibility to polymyxin B. The typing methods were used as a means of characterization and discrimination of the isolates based on either their genotypic or phenotypic features. Successful application of the RAPD typing method for the genotypic characterization of P. aeruginosa isolates was documented in several studies [30– 32]. According to the results of the current study, 80% of the strains belonged to the one RAPD type A. This may suggest the existence of endemic clones that re-circulated among the patients. In conclusion, this is the first report of Adelaide IMipenmase (AIM) MBL producing P. aeruginosa from Iran and also of the high prevalence of AmpC overproduction isolates. The

Please cite this article in press as: Neyestanaki DK, et al. Determination of extended spectrum beta-lactamases, metallo-beta-lactamases and AmpC-beta-lactamases among carbapenem resistant Pseudomonas aeruginosa isolated from burn patients. Burns (2014), http://dx.doi.org/ 10.1016/j.burns.2014.02.010

JBUR-4303; No. of Pages 6 burns xxx (2014) xxx–xxx

present study shows that P. aeruginosa isolates producing OXA10, TEM, VIM, PER and IMP beta-lactamases are common and the population structure of these isolates is highly similar.

Conflict of interest statement None declared.

Acknowledgments This research has been supported by Tehran University of Medical Sciences & Health Services grant no 19204//91-04-30.

references

[1] Tredget EE, Shankowsky HA, Rennie R, Burrell RE, Logsetty S. Pseudomonas infections in the thermally injured patient. Burns 2004;30(1):3–26. [2] Huang YT, Chang SC, Lauderdale TL, Yang AJ, Wang JT. Molecular epidemiology of carbapenem-resistant Pseudomonas aeruginosa carrying metallo-beta-lactamase genes in Taiwan. Diagn Microbiol Infect Dis 2007;59(2): 211–6. [3] Wolter DJ, Khalaf N, Robledo IE, Va´zquez GJ, Sante MI, Aquino EE, Goering IV, Hanson ND. Surveillance of carbapenem-resistant Pseudomonas aeruginosa isolates. Antimicrob Agents Chemother 2009;53(4): 1660–4. [4] Jabalameli F, Mirsalehian A, Sotoudeh N, Jabalameli L, Aligholi M, Khoramian B, Taherikalani M, Emaneini M. Multiple-locus variable number of tandem repeats (VNTR) fingerprinting (MLVF) and antibacterial resistance profiles of extended spectrum beta lactamase (ESBL) producing Pseudomonas aeruginosa among burnt patients in Tehran. Burns 2011;37(7):1202–7. [5] Lister PD, Wolter DJ, Hanson ND. Antibacterial-resistant Pseudomonas aeruginosa: clinical impact and complex regulation of chromosomally encoded resistance mechanisms. Clin Microbiol Rev 2009;22(4):582–610. [6] Poole K. Pseudomonas aeruginosa: resistance to the max. Front Microbiol 2011;2:65. [7] Poirel L, Nordmann P, Lagrutta E, Cleary T, Munoz-Price LS. Emergence of KPC-producing Pseudomonas aeruginosa in the United States. Antimicrob Agents Chemother 2010;54(10):3072. [8] Rodrı´guez-Martı´nez JM, Poirel L, Nordmann P. Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother 2009;53(11):4783–8. [9] Pica˜o RC, Carrara-Marroni FE, Gales AC, Venaˆncio EJ, Xavier DE, Tognim MC, Pelayo JS. Metallo-b-lactamase-production in meropenem-susceptible Pseudomonas aeruginosa isolates: risk for silent spread. Mem Inst Oswaldo Cruz 2012;107(6):747–51. [10] Khosravi AD, Mihani F. Detection of metallo-betalactamase-producing Pseudomonas aeruginosa strains isolated from burn patients in Ahwaz, Iran. Diagn Microbiol Infect Dis 2008;60(1):125–8. [11] Bahar MA, Jamali S, Samadikuchaksaraei A. Imipenemresistant Pseudomonas aeruginosa strains carry metallo-betalactamase gene bla(VIM) in a level I Iranian burn hospital. Burns 2010;36(6):826–30.

[12] Mahon CR, Lehman DC, Manuselis G. Text book of diagnostic microbiology. 3rd ed. Philadelphia, PA, USA; 2007;564–86. [13] Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing. TwentyFirst Inform Suppl 2011;31:M100-S21. [14] Feizabadi MM, Delfani S, Raji N, Majnooni A, Aligholi M. Distribution of blaTEM, blaSHV, blaCTX-M genes among clinical isolates of Klebsiella pneumoniae at Labbafinejad Hospital, Tehran, Iran. Microb Drug Resist 2010;16(1):49–53. [15] Mirsalehian A, Feizabadi M, Nakhjavani FA, Jabalameli F, Goli H, Kalantari N. Detection of VEB-1, OXA-10 and PER-1 genotypes in extended-spectrum b-lactamase-producing Pseudomonas aeruginosa strains isolated from burn patients. Burns 2010;36:70–4. [16] Strateva T, Ouzounova-Raykova V, Markova B, Todorova A, Marteva-Proevska Y, Mitov I. Problematic clinical isolates of Pseudomonas aeruginosa from the university hospitals in Sofia, Bulgaria: current status of antimicrobial resistance and prevailing resistance mechanisms. J Med Microbiol 2007;56(7):956–63. [17] Fiett J, Baraniak A, Mro´wka A, Fleischer M, Drulis-Kawa Z, Naumiuk L, et al. Molecular epidemiology of acquiredmetallo-betalactamase-producing bacteria in Poland. Antimicrob Agents Chemother 2006;50(3):880–6. [18] Labuschagne DJC, Weldhagen GF, Ehlers MM, Dove MG. Emergence of class 1 integron-associated GES-5 and GES-5like extended-spectrum b-lactamases in clinical isolates of Pseudomonas aeruginosa in South Africa. Int J Antimicrob Agents 2008;31:527–30. [19] Poirel L, Walsh TR, Cuvillier V, Nordmann P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis 2011;70:119–23. [20] Mahenthiralingam E, Campbell ME, Foster J, Lam JS, Speert DP. Random amplified polymorphic DNA typing of Pseudomonas aeruginosa isolates recovered from patients with cystic fibrosis. J Clin Microbiol 1996;34(5):1129. [21] Ruimy R, Genauzeau E, Barnabe C, Beaulieu A, Tibayrenc M, Andremont A. Genetic diversity of Pseudomonas aeruginosa strains isolated from ventilated patients with nosocomial pneumonia, cancer patients with bacteremia, and environmental water. Infect Immun 2001;69(1):584–8. [22] Mokaddas EM, Sanyal SC. Resistance patterns of Pseudomonas aeruginosa to carbapenems and piperacillin/ tazobactam. J Chemother 1999;11(2):93–6. [23] Tawfik AF, Shibl AM, Aljohi MA, Altammami MA, Al-Agamy MH. Distribution of Ambler class A, B and D b-lactamases among Pseudomonas aeruginosa isolates. Burns 2012;38(6):855–60. [24] Pfeifer Y, Cullik A, Witte W. Resistance to cephalosporins and carbapenems in Gram-negative bacterial pathogens. Int J Med Microbiol 2010;300(6):371–9. [25] Falagas ME, Karageorgopoulos DE. Extended-spectrum beta-lactamase-producing organisms. J Hosp Infect 2009;73(4):345–54. [26] Mansour W, Dahmen S, Poirel L, Charfi K, Bettaieb D, Boujaafar N, Bouallegue O. Emergence of SHV-2a extendedspectrum beta-lactamases in clinical isolates of Pseudomonas aeruginosa in a university hospital in Tunisia. Microb Drug Resist 2009;15(4):295–301. [27] Perez F, Endimiani A, Hujer KM, Bonomo RA. The continuing challenge of ESBLs. Curr Opin Pharmacol 2007;7(5):459–69. [28] Yousefi S, Farajnia S, Nahaei MR, Akhi MT, Ghotaslou R, Soroush MH, Naghili B, Jazani NH. Detection of metallo-blactamase-encoding genes among clinical isolates of Pseudomonas aeruginosa in northwest of Iran. Diagn Microbiol Infect Dis 2010;68(3):322–5.

Please cite this article in press as: Neyestanaki DK, et al. Determination of extended spectrum beta-lactamases, metallo-beta-lactamases and AmpC-beta-lactamases among carbapenem resistant Pseudomonas aeruginosa isolated from burn patients. Burns (2014), http://dx.doi.org/ 10.1016/j.burns.2014.02.010

5

JBUR-4303; No. of Pages 6

6

burns xxx (2014) xxx–xxx

[29] Carvalho AP, Albano RM, de Oliveira DN, Cidade DA, Teixeira LM, Marques Ede A. Characterization of an epidemic carbapenem-resistant Pseudomonas aeruginosa producing SPM-1 metallo-beta-lactamase in a hospital located in Rio de Janeiro, Brazil. Microb Drug Resist 2006;12(2):103–8. [30] Campbell M, Mahenthiralingam E, Speert DP. Evaluation of random amplified polymorphic DNA typing of Pseudomonas aeruginosa. J Clin Microbiol 2000;38(12):4614–5.

[31] Lagatolla C, Tonin EA, Monti-Bragadin C, Dolzani L, Gombac F, Bearzi C, Edalucci E, Gionechetti F, Rossolini GM. Endemic carbapenem-resistant Pseudomonas aeruginosa with acquired metallo-beta-lactamase determinants in European hospital. Emerg Infect Dis 2004;10(3): 535–8. [32] Nanvazadeh F, Khosravi AD, Zolfaghari MR, Parhizgari N. Genotyping of Pseudomonas aeruginosa strains isolated from burn patients by RAPD-PCR. Burns 2013;39(7):1409–13.

Please cite this article in press as: Neyestanaki DK, et al. Determination of extended spectrum beta-lactamases, metallo-beta-lactamases and AmpC-beta-lactamases among carbapenem resistant Pseudomonas aeruginosa isolated from burn patients. Burns (2014), http://dx.doi.org/ 10.1016/j.burns.2014.02.010