Determination of hepatitis delta virus RNA by polymerase chain reaction in acute and chronic delta infection

Determination of Hepatitis Delta Virus RNA by Polymerase Chain Reaction in Acute and Chronic Delta Infection ROSENDO JARDI, 1 MARIA BUTI, 2 MONTSERRAT COTRINA, 1 FRANCISCO RODRIGUEZ, ~ H E L E N A ALLENDE, 8 RAFAEL ESTEBAN, 2 AND J A I M E GUARDIA 2

The objective o f this study w a s to e v a l u a t e t h e usefulness o f hepatitis delta virus (HDV) R N A d e t e c t i o n by p o l y m e r a s e c h a i n r e a c t i o n (PCR) in a c u t e a n d c h r o n i c D hepatitis a n d to correlate w i t h HDV-RNA d e t e c t i o n by dot blot a n d h e p a t i c delta antigen. S e r u m s a m p l e s f r o m 33 patients w i t h a c u t e hepatitis B surface a n t i g e n ( H B s A g ) - p o s i t i v e h e p a t i t i s (15 w i t h hepatitis B a n d D coinfection, 8 w i t h H D V superinfection, a n d 10 w i t h a c u t e hepatitis B), 85 p a t i e n t s w i t h c h r o n i c HBsAg-positive hepatitis (73 w i t h c h r o n i c D hepatitis a n d 12 w i t h c h r o n i c B hepatitis), a n d c o n s e c u t i v e s e r u m s a m p l e s f r o m n i n e patients w i t h c h r o n i c D hepatitis t r e a t e d w i t h i n t e r f e r o n alfa-2b w e r e studied. HDV-RNA w a s d e t e c t e d by P C R in 93% o f t h e p a t i e n t s w i t h hepatitis B a n d D coinfection, in 100% o f t h e p a t i e n t s w i t h hepatitis D superinfection, a n d in 1 o f t h e 10 p a t i e n t s w i t h a c u t e hepatitis B w h o s u b s e q u e n t l y s e r o c o n v e r t e d to total a n t i b o d y to hepatitis delta a n t i g e n (HDAg), w h e r e a s HDV-RNA w a s f o u n d by dot blot t e c h n i q u e in 60% o f t h e hepatitis B a n d D c o i n f e c t i o n cases, in 62.5% of t h e p a t i e n t s w i t h hepatitis D superinfection, a n d in n o n e o f t h e a c u t e hepatitis B cases. In c h r o n i c D hepatitis, HDV-RNA tested positive by P C R a s s a y in 97% of patients w i t h intrahepatic HDAg, in o n e patient w i t h u n d e t e c t a b l e h e p a t i c HDAg, a n d in n o n e o f t h e p a t i e n t s w i t h c h r o n i c hepatitis B. In the t r e a t e d patients, HDV-RNA w a s o b s e r v e d to b e c o m e n e g a t i v e by P C R o n l y in t h e t h r e e patients w h o h a d a p e r s i s t e n t r e s p o n s e to interferon. The results o f this s t u d y s h o w that HDV-RNA d e t e r m i n a t i o n by P C R a s s a y is a reliable tool for t h e d i a g n o s i s o f delta i n f e c t i o n a n d a clear i m p r o v e m e n t o v e r o t h e r m e t h o d s for t h e e v a l u a t i o n o f H D V replication a n d r e s p o n s e to antiviral therapy. (HEPATOLOGY1995;21:25-29.)

Hepatitis delta virus (HDV) is a defective RNA virus t h a t requires the helper function of hepatitis B virus (HBV). 1 Chronic D hepatitis is usually diagnosed by the finding of hepatitis delta antigen (HDAg) in liver and/or circulating antibody to HDAg (immunoglobulin [Ig]M and/or IgG antibody to HDAg) in serum. Intrahepatic HDAg is considered the best direct marker for HDV replication, whereas IgG antibody to HDAg does not necessarily indicate ongoing or active delta infection. 2 In recent years, hybridization techniques t h a t allow noninvasive HDV-RNA testing in a variety of biomedical research projects have been developed, and detection of HDV-RNA by dot blot assay has been recently described. However, HDV-RNA detection by dot blot technique has a sensitivity of 80% to 85% compared with intrahepatic HDAg detection. 3-6 The polymerase chain reaction (PCR) assay, an ultrasensitive assay for nucleic acids, has been applied to HDV-RNA detection and shows great potential for the diagnosis and monitoring of chronic D hepatitis. 7-s Our aim was to study HDV-RNA detection by PCR assay in relation to dot blot results and to evaluate the clinical usefulness of this method in diagnosing acute and chronic D hepatitis and in monitoring the response to antiviral treatment. In addition, the use of a quickand-easy nonradioactive immunoassay to detect amplified products was studied. PATIENTS AND METHODS

Two hundred fifty-nine serum samples from 118 subjects who were positive to hepatitis B surface antigen (HBsAg), 33 with acute hepatitis and 85 with chronic hepatitis, were analyzed for HDV-RNA. The chronic D hepatitis cases were selected from 186 patients with this infection examined at Hospital General Universitario Valle HebrSn (Barcelona, Spain) between 1983 and 1993. In addition, nine patients with chronic D hepatitis who were receiving interferon alfa2b therapy were studied. Diagnosis of acute hepatitis was based on symptoms of acute hepatitis and serum alanine aminotransferase (ALT) levels > 10 times the normal value. Diagnosis of acute B and D coinfection was established by the simultaneous presence of serum HBsAg and IgM antibody to hepatitis B core antigen in combination with HDAg, IgM antibody to HDAg, or total anti-HD antibodies. Diagnosis of D superinfection was made on seropositivity of HBsAg and delta markers in the absence of IgM antibody to hepatitis B core antigen. Acute hepatitis

Abbreviations: HDV, hepatitis delta virus; HBV, hepatitis B virus; HDAg, hepatitis delta antigen; Ig, immunoglobulin; PCR, polymerase chain reaction; HBsAg, hepatitis B surface antigen; ALT, alanine aminotransferase; anti-HIV, antibody to human immunodeficiency virus; EIA, enzyme immunoassay; CAH, chronic acute hepatitis. From the Departments of 1Biochemistry,2Hepatology,and 3pathology, Hospital General Universitario Valle Hebr5n, Barcelona, Spain. Received March 12, 1994; accepted July 28, 1994. This study was supported in part by two grants from the Fondo de Investigaciones Sanitarias de la Seguridad Social (FISS-1309-1992 and FISS-900938). Address reprint requests to: Maria Buti, MD, Servicio de Hepatologia, Hospital General Valle HebrSn, Paseo Valle HebrSn s/n, Barcelona 08035, Spain. Copyright © 1995 by the American Association for the Study of Liver Diseases. 0270-9139/95/2101-000553.00/0

25

26 JARDI ET AL B was diagnosed when both HBsAg and IgM antibody to hepatitis B core antigen were detected in the absence of any serum marker of delta infection. In all cases, two serum samples were studied: one obtained within 1 week of symptoms and the second 4 weeks later. Diagnosis of chronic D hepatitis was based on the positivity of serum HBsAg and antibody to HDAg. Chronic hepatitis B was diagnosed by the positivity of HBsAg, a persistent increase of ALT levels for more than 6 months, and/or the presence of hepatic lesions in a histological examination. Finally, the detection of HDV-RNA by PCR assay was studied in nine patients with chronic D hepatitis who received recombinant interferon alfa-2b therapy (Intron A; Schering-Plough Corporation; Country Cork, Ireland), 9,000,000 U three times a week for 6 months2 In each of these patients, 12 consecutive serum samples were analyzed: one before treatment, one at initiation of treatment, one per month for the next 9 months, and one at 1 year after beginning treatment. Methods. HBsAg, hepatitis B e antigen, antibody to the hepatitis B e antigen, and antibody to HDAg were detected by commercial radioimmunoassay (Ausria II, Abbott-HBe, Antidelta; Abbott Laboratories, North Chicago, IL). IgM antibody to hepatitis B core antigen, Igm antibody to HDAg, and HDAg were assayed by enzyme immunoassay (EIA) (AbbottCorab-M, Deltassay IgM, and Deltassay; Pasteur, Paris, France). Antibody to human immunodeficiency virus (antiHIV) was determined by EIA (HIV-1/HIV-2; Abbott Laboratories), and positive results were confirmed by Western blot technique. Serum HBV-DNA and HDV-RNA were analyzed by dot blot hybridization techniques described previously. 5'1° The sensitivity of these methods was 0.5 pg of cloned complementary DNA containing HBV or HDV sequences. One hundred microliters of serum were used for the detection of viral nucleic acids by PCR techniques. Serum HBVDNA was detected by a PCR technique using primers synthesized according to the consensus sequence of the core region as reported previously. The sensitivity of this assay was about 10 -5 pg.~l HDV-RNA was studied by PCR assay according to a previously reported method. 7 Two microliters of extracted RNA were mixed with 50 pmol of antisense primer (5'GAACCCCCTCGAAGGTGGAT 3') and 8 #L of 2.5 mmol/L deoxynucleoside triphosphate; the mixture was heated for 10 minutes at 100°C and quickly chilled on cold ethanol (-70°C). The complementary DNA was synthesized by adding 4 #L of 5× reverse transcriptase buffer, 20 U ribonuclease inhibitor, and 1 U of avian myeloblastosis virus reverse transcriptase (Boehringer Mannheim Biochemicals, Mannheim, Germany). For complementary DNA amplification, 20 #L of reverse transcriptase mixture was added to 8 pL of 10× PCR buffer, 50 pmol of sense primer 5'AGTGGCTCTCCCTTAGCCAT 3 ', and 2.5 U of Taq thermostable polymerase (Boehringer Mannheim). The PCR was performed for 35 cycles in a programmable DNA Thermal Cycler (Perkin Elmer Cetus, Norwalk, CT). The amplified HDV-complementary DNA was analyzed by two techniques: Southern blot hybridization and a DNA EIA (GEN-ETI K; Sorin Biomedica, Salvaggia, Italy). In the Southern blot hybridization, the filters were incubated with a complementary DNA of HDV-RNA cloned in plasmid pSVDL3 (kindly provided by Dr. J. Taylor, Fox Chase Cancer Center, Philadelphia, PA) and labeled with 32p (the radiolabeled probe had a specific activity of l0 s cpm/#g). The conditions for prehybridization, hybridization, and washing were described previously. 5 In the DNA EIA method, the amplified HDV-complementary DNA was hybridized with a nonisoto-

HEPATOLOGYJanuary 1995 pic biotin-labeled probe (5'-CTTCTTTCCTCTTCGGGTCGGCATGGCATCTCCACCTCCT-3') that was synthesized in our laboratory. Hybridization was detected by colorimetric reaction. The cutoff value was determined as the mean +3 SD of the results of 30 replicates of negative samples: a result was considered positive when the optical density was >0.180. To compare the sensitivity of PCR and Southern blot and PCR and DNA EIA techniques in relation to the dot blot hybridization method, we tested in duplicate, decreasing dilutions of about 100 pg of HDV-RNA derived from a positive serum. Needle biopsy specimens of the liver were processed by conventional methods, and sections were stained for HDAg by the peroxidase-antiperoxidase technique (Anti-delta HRP; Sorin Biomedica). Statistical significance was assessed using the Fisher's exact and X2 tests. To compare the sensitivity and specificity of the methods, the Macnemar test was used. A P value of <.05 was considered significant. RESULTS

T h e 33 p a t i e n t s with acute h e p a t i t i s included 15 w i t h B a n d D coinfection, 8 with D superinfection, and 10 w i t h acute h e p a t i t i s B. All the p a t i e n t s w i t h acute hepatitis B a n d D coinfection r e c o v e r e d completely from t h e i r illnesses; d u r i n g the follow-up, H B s A g t e s t e d negative a n d A L T levels r e t u r n e d to normal. All the pat i e n t s with H D V superinfection developed chronic D infection; H B s A g a n d a n t i b o d y to HDAg t e s t e d positive a n d ALT levels r e m a i n e d elevated. The d e m o g r a p h i c a n d serological f e a t u r e s of t h e 33 p a t i e n t s w i t h acute h e p a t i t i s are shown in Table 1. The 85 p a t i e n t s w i t h chronic H B s A g positive included 73 with H D V infection a n d 12 with H B V infection. The characteristics of the p a t i e n t s with chronic hepatitis, including nine p a t i e n t s t r e a t e d w i t h interferon, are s h o w n in Table 2. T h e PCR amplification followed by S o u t h e r n blot or the DNA EIA t e s t showed t h e s a m e sensitivity, which was 10 ~ t i m e s g r e a t e r t h a n dot blot analysis (Fig. 1). T h e t i m e r e q u i r e d for detection of HDV-RNA was 18 to 24 h o u r s for the S o u t h e r n blot t e c h n i q u e a n d 4 to 5 h o u r s for the DNA EIA. In s e r u m samples obtained in t h e first 2 weeks of acute hepatitis, HDV-RNA was positive by t h e dot blot t e c h n i q u e in 9 (60%) of t h e 15 p a t i e n t s with D coinfection, in five (62.5%) of the eight cases of D superinfection, a n d in none of the 10 h e p a t i t i s B p a t i e n t s , w h e r e a s by PCR, HDV-RNA was positive in 14 (93%) of 15 cases w i t h D coinfection, in eight (100%) of the eight w i t h D superinfection a n d in 1 of t h e 10 p a t i e n t s w i t h type B hepatitis. This p a t i e n t s u b s e q u e n t l y s e r o c o n v e r t e d to total a n t i b o d y to HDAg. In the second s e r u m samples, o b t a i n e d 4 weeks later, HDV-RNA was detected by dot blot t e c h n i q u e in six (75%) of the eight D superinfection cases, w h e r e a s P C R a s s a y showed seropositivity to HDV-RNA in all eight (100%) of these cases. In chronic D hepatitis, HDV-RNA was detected b y dot blot t e c h n i q u e in 53 (73%) cases: 52 (76%) of the 68 p a t i e n t s who were hepatic H D A g positive and in one of the five p a t i e n t s who were hepatic HDAg negative. HDV-RNA was positive by P C R in 67 (92%) cases:

HEPATOLOGY Vol. 21, No. 1, 1995

JARDI ET AL

27

TABLE 1. D e m o g r a p h i c a n d S e r o l o g i c a l F e a t u r e s o f 33 P a t i e n t s W i t h A c u t e I n f e c t i o n

Feature Age Sex (male) Intravenous drug addict Serology (first serum sample) HBeAg + HBV-DNA + (by dot-blot) HBV-DNA + (by PCR) HDV-RNA + (by dot-blot) HDV-RNA + (by PCR) Anti-HIV +

Acute B + D Coinfection (N = 15) Mean/N Range / (%)

Acute D Superinfection (N = 8) Mean/N Range/ (%)

Acute Hepatitis B (N = 10) Mean/N Range](%)

21 (17 to 28) 10 (67%) 15 (100%)

21 (16 to 30) 5 (62%) 8 (100%)

19 (17 to 26) 8 (80%) 10 (100%)

7 9 12 9 14 10

(47%) (60%) (80%) (60%) (93%) (67%)

3 4 5 5 8 6

(37%) (50%) (62%) (62%) (100%) (75%)

6 (60%) 7 (70%) 9 (90%) 0 1" 7 (70%)

* This patient subsequently seroconverted to total anti-HD.

66 (97%) of the 68 patients with intrahepatic HDAg and one of the five patients with undetectable hepatic HDAg (the same case that was HDV-RNA positive by dot blot technique). None of the patients with chronic hepatitis B had detectable HDV-RNA by dot blot hybridization or PCR assay. An evaluation of the sensitivity and specificity of HDV-RNA testing by dot-blot and PCR techniques in relation to the presence of hepatic HDAg showed that the PCR technique was more sensitive (97%) than the dot blot technique (76%), but both had the same specificity (80%). HBV-DNA tested seropositive by dot blot hybridization in 33 (45%) of the 73 patients with chronic D hepatitis: 30 (44%) of the 68 with hepatic HDAg and three (60%) of the five without hepatic HDAg. By PCR, HBVDNA was detected in 47 cases: 44 (65%) of those patients with hepatic HDAg and three (60%) patients without HDAg. The histological study of 68 patients with chronic hepatitis who were positive to hepatic HDAg showed chronic active hepatitis (CAH) in 50 cases and cirrhosis in 18 cases. HDV-RNA was detected by dot blot tech-

nique in 76% of patients with CAH and in 78% of patients with cirrhosis, whereas by PCR technique, it was present in 98% of patients with CAH and 94% of patients with cirrhosis. HBV-DNA was detected by dot blot technique in 40% of patients with CAH and in 55% of patients with cirrhosis, whereas by PCR, it was found in 64% of patients with CAH and 67% of patients with cirrhosis. The two viral nucleic acids were simultaneously found by PCR in 60% of patients with CAH and 61% of patients with cirrhosis (Table 3). Of the 68 patients with chronic hepatitis and hepatic HDAg, 48 (70%) tested anti-HIV positive. None of the anti-HIV positive cases had clinical evidence of acquired immunodeficiency syndrome. The presence or absence of anti-HIV in relation to HDV-RNA and HBV-DNA detection by dot blot and PCR techniques is shown in Table 4. Serial serum samples from nine patients with chronic D hepatitis under interferon therapy were analyzed for HDV-RNA by PCR technique. Before treatment, ALT levels were elevated in all of the cases (mean, 186.5 + 131 IU/L), and hepatic HDAg and se-

TABLE 2. D e m o g r a p h i c a n d S e r o l o g i c a l F e a t u r e s o f 94 P a t i e n t s W i t h C h r o n i c H e p a t i t i s

Feature Age Sex (male) Intravenous drug addict Histology CAH Cirrhosis Hepatic HDAg Serology HBeAg + HBV-DNA + (by dot-blot) HBV-DNA + (by PCR) HDV-RNA + (by dot-blot) HDV-RNA + (by PCR) Anti-HIV +

Chronic Delta Hepatitis (N ~ 73) Mean/N Range] (%)

Chronic Delta Hepatitis With Interferon Therapy (N = 9) Mean/ N Range](%)

Chronic Hepatitis B (N = 12) Mean/N Range](%)

26 (11 to 63) 61 (83%) 59 (81%)

23 (21 to 32) 6 (67%) 6 (67%)

29 (23 to 35) 7 (58%) 12 (100%)

54 (74%) 19 (26%) 68 (93%)

7 (78%) 2 (22%) 9 (100%)

23 33 47 53 67 52

2 5 7 9 9 6

(31%) (45%) (64%) (73%) (92%) (71%)

(22%) (55%) (78%) (100%) (100%) (67%)

8 (67%) 4 (33%) 0 5 7 9 0 0 12

(42%) (58%) (75%)

(100%)

28

JARDI ET AL

HEPATOLOGY J a n u a r y 1995 TABLE 4. H D V - R N A a n d H B V - D N A D e t e c t i o n b y D o t - B l o t a n d P C R i n 68 C h r o n i c D e l t a H e p a t i t i s W i t h H e p a t i c H D A g i n R e l a t i o n to P r e s e n c e o f A n t i - H I V

456789

O . D .

Serum Samples

48 Anti-HIV +

20 Anti-HIV -

3.0 iii~ iii~ii:i!i~::~iii~iiiii:i;iiiiiiiii i

i~ii~il ~ ii ~ ~ii!~ ~iiiiiiii

i~

~:~ ii-

2.0

B

:))ii

1 .0 0.18

!

2

3

4

2

3

4

5

HDV-RNA HDV-RNA HBV-DNA HBV-DNA

+ + + +

(by (by (by (by

dot-blot) PCR) dot-blot) PCR)

39 47 27 35

(81%) (98%) (56%) a (73%) c

13 (65%) 19 (95%) 3 (15%) b (45%) d

NOTE. a vs. b, P = .003; c vs. d, P = .049.

cutoff

6

7

8

9

FIG. 1. (A) Comparative analysis of dot-blot, (B) PCR and DNA EIA, and (C) PCR and Southern blot techniques for HDV-RNA detection. Tenfold serial dilutions (from 1 [undiluted] to 9) were made from serum of a patient with chronic delta hepatitis, and HDV-RNA was isolated. (A) Using dot blot analysis, HDV-RNA was positive in samples 1, 2, and 3 and negative in sample 4. (B) Using PCR and DNA EIA, HDV-RNA was positive in samples 4, 5, 6, 7, and 8 and negative in sample 9. (C) PCR a n d Southern blot analysis of the same dilutions with similar results is shown. The cutoffvalue in the DNA EIA test was 0.180 optical density at 450 nm.

rum HDV-RNA were positive. During treatment, ALT levels returned to normal, and HDV-RNA tested negative in five patients; by dot blot technique; however, the response was persistent in only three of the patients. HDV-RNA was positive by PCR in the four nonresponder patients in all the consecutive serum samples analyzed before, during, and after treatment. In the two transient responder patients, HDV-RNA also remained positive by PCR; only in the three cases with a persistent response did HDV-RNA test negative (between months 4 and 6) by PCR. The results of second biopsies of these three patients showed inactive liver disease and negative hepatic HDAg. The evolution of HDV-RNA analyzed by PCR and DNA EIA techniques in a patient with a favorable response to interferon therapy is shown in Fig. 2.

DISCUSSION In various studies, HDV-RNA has been detected by dot blot and Northern hybridization techniques in approximately 80% of patients with chronic D hepatitis. 3'5~ Although these methods give satisfactory results, they require the use of radioactive probes and are confined to the research laboratory. In this study, the technique of PCR amplification of HDV-RNA and the analysis of the product by two different methods, conventional Southern blot and a DNA EIA test, show high sensitivity and specificity. Both these tests detected HDV-RNA in 97% of patients with chronic D hepatitis with detectable hepatic HDAg, in 93% of acute B and D coinfection, and in 100% of patients with acute D superinfection. Moreover, HDV-RNA was shown in one case of chronic D hepatitis in which hepatic HDAg was undetectable. This result concurs with a report by Madejon et a112 in which HDV-RNA was

INTERFERON(9 m U / 3

times week)

CAH

INACTIVE CH

HEPATIC HDAg +

HEPATIC HDAg -

O.D. 2

410 1,5, ~, 3 1 0

UJ a 1

<

< Z

210 121 I 0,5

110

TABLE 3. H D V - R N A a n d H B V . D N A D e t e c t i o n b y D o t - B l o t a n d P C R i n 68 C h r o n i c D e l t a H e p a t i t i s W i t h H e p a t i c H D A g i n R e l a t i o n to H i s t o l o g i c a l D i a g n o s i s

Serum Samples

HDV-RNA HDV-RNA HBV-DNA HBV-DNA HDV-RNA

+ + + + +

(by dot-blot) (by PCR) (by dot-blot) (by PCR) HBV-DNA + (by PCR)

Chronic Active Hepatitis (N = 50) N (%)

38 49 20 32 30

(76%) (98%) (40%) (64%) (60%)

Hepatic Cirrhosis (N = 18) N (%)

14 17 10 12 11

(78%) (94%) (55%) (67%) (61%)

40

~0.180 !i

~

~ 0

10

0

1

2

3

4

HBsAg + ~normal ALT/HDV-RNAnegative

5

6

12

18

24

MONTH8

HBsAg-

FIG. 2. Clinical course of a single patient with a continued response to interferon therapy as evaluated by PCR and DNA EIA. CH, Cirrhosis; O.D., optical density; Cutoff value of the DNA EIA, 0.180 O.D.; ALT normal range, 10 to 40 mU/L. - • - , ALT; +, HDVRNA DEIA.

HEPATOLOGYVol. 21, No. 1, 1995

detected by PCR in some HDAg negative cases. Another point of interest is the influence of human immunodeficiency virus infection in HBV and HDV replication. It has been shown that HBV replication, as evaluated by HBeAg and HBV-DNA detection, is suppressed in most patients during chronic D infection. 13 The present study indicates that HBV replication is more frequent in anti-HIV-positive patients with chronic D hepatitis (HBV-DNA was positive by PCR in 72% of anti-HIV-positive versus 45% of anti-HIVnegative patients). To date, HDV replication in relation to human immunodeficiency virus infection has not been extensively studied. Cassidy et al, 14 using a dot blot technique, found that there are no differences in HDV replication between anti-HIV-positive and -negative patients. However, D~ny et al, s using a PCR technique, described HDV-RNA only in anti-HIV-positive patients. In this study, which includes an important number of anti-HIV-positive patients, we showed differences in HBV but not in HDV replication according to the presence of anti-HIV. A similar percentage of HDV-RNA detection was found by PCR in both the anti-HIV-positive and anti-HIV-negative groups, suggesting that human immunodeficiency virus infection has little influence on HDV replication. From the clinical standpoint, determination of HDVRNA by PCR can be useful in monitoring the response to antiviral treatment. In this study and in another conducted by Cariani et al ~5 HDV-RNA became undetectable by PCR only in patients who became negative for HBsAg and had a continued response to therapy. Using the dot blot technique, we observed the disappearance of HDV-RNA in patients with a transient response, probably because of the lower sensitivity of the method. These results show the usefulness of the PCR method for the therapeutic monitoring of chronic HDV infection. Because HDV-RNA may appear before the detection of anti-HD antibodies, HDV-RNA detection by PCR may provide a sound basis for the early diagnosis of acute D hepatitis. 16 This would be especially useful in patients who are immunosuppressed and patients after undergoing liver transplantation, in which immunologic alterations can make difficult the diagnosis of active HDV replication. In these cases, anti-HD antibodies generally remained positive after liver transplantation; thus, the recurrence of hepatitis D may only be determined by the detection of HDVoRNA by PCR. In other infections, such as HCV, HCV-RNA determination can be used to diagnose HCV reinfection or de novo HCV infection in liver transplantation patients, whereas anti-HCV would still test negative) 7 Finally, in comparing the Southern blot and DNA EIA tests used in combination with the PCR, we found that the DNA EIA has a number of potential advantages. It uses nonradioactive probes, a large number of samples may be assayed in a short amount of time (100 determinations in 4 hours), and it gives semiquantitative results. These characteristics may make general

JARDI ET AL

29

application of the HDV-RNA PCR technique possible for routine clinical use.

Acknowledgment: The authors thank Carme Molinos, Montserrat Gimferer, and Isabel Guilera for their nursing assistance. REFERENCES 1. Rizetto M. The delta agent. HEPATOLOGY1983;3:729-737. 2. Rizetto M, Verme G. Delta hepatitis--present status. J Hepatol 1985; 1:187-193. 3. Smedile A, Rizette M, Denniston I~ Bonino F, Wells F, Verme G, Consolo F, et al. Type D hepatitis: the clinical significance of hepatitis D virus RNA in serum as detected by a hybridizationbased assay. HEPATOLOGY1986;6:1297-1302. 4. Govindarajan S, Gupta S, Valinluck B, Redeker AG. Correlation of IgM anti-HDV to hepatitis delta virus RNA in sera of chronic HDV. HEPATOLOGY1989; 10:34-35. 5. Rashoffer R, Buti M, Esteban R, Jardi R, RoggendorfM. Demonstration of hepatitis D virus RNA in patients with chronic hepatitis. J Infect Dis 1988; 157:191-195. 6. Smedile A, Bergmann KT, Baroudy BM, Wells FV, Purcell RH, Bonino F, Rizetto M, et al. Riboprobe assay for HDV-RNA: a sensitive method for the detection of the HDV genome in clinical serum samples. J Med Virol 1990;30:20-24. 7. Zignego AL, D~ny P, F~ray C, Ponzette A, Gentilini P, Tiollais P, Br~chot C. Amplification of hepatitis delta virus RNA sequence by PCR: a tool for viral detection and cloning. Mol Cell Probes 1990;4:43-51. 8. D~ny P, Lecot C, Jeantils V, Ovaguimiam L, Krivitzky A, Br~chot C. Polymerase chain reaction based detection of hepatitis D virus genome in patients infected with human immunodeficiency virus. J Med Virol 1993;39:214-218. 9. Buti M, Esteban R, Jardi R, Rodrignez F, Allende H, Cotrina M, Guardia J. Treatment of chronic type D hepatitis and concomitant human immunodeficiency infection with alfa interferon. J Hepatol 1992; 14:412-413. 10. Buti M, Jardi R, Rodrignez F, Arranz JA, Casacuberta JM, Sansegundo B, Pnigdomenech P, et al. Digoxygenin labelled DNA probe: a rapid non radioactive method for hepatitis virus DNA detection in serum. Eur J Clin Chem Clin Biochem 1991; 29:380-384. 11. Buti M, Rodriguez F, Genesca J, Arranz JA, Jardi R, Esteban R, Guardia J. Disappearance of serum hepatitis B virus DNA by polymerase chain reaction after adenine arabinoside 5' monophosphate therapy in chronic hepatitis B. Liver 1993;13:136140. 12. Madejon A, Castillo I, Bartolom~ J, Melero M, Campilto ML, Porres J, Moreno A, et al. Detection of HDV-RNA by PCR in serum of patients with chronic HDV infection. J Hepatol 1990; 11:381-384. 13. Chen PJ, Chen DS, Chen CR, Chen YY, Chen Hsu HM, Lai MY, Sung JL. Delta infection in asymptomatic carriers of hepatitis B surface antigen: low prevalence of activity and effective suppression of hepatitis B virus replication. HEPATOLOGY 1988;8:1121-1124. 14. Cassidy WM, Govindarajan S, Gupta S, Valinluck B, Redeker AG. Influence of HIV on chronic hepatitis B and D infection [Abstract]. HEPATOLOGY1989; 10:690. 15. Cariani E, Ravaggi A, Puoti M, Mantero G, Albertini A, Primi D. Evaluation of hepatitis delta virus RNA levels during interferon therapy by analysis of polymerase chain reaction products with a nonradioisotopic hybridization assay. HEPATOLOGY1992; 15:685689. 16. Negro F, Bergmann KF, Baroudy BM, Satterfield WC, Popper H, Purcell RH, Gerin JL. Chronic hepatitis D virus (HDV) infection in hepatitis B virus carrier chimpanzees experimentally superinfected with HDV. J Infect Dis 1988; 158:151-159. 17. Mateo R, Demetris A, Sico E, Fryre C, Wang LF, Sakhawi Y, Reilly M, et al. Early detection of de novo hepatitis C infection in patients after liver transplantation by reverse transcriptase polymerase chain reaction. Surgery 1993; 114:442-448.