- Email: [email protected]
Determination of potent antisense oligonucleotides In Vitro by semiempirical rules
JOURNAL OF BIOSCIENCE AND BIOENGINEERING Vol. 103, No. 3, 270–277. 2007 DOI: 10.1263/jbb.103.270
© 2007, The Society for Biotechnology, Japan
Determination of Potent Antisense Oligonucleotides In Vitro by Semiempirical Rules Naoki Yanagihara,1 Hisashi Tadakuma,1 Yo Ishihama,1 Kohki Okabe,2 and Takashi Funatsu2,3* Major in Integrative Bioscience and Biomedical Engineering, Graduate School of Science and Engineering, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 169-8555, Japan,1 Laboratory of Bio-Analytical Chemistry, Graduate School of Pharmaceutical Sciences, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan,2 and Core Research for Evolutional Science and Technology, Japan Science and Technology Agency, 4-1-8 Honcho, Kawaguchi-shi, Saitama 332-0012, Japan3 Received 20 October 2006/Accepted 25 December 2006
The selection of effective antisense target sites on a given mRNA molecule is a major problem in the detection of target mRNA in oligonucleotide arrays. In general, antisense oligodeoxynucleotides (asODNs) of about 10–20 nucleotides (nt) in length are used. However, the demand for predicting the sequence of potent asODNs much longer than those mentioned above has been increasing. Here, we prepared 40-nt asODNs directed against fluorescence-labeled green fluorescent protein (GFP) mRNA and quantified their hybridization efficiencies by fluorescence microscopy. We found that the hybridization efficiency depended on the TC content or the minimum free energy of the asODNs. On the basis of these findings, a semiempirical parameter called accessibility score was introduced to predict the potency of asODNs. The results of this study aided in the development of an effective two-step procedure for determining mRNA accessibility, namely, the computer-aided selection of asODN binding sites using an accessibility score followed by an experimental procedure for measuring the hybridization efficiencies between the selected asODNs and the target mRNA by fluorescence microscopy. [Key words: antisense oligodeoxynucleotides, fluorescence microscopy, RNA]
potent asODNs would be valuable. Recently, the demand for predicting the hybridization efficiencies of asODNs longer than 20 nucleotide (nt) has been growing. For instance, an invasive cleavage assay for the direct quantification of specific RNAs was developed (11). In this method, the RNA region targeted by both the upstream oligonucleotide and the probe (30–50 nt in length) is much longer than the region predicted by conventional methods. As another example, Hughes et al. (12) reported using microarrays that carefully selected longer oligonucleotides (60mers) and reliably detected transcript ratios at one copy per cell in complex biological samples. Thus, a rapid, inexpensive and reliable method for the prediction of effective, potent and long asODNs would be valuable. We prepared a series of asODNs with activity against GFP and c-fos mRNAs, and evaluated their hybridization efficiencies using fluorescence microscopy. We used 40mer asODNs instead of the frequently used 10–20mer asODNs. On the basis of the results of the hybridization efficiencies, we proposed a semiempirical accessibility score calculated from TC content and the predicted minimum free energy of each asODN. Our method provides an effective two-step procedure for determining potent 40mer asODNs, namely, the computer-aided selection of asODN binding sites using an accessibility score followed by an experimental proce-
Targeting mRNA molecules with antisense oligodeoxynucleotides (asODNs) is an important step in various RNA analysis techniques, such as primer extension, RT-PCR, and RNA invasive cleavage reactions (1). However, the factors that influence antisense potency are poorly understood. Empirically, only a small number of the tested asODNs exhibit effective sequence-specific antisense activity (2, 3). This problem is believed to arise from the various secondary and tertiary structures of mRNA molecules that leave only a small fraction of the mRNA sequences available for efficient asODN hybridization (4). To predict the accessibility of asODNs for target mRNA, systematic in vitro techniques, such as RNase H mapping (5), gel-mobility shift assays (6), techniques using oligonucleotide arrays (7), and random RT priming (8), have been developed. However, the complexity and high cost of these experimental methods triggered the development of theoretical methods for predicting accessible sites using RNA folding programs (9, 10). Although some examples of the successful application of computational methods have been reported, theoretical methods alone are still insufficient for designing potent asODNs. Thus, a rapid, inexpensive and reliable method for the prediction of * Corresponding author. e-mail: [email protected] phone: +81-(0)3-5841-4760 fax: +81-(0)3-5802-3339 270
VOL. 103, 2007
DETERMINATION OF POTENT ANTISENSE OLIGONUCLEOTIDES
271
TABLE 1. Sequences of asODNs Sequence (biotin-5′ → 3′)b Name of asDNA ODNGFP75–114 TTGGGACAACTCCAGTGAAGAGTTCTTCTCCTTTGCTAGC AACTTGTGGCCGTTAACATCACCATCTAATTCAACAAGAA ODNGFP115–154 TCCGTATGTTGCATCACCTTCACCCTCTCCACTGACAGAG ODNGFP155–194 GCAGTTTGCCAGTAGTGCAGATGAACTTCAGGGTAAGTTT ODNGFP195–234 CCATAGCACAGAGTAGTGACTAGTGTTGGCCATGGAACAG ODNGFP235–274 CCGTTTCATATGATCCGGGTATCTTGAAAAGCATTGAACA ODNGFP275–314 GTACATAACCTTCGGGCATGGCACTCTTGAAAAAGTCATG ODNGFP315–354 TTGTAGTTGCCGTCATCTTTGAAGAAGATGGTCCTTTCCT ODNGFP355–394 AACAAGGGTATCACCTTCAAACTTGACTTCAGCACGTGTC ODNGFP395–434 CATCTTCCTTGAAGTCAATACCTTTTAACTCGATTCTATT ODNGFP435–474 GAGTTATAGTTGTATTCCAATTTGTGTCCCAGAATGTTGC ODNGFP475–514 TCCATTCTTTTGTTTGTCTGCCATGATGTATACATTGTGT ODNGFP515–554 CATCTTCAATGTTGTGGCGGGTCTTGAAGTTCACTTTGAT ODNGFP555–594 GGAGTATTTTGTTGATAATGGTCTGCTAGTTGAACGCTTC ODNGFP595–634 GTAATGGTTGTCTGGTAAAAGGACAGGGCCATCGCCAATT ODNGFP635–674 TTTCGTTGGGATCTTTCGAAAGGGCAGATTGTGTGGACAG ODNGFP675–714 GCAGCTGTTACAAACTCAAGAAGGACCATGTGGTCTCTCT ODNGFP715–754 TCAGTTGTACAGTTCATCCATGCCATGTGTAATCCCA ODNGFP755–794 AGGCAAAGCCGGGCGAGGGGCCGAGGGGCGGAGACAGGTG ODNc-fos32–71 GCTGGAGAAGGAGTCTGCGGGTGAGTGGTAGTAAGAGAGG ODNc-fos159–198 GGAGTAAGCCCCAGCGGAGGGGGCGGGGACTCCGAAAGGG ODNc-ofs363–402 CTTGCCCCTCCTGCCAATGCTCTGCGCTCGGCCTCCTGTC ODNc-fos426–465 TCCTTTTCTCTTCTTCTTCTGGAGATAACTGTTCCACCTT ODNc-fos463–502 TCTTATTCCTTTCCCTTCGGATTCTCCTTTTCTCTTCTTC ODNc-fos487–526 ACTCTAGTTTTTCCTTCTCCTTCAGCAGGTTGGCAATCTC ODNc-fos625–664 GGGCCAGCAGCGTGGGTGAGCTGAGCGAGTCAGAGGAAGG ODNc-fos1180–1219 a The numerals indicate the nucleotide positions in the GFP and c-fos mRNA sequences. b The asDNA sequences are complementary to GFP or c-fos mRNA. a
dure for measuring the hybridization efficiencies between the selected asODNs and the target mRNA by fluorescence microscopy. MATERIALS AND METHODS Preparation of fluorescence-labeled mRNAs and asODNs To prepare red-shifted green fluorescent protein (rsGFP) mRNA (796 nt), pQBI63 (Quantum Biotechnologies, Montreal, Quebec, Canada), which contained the rsGFP coding sequence at 71 bp downstream of a T7 promoter transcription initiation site, was digested with BamHI and the linearized plasmid was transcribed using a RiboMAX Large Scale RNA Production System T7 (Promega, Madison, WI, USA). To prepare c-fos mRNA (1284 nt), pBluescriptII KS(−)-c-fos plasmids (kind gifts from Dr. Yoshie Harada, The Tokyo Metropolitan Institute of Medical Science), which contained the c-fos cDNA sequence and a T3 promoter sequence, were digested with HindIII and the linearized plasmids were transcribed using a MEGAscript T3 kit (Ambion, Austin, TX, USA). The AUG start codons were located from 72 to 74 nt (rsGFP) and from 82 to 84 nt (c-fos). The mRNA molecules obtained were labeled with a Cy5 Labeling kit (Label IT; Mirus, Madison, WI, USA), followed by the removal of unreacted dye by gel filtration (Chroma SPIN-100 DEPC-H2O; Clontech, Mountain View, CA, USA). Cy5 and mRNA concentrations were calculated from their absorbances at 650 and 260 nm, respectively, using a spectrofluorometer (FP6500; Jasco, Tokyo). The labeling ratios of Cy5/GFP mRNA and Cy5/c-fos mRNA were 2.2 and 8.5, respectively. Antisense ODNs with biotinylated 5′ ends were purchased from SIGMA Genosys (Ishikari-shi), and their sequences are listed in Table 1. Microscopy An inverted microscope (IX-70; Olympus, Tokyo) was used to quantify the amount of Cy5-labeled mRNA attached to
microbeads coated with the asODNs. Cy5-labeled mRNAs were illuminated with a He-Ne laser (8 mW, 632.8 nm; NEC, Tokyo). The laser beam illuminated a specimen with a diameter of 100 µm using an oil-immersion objective (PlanApo 100×NA=1.4; Olympus). A dichroic mirror (Q570LP; Chroma Technology, Rockingham, VT, USA) and an emission filter (HQ610/75m; Chroma Technology) were used. Fluorescence images were taken using an ICCD video camera (ICCD-350F; Video Scope International, Sterling, VA, USA) coupled to an image intensifier (VS4-1845; Video Scope International) and recorded on S-VHS format videotapes. Images were analyzed using Scion Image (Scion Corporation, Frederick, MD, USA) (13). Quantification of amount of hybridization efficiencies between the asODNs to the target mRNAs The methods used for measuring amount of hybridization efficiencies between the asODNs and the target mRNAs are illustrated in Fig. 1. Biotinylated asODNs (1 µM) were mixed with neutravidin-conjugated microbeads with a diameter of 1 µm (F8777; Molecular Probe, Eugene, OR, USA) in 50 µl of phosphate-buffered saline containing Mg2+ (buffer A; 137 mM NaCl, 2.7 mM KCl, 2 mM MgCl2, 8.1 mM Na2HPO4, 1.5 mM KH2PO4, pH 7.3) and incubated for 15 min. The solution was then centrifuged at 10,000×g for 3 min and the supernatant was discarded. The pellet was suspended in 50 µl of buffer A and centrifuged again. The supernatant was discarded and the pellet was resuspended in 5 µl of buffer A containing 10 mg/ml acetylated bovine serum albumin (acetylated BSA; B2518; Sigma, St. Louis, MO, USA). Then, the solution was mixed with 1 µl of Cy5-labeled GFP mRNA (final concentration, 100 nM) and incubated for an appropriate amount of time (standard incubation time, 90 min). The solution was diluted 10-fold with buffer A, perfused into a flow cell whose surface had been precoated with biotinylated BSA (13) and incubated for 30 s. The neutravidin-conjugated microbeads attached to the glass surface via the biotinylated BSA. The flow cell was washed twice with buffer A and the microbeads were observed by fluorescence microscopy. The amount of Cy5-
272
YANAGIHARA ET AL.
J. BIOSCI. BIOENG.,
FIG. 1. Schematic drawing of methods used for measuring amount of hybridization between asODNs and target mRNAs. Biotinylated asODNs were attached to neutravidin-conjugated microbeads (1 µm in diameter) and then incubated with Cy5-labeled GFP mRNA for 90 min. After washing, the amounts of mRNA attached to the microbeads were determined by fluorescence microscopy. See Materials and Methods for details.
labeled GFP mRNA hybridized to the asODNs on the microbeads was determined by measuring the fluorescence intensity. All procedures were performed at room temperature. Prediction of secondary structures of mRNA To obtain secondary structure predictions for GFP mRNA, we applied the computer program mfold version 3.1 (10). We input the GFP coding sequence (796 bases) and obtained 20 predicted secondary structures calculated for linear mRNA in 1 M NaCl without divalent ions at 37°C, on the basis of free energy minimization. Calculation of minimum free energy of asODNs The free energy of intramolecular folding for each asODN was calculated using mfold version 3.1 and previously reported parameters for DNA folding (10). The calculation was performed assuming the presence of 145 mM Na+ and 2 mM Mg2+ at 25°C. Statistical analysis Pearson correlation-coefficient analysis was performed to assess the associations between variables using the computer program GB-STAT version 7.0 (Dynamic Microsoft Systems, Silver Spring, MD, USA). Values of p<0.05 were considered statistically significant.
RESULTS Time course of hybridization of asODN to GFP mRNA Following the mixing of Cy5-labeled GFP mRNA (100 nM)
FIG. 2. Quantification of amounts of GFP mRNA attached to asODNs. (A) Time course of association of Cy5-labeled GFP mRNA with antisense ODNGFP155–194. (B) Relative fluorescence intensities of Cy5-labeled GFP mRNA attached to various asODNs. The fluorescence intensity of the mRNA attached to ODNGFP435–474 was used as a standard (100%). The mean values of 14 independent experiments are shown. Error bars indicate the standard deviations.
with microbeads coated with an asODN, which was designated ODNGFP155–194, and incubation for various periods, the amounts of hybridized mRNA were measured by fluorescence microscopy. ODNGFP155–194 was selected for this preliminary experiment because it showed efficient hybridization to GFP mRNA. As shown in Fig. 2A, the association reaction was completed within about 50 min. Therefore, the standard incubation time for the following experiments was set at 90 min. Hybridization efficiencies of various asODNs with Cy5-labeled GFP mRNA Microbeads coated with each of the asODNs were individually incubated with Cy5labeled GFP mRNA for 90 min, and the amount of hybridized mRNA was determined by fluorescence microscopy. The relative fluorescence intensities of the microbeads com-
VOL. 103, 2007
DETERMINATION OF POTENT ANTISENSE OLIGONUCLEOTIDES
273
TABLE 2. Characteristic parameters of asODNs Name of asODN ODNGFP75–114 ODNGFP115–154 ODNGFP155–194 ODNGFP195–234 ODNGFP235–274 ODNGFP275–314 ODNGFP315–354 ODNGFP355–394 ODNGFP395–434 ODNGFP435–474 ODNGFP475–514 ODNGFP515–554 ODNGFP555–594 ODNGFP595–634 ODNGFP635–674 ODNGFP675–714 ODNGFP715–754 ODNGFP755–794 ODNc-fos32–71 ODNc-fos159–198 ODNc-ofs363–402 ODNc-fos426–465 ODNc-fos463–502 ODNc-fos487–526 ODNc-fos625–664 ODNc-fos1180–1219
TC content 0.575 0.500 0.650 0.450 0.400 0.500 0.475 0.600 0.525 0.675 0.550 0.675 0.575 0.525 0.425 0.450 0.500 0.595 0.225 0.250 0.275 0.750 0.775 0.900 0.700 0.275
Minimum free energy (kcal/mol) −4.9 −2.8 −0.9 −3.5 −3.9 −3.0 −4.2 −5.2 −2.7 −1.7 −1.2 −1.9 −3.7 −0.5 −4.7 −3.2 −4.7 −0.6 −5.4 −2.9 −7.9 −2.6 −1.5 −1.0 −1.6 −4.8
pared with that of microbeads containing ODNGFP435–474 are shown in Table 2 and Fig. 2B. The signal intensity due to the hybridization of each probe and the mRNA varied considerably. ODNGFP155–194, ODNGFP435–474, ODNGFP475–514, ODNGFP515–554, ODNGFP555–594, ODNGFP595–634, ODNGFP675–714, and ODNGFP755–794 bound a large amount of mRNA, whereas ODNGFP75–114, ODNGFP115–154, ODNGFP195–234, ODNGFP235–274, ODNGFP275–314, ODNGFP315–354, ODNGFP355–394, ODNGFP395–434, ODNGFP635–674, and ODNGFP715–754 only bound a small amount of mRNA. Comparison of predicted secondary structures of GFP mRNA and hybridization efficiencies of asODNs The secondary structures of GFP mRNA were predicted by the computer program mfold version 3.1. A set of 20 suboptimal folding structures were calculated on the basis of free energy minimization. The predicted structures were named fold_1, fold_2 and so on, in increasing order from the lowest predicted free energy. First, we speculated that if the predicted secondary structures were correct, there might be a correlation between the number of bases involved in a single strand of the target sequence and the fluorescence intensity of Cy5-labeled GFP mRNA. However, no correlations were found for any of the predicted secondary structures. Typical results for fold_1 and fold_8 are shown in Fig. 3A and 3B, respectively. Next, we examined the correlation between the number of bases involved in the largest loop and the fluorescence intensity of Cy5-labeled GFP mRNA. Although there was no correlation for fold_1 (the predicted secondary structure with the lowest free energy) (Fig. 3C), correlations were found for fold_8 (p = 0.0076, r = 0.61) (Fig. 3D), fold_10 (p = 0.048, r = 0.47), and fold_13 (p =
Accessibility score −0.16 0.08 0.52 −0.08 −0.19 0.05 −0.16 −0.18 0.12 0.42 0.37 0.39 0.02 0.45 −0.28 −0.03 −0.22 0.51 −0.59 −0.19 −0.91 0.36 0.55 0.75 0.46 −0.45
Fluorescence intensity (mean ± SD) 18.3 ± 4.8 16.1 ± 2.4 68.2 ± 8.5 6.4 ± 1.1 2.1 ± 0.4 15.7 ± 4.2 8.8 ± 1.1 17.2 ± 2.5 16.3 ± 3.1 100.0 ± 22.0 50.6 ± 10.7 58.4 ± 17.8 56.4 ± 7.1 47.3 ± 6.9 3.0 ± 0.9 62.6 ± 11.5 1.3 ± 0.3 75.5 ± 13.3 5.0 ± 0.8 48.2 ± 2.9 5.0 ± 0.6 21.7 ± 1.8 68.1 ± 5.0 137.9 ± 9.1 39.1 ± 4.6 15.0 ± 1.7
0.0079, r = 0.60). Correlation between nucleotide contents of asODNs and degree of hybridization To identify particular features that may be present in the effective asODNs, the fluorescence intensities of Cy5-labeled GFP mRNAs attached to the asODNs were plotted as a function of the TC content (Fig. 4A), GC content (Fig. 4B) and TG content (Fig. 4C) of the asODNs. A single correlation (p = 0.001, r = 0.71) was found between the TC content and the amount of hybridization. Contrary to the results of some reports (14–16), but consistent with those of another report (17), we found no correlation between the amount of hybridization and GC content. Correlation between predicted minimum free energy of asODNs and amount of hybridization The free energy of intramolecular folding for each asODN was calculated using the program mfold version 3.1 using previously described parameters for DNA folding (10). A correlation (p = 0.0008, r = 0.72) was found between the predicted minimum free energy of asODNs and the amount of hybridization (Fig. 5). Specifically, asODNs with a predicted minimum free energy of more than −2 kcal/mol were accessible to target mRNAs, whereas those with a predicted minimum free energy of less than −4 kcal/mol were inaccessible. Definition of accessibility score Because the efficiencies of hybridization depended on both the TC content and the predicted minimum free energy of the asODN, we tried to develop an appropriate function to identify potent asODNs. Accessibility score was defined by a linear combination of the TC content and the predicted minimum free energy as follows.
274
J. BIOSCI. BIOENG.,
YANAGIHARA ET AL.
FIG. 4. Amounts of GFP mRNA attached to asODNs as function of TC content (A), GC content (B) and TG content (C) of asODNs. Correlation coefficients and regression lines are shown in the panels. A linear correlation (p = 0.001, r = 0.71) is only found in panel A.
Accessibility score = x + ky
FIG. 3. Amounts of GFP mRNA attached to asODNs as function of predicted number of bases in single strands (A, B) and number of bases in largest loop in target sequences (C, D). The secondary structures were predicted using mfold version 3.1. (A, C) The predicted secondary structure of fold_1 was used. (B, D) The predicted secondary structure of fold_8 was used. Correlation coefficients (r values) and regression lines are shown in the panels. A linear correlation is present in panel D (p = 0.0076, r = 0.61).
(1)
Here, x is the TC content, y (kcal/mol) is the minimum free energy of the asODN predicted using mfold version 3.1 and k (mol/kcal) is an arbitrary constant. The optimal k between 0.01 and 100 mol/kcal was evaluated by calculating the correlation coefficients of the accessibility score and the fluorescence intensity of Cy5-labeled GFP mRNA. The highest correlation coefficient of 0.81 (p < 0.0001) was obtained when k = 0.15 mol/kcal. Next, the amounts of GFP mRNA attached to the asODNs were plotted as a function of accessibility score (Table 2 and Fig. 6). Prediction of accessible and inaccessible sequences of c-fos mRNA using accessibility score Next, we examined whether prediction using the accessibility score was
VOL. 103, 2007
DETERMINATION OF POTENT ANTISENSE OLIGONUCLEOTIDES
275
DISCUSSION
FIG. 5. Amounts of GFP mRNA attached to asODNs as function of predicted minimum free energy of asODNs. A linear correlation (p = 0.0008, r = 0.72) is recognized. The line indicates the regression line.
FIG. 6. Amounts of mRNA attached to asODNs as function of accessibility score. Closed and open squares indicate the asODNs against GFP and c-fos mRNAs, respectively. A linear correlation between the accessibility score of asODNs against GFP mRNA and the amounts of GFP mRNA attached to asODNs (p< 0.0001, r = 0.81) is obtained. The line indicates the regression line.
applicable to other mRNAs of different sequences and lengths. Specifically, c-fos mRNA (1284 nt) was used as a target sequence, and the accessibility scores of 1245 asODNs were calculated. ODNc-fos426–465, ODNc-fos463– 502, ODNc-fos487–526 and ODNc-fos625–664 were selected as candidates for accessible ODNs, whereas ODNc-fos32–71, ODNc-fos159–198, ODNc-fos363–402 and ODNc-fos1180–1219 were selected as inaccessible candidates. These asODNs were attached to microbeads and amount of hybridization efficiencies between the asODNs to Cy5-labeled c-fos mRNAs were measured as described above. The results are shown in Table 2 and Fig. 6 (open squares). The obtained results revealed that the accessibility score developed on the basis of the GFP mRNA results was also useful for predicting potent asODNs directed against c-fos mRNA. The optimal k for c-fos mRNA was determined by calculating the correlation coefficients of the accessibility score and the fluorescence intensity of Cy5-labeled c-fos mRNA. The highest correlation coefficient of 0.76 (p < 0.05) was obtained when k = 0.1, 0.15 or 0.2 mol/kcal.
In the field of cellular biology, fusion proteins of GFP are widely used and their functions and localizations in cells have been extensively studied. If GFP mRNA can be successfully labeled with fluorescent asODNs, it will be helpful for studying the localizations of GFP fusion proteins and their mRNAs simultaneously. We prepared biotinylated 40mer asODNs directed against all the 40-nt sections of the coding sequence hat cumulatively covered the entire sequence of GFP mRNA. The asODNs were attached to neutravidin-conjugated microbeads, and their hybridization efficiencies with Cy5-labeled GFP mRNA were determined by fluorescence microscopy. This technique proved to be a simple method for distinguishing the effective asODNs. To identify some characteristic features of effective asODNs, specific sequence motifs were examined. Tu et al. (18) reported that a TCCC motif yielded potent asODNs, whereas Sohail et al. (17) reported that TTTC, TCCA and CTTT motifs were present in potent asODNs. Furthermore, highly significant positive correlations between the presence of CCAC, TCCC, ACTC, GCCA and CTCT motifs in oligonucleotides and their antisense efficiencies were also demonstrated (19). In the asODN sequences used in this study, 22 copies of the above-mentioned motifs were present in 8 asODNs that had relatively strong signals (>50%), whereas only 17 copies of the motifs were present in 13 asODNs that had relatively weak signals (< 20%). These motifs were rich in C and T, and this high CT ratio may be the origin of the correlation between the TC content and the hybridization efficiency. It is not clear why the presence of such motifs positively correlated with the potency of asODNs. One possible reason is that pyrimidine-rich oligonucleotides, particularly those that are C-rich, are able to form the most stable DNA-RNA duplexes (20). Next, we focused on the thermodynamic stability of asODNs. Thermodynamic analyses of the entire process of hybridization, including analyses of the free energy of displacing mRNA secondary structures caused by probe binding and the free energy of heteroduplex formation, can be carried out using the computer program OligoWalk (21). However, this process requires a known structure or a set of predicted secondary structures for the mRNA. Because it is difficult to obtain such data, we only calculated the predicted minimum free energy of each asODN. The minimum free energy of an ODN is a good index for evaluating the intra-association of nucleotide pairs. It is generally accepted that heteroduplex formation is primarily constrained by the local secondary structures of mRNAs and that the contribution of the secondary structures of short asODNs is of relatively less importance (5, 7, 22). However, our results indicate that the secondary structures of 40mer asODNs are important. The 40mer asODNs with a predicted minimum free energy of more than −2 kcal/mol were accessible to target mRNAs, whereas those with a predicted minimum free energy of less than −4 kcal/mol were inaccessible. Some asODNs were accessible to the target mRNA, whereas others were inaccessible at a free energy of about −3 kcal/mol. This difference may be ascribed to the secondary structures of the mRNA.
276
YANAGIHARA ET AL.
Next, we compared our results with the secondary structures predicted by Smith et al. (23). They predicted lowenergy secondary structures of folded rsGFP mRNA using mfold, and calculated the percentage of these structures in which a particular base was involved in intramolecular hybridization. Their results are not fully consistent with our experimental results, indicating the limitations of secondary structure prediction using computational methods alone. On the other hand, Luebke et al. (24) hybridized fluorescencelabeled GFP mRNA to 21mer ODN combinatorial arrays, and determined the hybridization efficiencies of 755 different probes for the GFP transcript. Although the hybridization signal corresponding to ODNGFP155–194 showed a similar result to that of the present result, the other signals differed. One possible reason for these differences is the sequences, because they used wild-type GFP whereas we used rsGFP. Another reason could be the difference in ODN length, because they used 21mer probes whereas we used 40mer probes. Our 40mer probes, which targeted sequences other than 155–194, also bound to GFP mRNA presumably because the affinities of 40mer probes for mRNA were higher than those of 20mer probes. Taken together, these results suggest the importance of asODN length. In typical antisense experiments, short 10– 20mer asODNs have been used to monitor the very local structure of target mRNA. Recently, a wider range of information on mRNAs and methods for designing longer asODNs have become necessary. Our method provides an effective two-step procedure for determining potent 40mer asODNs, namely, the computer-aided selection of asODN binding sites defined by an accessibility score followed by an experimental procedure for measuring the hybridization efficiencies of the selected asODNs and the mRNA by fluorescence microscopy. Our method will be of great value because it is simple, economical and effective. ACKNOWLEDGMENTS We thank Yoshie Harada for providing the plasmid containing c-fos, and Makoto Tsunoda and Mai Yamagishi for their critical reading of the manuscript. This work was partly supported by Grants-in-Aid for Specially Promoted Research, Scientific Research Priority Area (A) nos. 14035249 and 15030238 and Scientific Research (B) no. 11480196 from the Ministry of Education, Culture, Sports, Science and Technology of Japan.
REFERENCES 1. Kwiatkowski, R. W., Lyamichev, V., de Arruda, M., and Neri, B.: Clinical, genetic, and pharmacogenetic applications of the Invader assay. Mol. Diagn., 4, 353–364 (1999). 2. Monia, B. P., Johnston, J. F., Ecker, D. J., Zounes, M. A., Lima, W. F., and Freier, S. M.: Selective inhibition of mutant Ha-ras mRNA expression by antisense oligonucleotides. J. Biol. Chem., 267, 19954–19962 (1992). 3. Matveeva, O., Felden, B., Tsodikov, A., Johnston, J., Monia, B. P., Atkins, J. F., Gesteland, R. F., and Freier, S. M.: Prediction of antisense oligonucleotide efficacy by in vitro methods. Nat. Biotechnol., 16, 1374–1375 (1998). 4. Vickers, T. A., Wyatt, J. R., and Freier, S. M.: Effects of RNA secondary structure on cellular antisense activity. Nucleic Acids Res., 28, 1340–1347 (2000).
J. BIOSCI. BIOENG.,
5. Ho, S. P., Bao, Y., Lesher, T., Malhotra, R., Ma, L. Y., Fluharty, S. J., and Sakai, R. R.: Mapping of RNA accessible sites for antisense experiments with oligonucleotide libraries. Nat. Biotechnol., 16, 59–63 (1998). 6. Matveeva, O., Felden, B., Audlin, S., Gesteland, R. F., and Atkins, J. F.: A rapid in vitro method for obtaining RNA accessibility patterns for complementary DNA probes: correlation with an intracellular pattern and known RNA structures. Nucleic Acids Res., 25, 5010–5006 (1997). 7. Milner, N., Mir, K. U., and Southern, E. M.: Selecting effective antisense reagents on combinatorial oligonucleotide arrays. Nat. Biotechnol., 15, 537–541 (1997). 8. Allawi, H. T., Dong, F., Ip, H. S., Neri, B. P., and Lyamichev, V. I.: Mapping of RNA accessible sites by extension of random oligonucleotide libraries with reverse transcriptase. RNA, 7, 314–327 (2001). 9. Patzel, V., Steidl, U., Kronenwett, R., Haas, R., and Sczakiel, G.: A theoretical approach to select effective antisense oligodeoxyribonucleotides at high statistical probability. Nucleic Acids Res., 27, 4328–4334 (1999). 10. Zuker, M.: Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res., 31, 3406–3415 (2003). 11. Eis, P. S., Olson, M. C., Takova, T., Curtis, M. L., Olson, S. M., Vener, T. I., Ip, H. S., Vedvik, K. L., Bartholomay, C. T., Allawi, H. T., Ma, W. P., Hall, J. G., Morin, M. D., Rushmore, T. H., Lyamichev, V. I., and Kwiatkowski, R. W.: An invasive cleavage assay for direct quantitation of specific RNAs. Nat. Biotechnol., 19, 673–676 (2001). 12. Hughes, T. R., Mao, M., Jones, A. R., Burchard, J., Marton, M. J., Shannon, K. W., Lefkowitz, S. M., Ziman, M., Schelter, J. M., Meyer, M. R., and other 14 authors: Expression profiling using microarrays fabricated by an inkjet oligonucleotide synthesizer. Nat. Biotechnol., 19, 342–347 (2001). 13. Taguchi, H., Ueno, T., Tadakuma, H., Yoshida, M., and Funatsu, T.: Single-molecule observation of protein-protein interactions in the chaperonin system. Nat. Biotechnol., 19, 861–865 (2001). 14. Smetsers, T. F., Boezeman, J. B., and Mensink, E. J.: Bias in nucleotide composition of antisense oligonucleotides. Antisense Nucleic Acid Drug Dev., 6, 63–67 (1996). 15. Ho, S. P., Britton, D. H., Stone, B. A., Behrens, D. L., Leffet, L. M., Hobbs, F. W., Miller, J. A., and Trainor, G. L.: Potent antisense oligonucleotides to the human multidrug resistance-1 mRNA are rationally selected by mapping RNA-accessible sites with oligonucleotide libraries. Nucleic Acids Res., 24, 1901–1907 (1996). 16. Agrawal, S.: Importance of nucleotide sequence and chemical modifications of antisense oligonucleotides. Biochim. Biophys. Acta, 1489, 53–68 (1999). 17. Sohail, M., Hochegger, H., Klotzbucher, A., Guellec, R. L., Hunt, T., and Southern, E. M.: Antisense oligonucleotides selected by hybridisation to scanning arrays are effective reagents in vivo. Nucleic Acids Res., 29, 2041–2051 (2001). 18. Tu, G. C., Cao, Q. N., Zhou, F., and Israel, Y.: Tetranucleotide GGGA motif in primary RNA transcripts. Novel target site for antisense design. J. Biol. Chem., 273, 25125–25131 (1998). 19. Matveeva, O. V., Tsodikov, A. D., Giddings, M., Freier, S. M., Wyatt, J. R., Spiridonov, A. N., Shabalina, S. A., Gesteland, R. F., and Atkins, J. F.: Identification of sequence motifs in oligonucleotides whose presence is correlated with antisense activity. Nucleic Acids Res., 28, 2862– 2865 (2000). 20. Lesnik, E. A. and Freier, S. M.: Relative thermodynamic stability of DNA, RNA, and DNA:RNA hybrid duplexes: relationship with base composition and structure. Biochemistry,
VOL. 103, 2007
DETERMINATION OF POTENT ANTISENSE OLIGONUCLEOTIDES
34, 10807–10815 (1995). 21. Mathews, D. H., Burkard, M. E., Freier, S. M., Wyatt, J. R., and Turner, D. H.: Predicting oligonucleotide affinity to nucleic acid targets. RNA, 5, 1458–1469 (1999). 22. Patzel, V. and Sczakiel, G.: Theoretical design of antisense RNA structures substantially improves annealing kinetics and efficacy in human cells. Nat. Biotechnol., 16, 64–68 (1998).
277
23. Smith, L., Andersen, K. B., Hovgaard, L., and Jaroszewski, J. W.: Rational selection of antisense oligonucleotide sequences. Eur. J. Pharm. Sci., 11, 191–198 (2000). 24. Luebke, K. J., Balog, R. P., and Garner, H. R.: Prioritized selection of oligodeoxyribonucleotide probes for efficient hybridization to RNA transcripts. Nucleic Acids Res., 31, 750– 758 (2003).
© 2007, The Society for Biotechnology, Japan
Determination of Potent Antisense Oligonucleotides In Vitro by Semiempirical Rules Naoki Yanagihara,1 Hisashi Tadakuma,1 Yo Ishihama,1 Kohki Okabe,2 and Takashi Funatsu2,3* Major in Integrative Bioscience and Biomedical Engineering, Graduate School of Science and Engineering, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 169-8555, Japan,1 Laboratory of Bio-Analytical Chemistry, Graduate School of Pharmaceutical Sciences, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan,2 and Core Research for Evolutional Science and Technology, Japan Science and Technology Agency, 4-1-8 Honcho, Kawaguchi-shi, Saitama 332-0012, Japan3 Received 20 October 2006/Accepted 25 December 2006
The selection of effective antisense target sites on a given mRNA molecule is a major problem in the detection of target mRNA in oligonucleotide arrays. In general, antisense oligodeoxynucleotides (asODNs) of about 10–20 nucleotides (nt) in length are used. However, the demand for predicting the sequence of potent asODNs much longer than those mentioned above has been increasing. Here, we prepared 40-nt asODNs directed against fluorescence-labeled green fluorescent protein (GFP) mRNA and quantified their hybridization efficiencies by fluorescence microscopy. We found that the hybridization efficiency depended on the TC content or the minimum free energy of the asODNs. On the basis of these findings, a semiempirical parameter called accessibility score was introduced to predict the potency of asODNs. The results of this study aided in the development of an effective two-step procedure for determining mRNA accessibility, namely, the computer-aided selection of asODN binding sites using an accessibility score followed by an experimental procedure for measuring the hybridization efficiencies between the selected asODNs and the target mRNA by fluorescence microscopy. [Key words: antisense oligodeoxynucleotides, fluorescence microscopy, RNA]
potent asODNs would be valuable. Recently, the demand for predicting the hybridization efficiencies of asODNs longer than 20 nucleotide (nt) has been growing. For instance, an invasive cleavage assay for the direct quantification of specific RNAs was developed (11). In this method, the RNA region targeted by both the upstream oligonucleotide and the probe (30–50 nt in length) is much longer than the region predicted by conventional methods. As another example, Hughes et al. (12) reported using microarrays that carefully selected longer oligonucleotides (60mers) and reliably detected transcript ratios at one copy per cell in complex biological samples. Thus, a rapid, inexpensive and reliable method for the prediction of effective, potent and long asODNs would be valuable. We prepared a series of asODNs with activity against GFP and c-fos mRNAs, and evaluated their hybridization efficiencies using fluorescence microscopy. We used 40mer asODNs instead of the frequently used 10–20mer asODNs. On the basis of the results of the hybridization efficiencies, we proposed a semiempirical accessibility score calculated from TC content and the predicted minimum free energy of each asODN. Our method provides an effective two-step procedure for determining potent 40mer asODNs, namely, the computer-aided selection of asODN binding sites using an accessibility score followed by an experimental proce-
Targeting mRNA molecules with antisense oligodeoxynucleotides (asODNs) is an important step in various RNA analysis techniques, such as primer extension, RT-PCR, and RNA invasive cleavage reactions (1). However, the factors that influence antisense potency are poorly understood. Empirically, only a small number of the tested asODNs exhibit effective sequence-specific antisense activity (2, 3). This problem is believed to arise from the various secondary and tertiary structures of mRNA molecules that leave only a small fraction of the mRNA sequences available for efficient asODN hybridization (4). To predict the accessibility of asODNs for target mRNA, systematic in vitro techniques, such as RNase H mapping (5), gel-mobility shift assays (6), techniques using oligonucleotide arrays (7), and random RT priming (8), have been developed. However, the complexity and high cost of these experimental methods triggered the development of theoretical methods for predicting accessible sites using RNA folding programs (9, 10). Although some examples of the successful application of computational methods have been reported, theoretical methods alone are still insufficient for designing potent asODNs. Thus, a rapid, inexpensive and reliable method for the prediction of * Corresponding author. e-mail: [email protected] phone: +81-(0)3-5841-4760 fax: +81-(0)3-5802-3339 270
VOL. 103, 2007
DETERMINATION OF POTENT ANTISENSE OLIGONUCLEOTIDES
271
TABLE 1. Sequences of asODNs Sequence (biotin-5′ → 3′)b Name of asDNA ODNGFP75–114 TTGGGACAACTCCAGTGAAGAGTTCTTCTCCTTTGCTAGC AACTTGTGGCCGTTAACATCACCATCTAATTCAACAAGAA ODNGFP115–154 TCCGTATGTTGCATCACCTTCACCCTCTCCACTGACAGAG ODNGFP155–194 GCAGTTTGCCAGTAGTGCAGATGAACTTCAGGGTAAGTTT ODNGFP195–234 CCATAGCACAGAGTAGTGACTAGTGTTGGCCATGGAACAG ODNGFP235–274 CCGTTTCATATGATCCGGGTATCTTGAAAAGCATTGAACA ODNGFP275–314 GTACATAACCTTCGGGCATGGCACTCTTGAAAAAGTCATG ODNGFP315–354 TTGTAGTTGCCGTCATCTTTGAAGAAGATGGTCCTTTCCT ODNGFP355–394 AACAAGGGTATCACCTTCAAACTTGACTTCAGCACGTGTC ODNGFP395–434 CATCTTCCTTGAAGTCAATACCTTTTAACTCGATTCTATT ODNGFP435–474 GAGTTATAGTTGTATTCCAATTTGTGTCCCAGAATGTTGC ODNGFP475–514 TCCATTCTTTTGTTTGTCTGCCATGATGTATACATTGTGT ODNGFP515–554 CATCTTCAATGTTGTGGCGGGTCTTGAAGTTCACTTTGAT ODNGFP555–594 GGAGTATTTTGTTGATAATGGTCTGCTAGTTGAACGCTTC ODNGFP595–634 GTAATGGTTGTCTGGTAAAAGGACAGGGCCATCGCCAATT ODNGFP635–674 TTTCGTTGGGATCTTTCGAAAGGGCAGATTGTGTGGACAG ODNGFP675–714 GCAGCTGTTACAAACTCAAGAAGGACCATGTGGTCTCTCT ODNGFP715–754 TCAGTTGTACAGTTCATCCATGCCATGTGTAATCCCA ODNGFP755–794 AGGCAAAGCCGGGCGAGGGGCCGAGGGGCGGAGACAGGTG ODNc-fos32–71 GCTGGAGAAGGAGTCTGCGGGTGAGTGGTAGTAAGAGAGG ODNc-fos159–198 GGAGTAAGCCCCAGCGGAGGGGGCGGGGACTCCGAAAGGG ODNc-ofs363–402 CTTGCCCCTCCTGCCAATGCTCTGCGCTCGGCCTCCTGTC ODNc-fos426–465 TCCTTTTCTCTTCTTCTTCTGGAGATAACTGTTCCACCTT ODNc-fos463–502 TCTTATTCCTTTCCCTTCGGATTCTCCTTTTCTCTTCTTC ODNc-fos487–526 ACTCTAGTTTTTCCTTCTCCTTCAGCAGGTTGGCAATCTC ODNc-fos625–664 GGGCCAGCAGCGTGGGTGAGCTGAGCGAGTCAGAGGAAGG ODNc-fos1180–1219 a The numerals indicate the nucleotide positions in the GFP and c-fos mRNA sequences. b The asDNA sequences are complementary to GFP or c-fos mRNA. a
dure for measuring the hybridization efficiencies between the selected asODNs and the target mRNA by fluorescence microscopy. MATERIALS AND METHODS Preparation of fluorescence-labeled mRNAs and asODNs To prepare red-shifted green fluorescent protein (rsGFP) mRNA (796 nt), pQBI63 (Quantum Biotechnologies, Montreal, Quebec, Canada), which contained the rsGFP coding sequence at 71 bp downstream of a T7 promoter transcription initiation site, was digested with BamHI and the linearized plasmid was transcribed using a RiboMAX Large Scale RNA Production System T7 (Promega, Madison, WI, USA). To prepare c-fos mRNA (1284 nt), pBluescriptII KS(−)-c-fos plasmids (kind gifts from Dr. Yoshie Harada, The Tokyo Metropolitan Institute of Medical Science), which contained the c-fos cDNA sequence and a T3 promoter sequence, were digested with HindIII and the linearized plasmids were transcribed using a MEGAscript T3 kit (Ambion, Austin, TX, USA). The AUG start codons were located from 72 to 74 nt (rsGFP) and from 82 to 84 nt (c-fos). The mRNA molecules obtained were labeled with a Cy5 Labeling kit (Label IT; Mirus, Madison, WI, USA), followed by the removal of unreacted dye by gel filtration (Chroma SPIN-100 DEPC-H2O; Clontech, Mountain View, CA, USA). Cy5 and mRNA concentrations were calculated from their absorbances at 650 and 260 nm, respectively, using a spectrofluorometer (FP6500; Jasco, Tokyo). The labeling ratios of Cy5/GFP mRNA and Cy5/c-fos mRNA were 2.2 and 8.5, respectively. Antisense ODNs with biotinylated 5′ ends were purchased from SIGMA Genosys (Ishikari-shi), and their sequences are listed in Table 1. Microscopy An inverted microscope (IX-70; Olympus, Tokyo) was used to quantify the amount of Cy5-labeled mRNA attached to
microbeads coated with the asODNs. Cy5-labeled mRNAs were illuminated with a He-Ne laser (8 mW, 632.8 nm; NEC, Tokyo). The laser beam illuminated a specimen with a diameter of 100 µm using an oil-immersion objective (PlanApo 100×NA=1.4; Olympus). A dichroic mirror (Q570LP; Chroma Technology, Rockingham, VT, USA) and an emission filter (HQ610/75m; Chroma Technology) were used. Fluorescence images were taken using an ICCD video camera (ICCD-350F; Video Scope International, Sterling, VA, USA) coupled to an image intensifier (VS4-1845; Video Scope International) and recorded on S-VHS format videotapes. Images were analyzed using Scion Image (Scion Corporation, Frederick, MD, USA) (13). Quantification of amount of hybridization efficiencies between the asODNs to the target mRNAs The methods used for measuring amount of hybridization efficiencies between the asODNs and the target mRNAs are illustrated in Fig. 1. Biotinylated asODNs (1 µM) were mixed with neutravidin-conjugated microbeads with a diameter of 1 µm (F8777; Molecular Probe, Eugene, OR, USA) in 50 µl of phosphate-buffered saline containing Mg2+ (buffer A; 137 mM NaCl, 2.7 mM KCl, 2 mM MgCl2, 8.1 mM Na2HPO4, 1.5 mM KH2PO4, pH 7.3) and incubated for 15 min. The solution was then centrifuged at 10,000×g for 3 min and the supernatant was discarded. The pellet was suspended in 50 µl of buffer A and centrifuged again. The supernatant was discarded and the pellet was resuspended in 5 µl of buffer A containing 10 mg/ml acetylated bovine serum albumin (acetylated BSA; B2518; Sigma, St. Louis, MO, USA). Then, the solution was mixed with 1 µl of Cy5-labeled GFP mRNA (final concentration, 100 nM) and incubated for an appropriate amount of time (standard incubation time, 90 min). The solution was diluted 10-fold with buffer A, perfused into a flow cell whose surface had been precoated with biotinylated BSA (13) and incubated for 30 s. The neutravidin-conjugated microbeads attached to the glass surface via the biotinylated BSA. The flow cell was washed twice with buffer A and the microbeads were observed by fluorescence microscopy. The amount of Cy5-
272
YANAGIHARA ET AL.
J. BIOSCI. BIOENG.,
FIG. 1. Schematic drawing of methods used for measuring amount of hybridization between asODNs and target mRNAs. Biotinylated asODNs were attached to neutravidin-conjugated microbeads (1 µm in diameter) and then incubated with Cy5-labeled GFP mRNA for 90 min. After washing, the amounts of mRNA attached to the microbeads were determined by fluorescence microscopy. See Materials and Methods for details.
labeled GFP mRNA hybridized to the asODNs on the microbeads was determined by measuring the fluorescence intensity. All procedures were performed at room temperature. Prediction of secondary structures of mRNA To obtain secondary structure predictions for GFP mRNA, we applied the computer program mfold version 3.1 (10). We input the GFP coding sequence (796 bases) and obtained 20 predicted secondary structures calculated for linear mRNA in 1 M NaCl without divalent ions at 37°C, on the basis of free energy minimization. Calculation of minimum free energy of asODNs The free energy of intramolecular folding for each asODN was calculated using mfold version 3.1 and previously reported parameters for DNA folding (10). The calculation was performed assuming the presence of 145 mM Na+ and 2 mM Mg2+ at 25°C. Statistical analysis Pearson correlation-coefficient analysis was performed to assess the associations between variables using the computer program GB-STAT version 7.0 (Dynamic Microsoft Systems, Silver Spring, MD, USA). Values of p<0.05 were considered statistically significant.
RESULTS Time course of hybridization of asODN to GFP mRNA Following the mixing of Cy5-labeled GFP mRNA (100 nM)
FIG. 2. Quantification of amounts of GFP mRNA attached to asODNs. (A) Time course of association of Cy5-labeled GFP mRNA with antisense ODNGFP155–194. (B) Relative fluorescence intensities of Cy5-labeled GFP mRNA attached to various asODNs. The fluorescence intensity of the mRNA attached to ODNGFP435–474 was used as a standard (100%). The mean values of 14 independent experiments are shown. Error bars indicate the standard deviations.
with microbeads coated with an asODN, which was designated ODNGFP155–194, and incubation for various periods, the amounts of hybridized mRNA were measured by fluorescence microscopy. ODNGFP155–194 was selected for this preliminary experiment because it showed efficient hybridization to GFP mRNA. As shown in Fig. 2A, the association reaction was completed within about 50 min. Therefore, the standard incubation time for the following experiments was set at 90 min. Hybridization efficiencies of various asODNs with Cy5-labeled GFP mRNA Microbeads coated with each of the asODNs were individually incubated with Cy5labeled GFP mRNA for 90 min, and the amount of hybridized mRNA was determined by fluorescence microscopy. The relative fluorescence intensities of the microbeads com-
VOL. 103, 2007
DETERMINATION OF POTENT ANTISENSE OLIGONUCLEOTIDES
273
TABLE 2. Characteristic parameters of asODNs Name of asODN ODNGFP75–114 ODNGFP115–154 ODNGFP155–194 ODNGFP195–234 ODNGFP235–274 ODNGFP275–314 ODNGFP315–354 ODNGFP355–394 ODNGFP395–434 ODNGFP435–474 ODNGFP475–514 ODNGFP515–554 ODNGFP555–594 ODNGFP595–634 ODNGFP635–674 ODNGFP675–714 ODNGFP715–754 ODNGFP755–794 ODNc-fos32–71 ODNc-fos159–198 ODNc-ofs363–402 ODNc-fos426–465 ODNc-fos463–502 ODNc-fos487–526 ODNc-fos625–664 ODNc-fos1180–1219
TC content 0.575 0.500 0.650 0.450 0.400 0.500 0.475 0.600 0.525 0.675 0.550 0.675 0.575 0.525 0.425 0.450 0.500 0.595 0.225 0.250 0.275 0.750 0.775 0.900 0.700 0.275
Minimum free energy (kcal/mol) −4.9 −2.8 −0.9 −3.5 −3.9 −3.0 −4.2 −5.2 −2.7 −1.7 −1.2 −1.9 −3.7 −0.5 −4.7 −3.2 −4.7 −0.6 −5.4 −2.9 −7.9 −2.6 −1.5 −1.0 −1.6 −4.8
pared with that of microbeads containing ODNGFP435–474 are shown in Table 2 and Fig. 2B. The signal intensity due to the hybridization of each probe and the mRNA varied considerably. ODNGFP155–194, ODNGFP435–474, ODNGFP475–514, ODNGFP515–554, ODNGFP555–594, ODNGFP595–634, ODNGFP675–714, and ODNGFP755–794 bound a large amount of mRNA, whereas ODNGFP75–114, ODNGFP115–154, ODNGFP195–234, ODNGFP235–274, ODNGFP275–314, ODNGFP315–354, ODNGFP355–394, ODNGFP395–434, ODNGFP635–674, and ODNGFP715–754 only bound a small amount of mRNA. Comparison of predicted secondary structures of GFP mRNA and hybridization efficiencies of asODNs The secondary structures of GFP mRNA were predicted by the computer program mfold version 3.1. A set of 20 suboptimal folding structures were calculated on the basis of free energy minimization. The predicted structures were named fold_1, fold_2 and so on, in increasing order from the lowest predicted free energy. First, we speculated that if the predicted secondary structures were correct, there might be a correlation between the number of bases involved in a single strand of the target sequence and the fluorescence intensity of Cy5-labeled GFP mRNA. However, no correlations were found for any of the predicted secondary structures. Typical results for fold_1 and fold_8 are shown in Fig. 3A and 3B, respectively. Next, we examined the correlation between the number of bases involved in the largest loop and the fluorescence intensity of Cy5-labeled GFP mRNA. Although there was no correlation for fold_1 (the predicted secondary structure with the lowest free energy) (Fig. 3C), correlations were found for fold_8 (p = 0.0076, r = 0.61) (Fig. 3D), fold_10 (p = 0.048, r = 0.47), and fold_13 (p =
Accessibility score −0.16 0.08 0.52 −0.08 −0.19 0.05 −0.16 −0.18 0.12 0.42 0.37 0.39 0.02 0.45 −0.28 −0.03 −0.22 0.51 −0.59 −0.19 −0.91 0.36 0.55 0.75 0.46 −0.45
Fluorescence intensity (mean ± SD) 18.3 ± 4.8 16.1 ± 2.4 68.2 ± 8.5 6.4 ± 1.1 2.1 ± 0.4 15.7 ± 4.2 8.8 ± 1.1 17.2 ± 2.5 16.3 ± 3.1 100.0 ± 22.0 50.6 ± 10.7 58.4 ± 17.8 56.4 ± 7.1 47.3 ± 6.9 3.0 ± 0.9 62.6 ± 11.5 1.3 ± 0.3 75.5 ± 13.3 5.0 ± 0.8 48.2 ± 2.9 5.0 ± 0.6 21.7 ± 1.8 68.1 ± 5.0 137.9 ± 9.1 39.1 ± 4.6 15.0 ± 1.7
0.0079, r = 0.60). Correlation between nucleotide contents of asODNs and degree of hybridization To identify particular features that may be present in the effective asODNs, the fluorescence intensities of Cy5-labeled GFP mRNAs attached to the asODNs were plotted as a function of the TC content (Fig. 4A), GC content (Fig. 4B) and TG content (Fig. 4C) of the asODNs. A single correlation (p = 0.001, r = 0.71) was found between the TC content and the amount of hybridization. Contrary to the results of some reports (14–16), but consistent with those of another report (17), we found no correlation between the amount of hybridization and GC content. Correlation between predicted minimum free energy of asODNs and amount of hybridization The free energy of intramolecular folding for each asODN was calculated using the program mfold version 3.1 using previously described parameters for DNA folding (10). A correlation (p = 0.0008, r = 0.72) was found between the predicted minimum free energy of asODNs and the amount of hybridization (Fig. 5). Specifically, asODNs with a predicted minimum free energy of more than −2 kcal/mol were accessible to target mRNAs, whereas those with a predicted minimum free energy of less than −4 kcal/mol were inaccessible. Definition of accessibility score Because the efficiencies of hybridization depended on both the TC content and the predicted minimum free energy of the asODN, we tried to develop an appropriate function to identify potent asODNs. Accessibility score was defined by a linear combination of the TC content and the predicted minimum free energy as follows.
274
J. BIOSCI. BIOENG.,
YANAGIHARA ET AL.
FIG. 4. Amounts of GFP mRNA attached to asODNs as function of TC content (A), GC content (B) and TG content (C) of asODNs. Correlation coefficients and regression lines are shown in the panels. A linear correlation (p = 0.001, r = 0.71) is only found in panel A.
Accessibility score = x + ky
FIG. 3. Amounts of GFP mRNA attached to asODNs as function of predicted number of bases in single strands (A, B) and number of bases in largest loop in target sequences (C, D). The secondary structures were predicted using mfold version 3.1. (A, C) The predicted secondary structure of fold_1 was used. (B, D) The predicted secondary structure of fold_8 was used. Correlation coefficients (r values) and regression lines are shown in the panels. A linear correlation is present in panel D (p = 0.0076, r = 0.61).
(1)
Here, x is the TC content, y (kcal/mol) is the minimum free energy of the asODN predicted using mfold version 3.1 and k (mol/kcal) is an arbitrary constant. The optimal k between 0.01 and 100 mol/kcal was evaluated by calculating the correlation coefficients of the accessibility score and the fluorescence intensity of Cy5-labeled GFP mRNA. The highest correlation coefficient of 0.81 (p < 0.0001) was obtained when k = 0.15 mol/kcal. Next, the amounts of GFP mRNA attached to the asODNs were plotted as a function of accessibility score (Table 2 and Fig. 6). Prediction of accessible and inaccessible sequences of c-fos mRNA using accessibility score Next, we examined whether prediction using the accessibility score was
VOL. 103, 2007
DETERMINATION OF POTENT ANTISENSE OLIGONUCLEOTIDES
275
DISCUSSION
FIG. 5. Amounts of GFP mRNA attached to asODNs as function of predicted minimum free energy of asODNs. A linear correlation (p = 0.0008, r = 0.72) is recognized. The line indicates the regression line.
FIG. 6. Amounts of mRNA attached to asODNs as function of accessibility score. Closed and open squares indicate the asODNs against GFP and c-fos mRNAs, respectively. A linear correlation between the accessibility score of asODNs against GFP mRNA and the amounts of GFP mRNA attached to asODNs (p< 0.0001, r = 0.81) is obtained. The line indicates the regression line.
applicable to other mRNAs of different sequences and lengths. Specifically, c-fos mRNA (1284 nt) was used as a target sequence, and the accessibility scores of 1245 asODNs were calculated. ODNc-fos426–465, ODNc-fos463– 502, ODNc-fos487–526 and ODNc-fos625–664 were selected as candidates for accessible ODNs, whereas ODNc-fos32–71, ODNc-fos159–198, ODNc-fos363–402 and ODNc-fos1180–1219 were selected as inaccessible candidates. These asODNs were attached to microbeads and amount of hybridization efficiencies between the asODNs to Cy5-labeled c-fos mRNAs were measured as described above. The results are shown in Table 2 and Fig. 6 (open squares). The obtained results revealed that the accessibility score developed on the basis of the GFP mRNA results was also useful for predicting potent asODNs directed against c-fos mRNA. The optimal k for c-fos mRNA was determined by calculating the correlation coefficients of the accessibility score and the fluorescence intensity of Cy5-labeled c-fos mRNA. The highest correlation coefficient of 0.76 (p < 0.05) was obtained when k = 0.1, 0.15 or 0.2 mol/kcal.
In the field of cellular biology, fusion proteins of GFP are widely used and their functions and localizations in cells have been extensively studied. If GFP mRNA can be successfully labeled with fluorescent asODNs, it will be helpful for studying the localizations of GFP fusion proteins and their mRNAs simultaneously. We prepared biotinylated 40mer asODNs directed against all the 40-nt sections of the coding sequence hat cumulatively covered the entire sequence of GFP mRNA. The asODNs were attached to neutravidin-conjugated microbeads, and their hybridization efficiencies with Cy5-labeled GFP mRNA were determined by fluorescence microscopy. This technique proved to be a simple method for distinguishing the effective asODNs. To identify some characteristic features of effective asODNs, specific sequence motifs were examined. Tu et al. (18) reported that a TCCC motif yielded potent asODNs, whereas Sohail et al. (17) reported that TTTC, TCCA and CTTT motifs were present in potent asODNs. Furthermore, highly significant positive correlations between the presence of CCAC, TCCC, ACTC, GCCA and CTCT motifs in oligonucleotides and their antisense efficiencies were also demonstrated (19). In the asODN sequences used in this study, 22 copies of the above-mentioned motifs were present in 8 asODNs that had relatively strong signals (>50%), whereas only 17 copies of the motifs were present in 13 asODNs that had relatively weak signals (< 20%). These motifs were rich in C and T, and this high CT ratio may be the origin of the correlation between the TC content and the hybridization efficiency. It is not clear why the presence of such motifs positively correlated with the potency of asODNs. One possible reason is that pyrimidine-rich oligonucleotides, particularly those that are C-rich, are able to form the most stable DNA-RNA duplexes (20). Next, we focused on the thermodynamic stability of asODNs. Thermodynamic analyses of the entire process of hybridization, including analyses of the free energy of displacing mRNA secondary structures caused by probe binding and the free energy of heteroduplex formation, can be carried out using the computer program OligoWalk (21). However, this process requires a known structure or a set of predicted secondary structures for the mRNA. Because it is difficult to obtain such data, we only calculated the predicted minimum free energy of each asODN. The minimum free energy of an ODN is a good index for evaluating the intra-association of nucleotide pairs. It is generally accepted that heteroduplex formation is primarily constrained by the local secondary structures of mRNAs and that the contribution of the secondary structures of short asODNs is of relatively less importance (5, 7, 22). However, our results indicate that the secondary structures of 40mer asODNs are important. The 40mer asODNs with a predicted minimum free energy of more than −2 kcal/mol were accessible to target mRNAs, whereas those with a predicted minimum free energy of less than −4 kcal/mol were inaccessible. Some asODNs were accessible to the target mRNA, whereas others were inaccessible at a free energy of about −3 kcal/mol. This difference may be ascribed to the secondary structures of the mRNA.
276
YANAGIHARA ET AL.
Next, we compared our results with the secondary structures predicted by Smith et al. (23). They predicted lowenergy secondary structures of folded rsGFP mRNA using mfold, and calculated the percentage of these structures in which a particular base was involved in intramolecular hybridization. Their results are not fully consistent with our experimental results, indicating the limitations of secondary structure prediction using computational methods alone. On the other hand, Luebke et al. (24) hybridized fluorescencelabeled GFP mRNA to 21mer ODN combinatorial arrays, and determined the hybridization efficiencies of 755 different probes for the GFP transcript. Although the hybridization signal corresponding to ODNGFP155–194 showed a similar result to that of the present result, the other signals differed. One possible reason for these differences is the sequences, because they used wild-type GFP whereas we used rsGFP. Another reason could be the difference in ODN length, because they used 21mer probes whereas we used 40mer probes. Our 40mer probes, which targeted sequences other than 155–194, also bound to GFP mRNA presumably because the affinities of 40mer probes for mRNA were higher than those of 20mer probes. Taken together, these results suggest the importance of asODN length. In typical antisense experiments, short 10– 20mer asODNs have been used to monitor the very local structure of target mRNA. Recently, a wider range of information on mRNAs and methods for designing longer asODNs have become necessary. Our method provides an effective two-step procedure for determining potent 40mer asODNs, namely, the computer-aided selection of asODN binding sites defined by an accessibility score followed by an experimental procedure for measuring the hybridization efficiencies of the selected asODNs and the mRNA by fluorescence microscopy. Our method will be of great value because it is simple, economical and effective. ACKNOWLEDGMENTS We thank Yoshie Harada for providing the plasmid containing c-fos, and Makoto Tsunoda and Mai Yamagishi for their critical reading of the manuscript. This work was partly supported by Grants-in-Aid for Specially Promoted Research, Scientific Research Priority Area (A) nos. 14035249 and 15030238 and Scientific Research (B) no. 11480196 from the Ministry of Education, Culture, Sports, Science and Technology of Japan.
REFERENCES 1. Kwiatkowski, R. W., Lyamichev, V., de Arruda, M., and Neri, B.: Clinical, genetic, and pharmacogenetic applications of the Invader assay. Mol. Diagn., 4, 353–364 (1999). 2. Monia, B. P., Johnston, J. F., Ecker, D. J., Zounes, M. A., Lima, W. F., and Freier, S. M.: Selective inhibition of mutant Ha-ras mRNA expression by antisense oligonucleotides. J. Biol. Chem., 267, 19954–19962 (1992). 3. Matveeva, O., Felden, B., Tsodikov, A., Johnston, J., Monia, B. P., Atkins, J. F., Gesteland, R. F., and Freier, S. M.: Prediction of antisense oligonucleotide efficacy by in vitro methods. Nat. Biotechnol., 16, 1374–1375 (1998). 4. Vickers, T. A., Wyatt, J. R., and Freier, S. M.: Effects of RNA secondary structure on cellular antisense activity. Nucleic Acids Res., 28, 1340–1347 (2000).
J. BIOSCI. BIOENG.,
5. Ho, S. P., Bao, Y., Lesher, T., Malhotra, R., Ma, L. Y., Fluharty, S. J., and Sakai, R. R.: Mapping of RNA accessible sites for antisense experiments with oligonucleotide libraries. Nat. Biotechnol., 16, 59–63 (1998). 6. Matveeva, O., Felden, B., Audlin, S., Gesteland, R. F., and Atkins, J. F.: A rapid in vitro method for obtaining RNA accessibility patterns for complementary DNA probes: correlation with an intracellular pattern and known RNA structures. Nucleic Acids Res., 25, 5010–5006 (1997). 7. Milner, N., Mir, K. U., and Southern, E. M.: Selecting effective antisense reagents on combinatorial oligonucleotide arrays. Nat. Biotechnol., 15, 537–541 (1997). 8. Allawi, H. T., Dong, F., Ip, H. S., Neri, B. P., and Lyamichev, V. I.: Mapping of RNA accessible sites by extension of random oligonucleotide libraries with reverse transcriptase. RNA, 7, 314–327 (2001). 9. Patzel, V., Steidl, U., Kronenwett, R., Haas, R., and Sczakiel, G.: A theoretical approach to select effective antisense oligodeoxyribonucleotides at high statistical probability. Nucleic Acids Res., 27, 4328–4334 (1999). 10. Zuker, M.: Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res., 31, 3406–3415 (2003). 11. Eis, P. S., Olson, M. C., Takova, T., Curtis, M. L., Olson, S. M., Vener, T. I., Ip, H. S., Vedvik, K. L., Bartholomay, C. T., Allawi, H. T., Ma, W. P., Hall, J. G., Morin, M. D., Rushmore, T. H., Lyamichev, V. I., and Kwiatkowski, R. W.: An invasive cleavage assay for direct quantitation of specific RNAs. Nat. Biotechnol., 19, 673–676 (2001). 12. Hughes, T. R., Mao, M., Jones, A. R., Burchard, J., Marton, M. J., Shannon, K. W., Lefkowitz, S. M., Ziman, M., Schelter, J. M., Meyer, M. R., and other 14 authors: Expression profiling using microarrays fabricated by an inkjet oligonucleotide synthesizer. Nat. Biotechnol., 19, 342–347 (2001). 13. Taguchi, H., Ueno, T., Tadakuma, H., Yoshida, M., and Funatsu, T.: Single-molecule observation of protein-protein interactions in the chaperonin system. Nat. Biotechnol., 19, 861–865 (2001). 14. Smetsers, T. F., Boezeman, J. B., and Mensink, E. J.: Bias in nucleotide composition of antisense oligonucleotides. Antisense Nucleic Acid Drug Dev., 6, 63–67 (1996). 15. Ho, S. P., Britton, D. H., Stone, B. A., Behrens, D. L., Leffet, L. M., Hobbs, F. W., Miller, J. A., and Trainor, G. L.: Potent antisense oligonucleotides to the human multidrug resistance-1 mRNA are rationally selected by mapping RNA-accessible sites with oligonucleotide libraries. Nucleic Acids Res., 24, 1901–1907 (1996). 16. Agrawal, S.: Importance of nucleotide sequence and chemical modifications of antisense oligonucleotides. Biochim. Biophys. Acta, 1489, 53–68 (1999). 17. Sohail, M., Hochegger, H., Klotzbucher, A., Guellec, R. L., Hunt, T., and Southern, E. M.: Antisense oligonucleotides selected by hybridisation to scanning arrays are effective reagents in vivo. Nucleic Acids Res., 29, 2041–2051 (2001). 18. Tu, G. C., Cao, Q. N., Zhou, F., and Israel, Y.: Tetranucleotide GGGA motif in primary RNA transcripts. Novel target site for antisense design. J. Biol. Chem., 273, 25125–25131 (1998). 19. Matveeva, O. V., Tsodikov, A. D., Giddings, M., Freier, S. M., Wyatt, J. R., Spiridonov, A. N., Shabalina, S. A., Gesteland, R. F., and Atkins, J. F.: Identification of sequence motifs in oligonucleotides whose presence is correlated with antisense activity. Nucleic Acids Res., 28, 2862– 2865 (2000). 20. Lesnik, E. A. and Freier, S. M.: Relative thermodynamic stability of DNA, RNA, and DNA:RNA hybrid duplexes: relationship with base composition and structure. Biochemistry,
VOL. 103, 2007
DETERMINATION OF POTENT ANTISENSE OLIGONUCLEOTIDES
34, 10807–10815 (1995). 21. Mathews, D. H., Burkard, M. E., Freier, S. M., Wyatt, J. R., and Turner, D. H.: Predicting oligonucleotide affinity to nucleic acid targets. RNA, 5, 1458–1469 (1999). 22. Patzel, V. and Sczakiel, G.: Theoretical design of antisense RNA structures substantially improves annealing kinetics and efficacy in human cells. Nat. Biotechnol., 16, 64–68 (1998).
277
23. Smith, L., Andersen, K. B., Hovgaard, L., and Jaroszewski, J. W.: Rational selection of antisense oligonucleotide sequences. Eur. J. Pharm. Sci., 11, 191–198 (2000). 24. Luebke, K. J., Balog, R. P., and Garner, H. R.: Prioritized selection of oligodeoxyribonucleotide probes for efficient hybridization to RNA transcripts. Nucleic Acids Res., 31, 750– 758 (2003).