Determination of Sequence Specificity between a Plasmid Replication Initiator Protein and the Origin of Replication

J. Mol. Biol. (1995) 254, 381–391

Determination of Sequence Specificity between a Plasmid Replication Initiator Protein and the Origin of Replication Christopher D. Thomas1*, Theo T. Nikiforov2, Bernard A. Connolly3 and William V. Shaw1 1

Department of Biochemistry The University of Leicester University Road, Leicester LE1 7RH, UK 2 Department of Biochemistry University of Southampton Southampton, SO2 3TU, UK 3 Department of Biochemistry and Genetics, University of Newcastle, Newcastle upon Tyne, NE2 4HH, UK

Staphylococcal plasmids of the pT181 family replicate by a rolling circle mechanism, requiring the activities of a plasmid-specified Rep protein. The initiation event involves site-specific phosphodiester bond cleavage by Rep within the replication origin, ori. In vitro the Rep proteins also display type-I topoisomerase activity specific for this plasmid family. Although the single site of bond cleavage, ICR II, is conserved among all members of the pT181 family, the plasmid-specific Rep proteins are able to discriminate between family members in vivo, initiating replication only from the cognate origin. The basis of such specificity is believed to be due to a non-covalent binding interaction between Rep and a DNA sequence adjacent to the site of phosphodiester bond cleavage. Using the RepD protein specified by plasmid pC221, we present data for the physical parameters of RepD:oriD complex formation. Quantification of the relative strengths of the non-covalent interactions for different but related ori target sequences, measured by gel mobility shift experiments, has yielded data that are in accord with the known specificity of the protein in vivo. Oligonucleotide competition experiments demonstrate that this interaction is indeed attributable to the specificity determinant, ICR III. Protein-DNA crosslinking methods show that a carboxyl-terminal proteolytic fragment of RepD makes a specific interaction with the ICR III region of its cognate replication origin. Analysis of topoisomerase rates indicates that the interaction between ICR III and the carboxyl terminus of the protein is required before a productive interaction, namely the phosphodiester bond cleavage at the ICR II, can occur. 7 1995 Academic Press Limited

*Corresponding author

Keywords: plasmid replication; DNA-binding protein; site-specific topoisomerase; 4-thiothymidine crosslinking

Introduction A ‘‘rolling circle’’ model for replication has been proposed for many plasmids of Gram-positive bacteria, notably those of the staphylococci (Majumder & Novick, 1988; Novick, 1989). The latter include the pT181 family of plasmids, each of which is approximately 4.5 kb in size, confers resistance to a single antibiotic (tetracycline, streptomycin or chloramphenicol), and belongs to Present addresses: C. D. Thomas, Department of Biochemistry & Molecular Biology, University of Leeds, Leeds LS2 9JT, UK; T. T. Nikiforov, Nanogen, 10398 Pacific Center Court, San Diego, CA 92121, USA. Abbreviations used: ICR, inverted complementary repeat; ori, origin of replication. 0022–2836/95/480381–11 $12.00/0

one of five distinct incompatibility groups (Projan & Novick, 1988; Novick, 1989; Balson & Shaw, 1990). Members of this family encode a trans-acting Rep (replication initiator) protein that instigates unidirectional replication by cleavage at a unique position within the (+) strand of the replication origin, ori (Figure 1), forming a covalent adduct. Replication proceeds by elongation from the resulting free 3' hydroxyl end. The cleavage site is within the loop of a potential stem-loop structure (Noirot et al., 1990) formed by the second of three inverted complementary repeats (ICR) at the origin (Projan et al., 1985; Gennaro et al., 1989) and is referred to as ICR II. The sequence of ICR II is conserved between all members of the pT181 family and is also believed to be the site for termination of 7 1995 Academic Press Limited

382 replication (Iordanescu & Projan, 1988; Murray et al., 1989). Cleavage at ICR II by Rep involves formation of a new phosphodiester linkage between the resulting free 5' phosphate group and the hydroxyl group of Tyr191 (Thomas et al., 1990a). All Rep proteins demonstrate type-I topoisomerase activity in vitro with substrate plasmids containing ICR II (Koepsel et al., 1985; Thomas et al., 1990a). Despite the similarities in primary structure between Rep proteins from different pT181-like plasmids and strict conservation of the ICR II sequence, replication in vivo is plasmid-specific. When expressed at normal levels within the cell RepC, specified by the inc3 plasmid pT181 (Khan & Novick, 1983), will initiate replication in vivo only from the origin (oriC) of that plasmid, failing to act on the target (oriD) of the RepD protein of the inc4 plasmid pC221 (Brenner & Shaw, 1985). Only when the Rep protein is provided in great excess can heterologous initiation be observed in vivo (Iordanescu, 1989). Furthermore, it has been shown that specificity is conferred on the Rep:ori interaction by the third ICR sequence, adjacent to the cleavage site, to which the protein binds non-covalently (Projan et al., 1985; Koepsel et al., 1986; Zock et al., 1990; Wang et al., 1993). This specificity site, designated ICR III, is unique for each member of the pT181 family. Such a model is supported (1) by the footprinting patterns of RepC (Koepsel et al., 1986) and RepD (Thomas et al., 1988), which demonstrate binding to both the 3' side of ICR II up to the cleavage site and the adjacent ICR III of oriC and oriD, respectively, and (2) by qualitative gel mobility shift analysis of RepC and RepD with their cognate origins (Thomas et al., 1990a; Zock et al., 1990). In this study, we demonstrate that the interaction between ICR III and Rep is sufficient to account for the observed specificity in vivo, the evidence being measurements of relative binding affinities in vitro

Figure 1. Comparison of replication origin sequences. The contiguous replication origins of plasmids of the pT181 family are presented, with the inverted repeat elements indicated as arrows beneath each sequence. Origin sequences, their encoding plasmids and data sources are: oriC, (pT181, GenBank entry J01764), oriD (pC221, X02166), oriE (pS194, X06627), oriI (pUB112, M21929), oriJ (pC223, M21928) and oriN (pCW7, J03323). Dots indicate sequence identity with oriD of pC221. Nick indicates the position in the (+) strand of ICR II at which RepD breaks the phosphodiester bond and becomes covalently attached to the 3' adenosine moiety through a phosphotyrosyl linkage at Tyr191.

Interactions of RepD at ICR III

Figure 2. Ethidium bromide-stained gel showing change in electrophoretic mobility of an unlabelled restriction fragment containing oriD on binding to RepD. RepD was incubated with 1 mg digests of vectors pUC-D, pUC-C and pUC-N where the cloned replication origins oriD (lanes 1 to 6), oriC (lanes 7 and 8) and oriN (lanes 9 and 10), respectively, were released as 250 bp fragments (ori ) from the pUC19 cloning vector sequence (Vector). Wild-type, mutant Y191F and truncated 34 kDa forms of RepD were used as indicated, with the addition of 10 mM MgCl2 (lane 4) or excess oligonucleotide ICR IIID (lane 6). The position of the Rep:ori shifted band is shown.

and the effects of oligonucleotide competitors based on ICR II and ICR III in both topoisomerase and gel mobility shift (Lane et al., 1992) assays. In addition, double-stranded oligonucleotides corresponding to ICR III containing the photolabile base analogue 4-thiothymidine were prepared (Nikiforov & Connolly, 1992). The latter, when irradiated with low doses of ultraviolet light at 1340 nm, can become covalently attached to cognate proteins. Sequencespecific crosslinking was detected between such ICR III ‘‘substrates’’ and a carboxyl-terminal proteolytic fragment of RepD that contains a six amino acid residue motif (residues 265 to 270) proposed for the specificity of Rep:ori recognition (Wang et al., 1992; Dempsey et al., 1992). This proteolytic fragment (14 kDa) encompasses most of the variant amino acids of Rep proteins of the pT181 family (Thomas et al., 1990b). By contrast, the residue of Rep (Tyr191) involved in covalent linkage at the replication initiation site ICR II (Thomas et al., 1990a) lies in a region of conserved amino acid sequence within a different proteolytic fragment (21 kDa). Although the Tyr191:ICR II interaction alone is the minimum requirement for type-I topoisomerase activity in vitro, the additional interaction of Rep at ICR III greatly increases its efficiency, measured here by nicking of negatively supercoiled plasmid substrates. Thus the Rep proteins combine two distinct interactions with the replication origin to result in origin-specific initiation of replication.

Results Gel mobility shift assays The change in electrophoretic mobility of a restriction fragment containing oriD on binding to RepD is illustrated qualitatively in Figure 2. Fragments containing oriC or oriN were not shifted

383

Interactions of RepD at ICR III

Table 1. Oligonucleotide substrates Name ICR ICR ICR ICR (No T4 T7 T10 T11 T12 T13 T14 T15 T16

II IIID IIIC IIIN S)

Sequencea

Description

AACCGGCTACTCTAATAGCCGGTT AAGTGGTAATTTTTTTACCACCC GGACGCACATACTGTGTGCATAT AAACCGACATACTATGTACACCC AAGTGGTAATTTTTTTACCACTT AAGSGGTAATTTTTTTACCACTT AAGTGGSAATTTTTTTACCACTT AAGTGGTAASTTTTTTACCACTT AAGTGGTAATSTTTTTACCACTT AAGTGGTAATTSTTTTACCACTT AAGTGGTAATTTSTTTACCACTT AAGTGGTAATTTTSTTACCACTT AAGTGGTAATTTTTSTACCACTT AAGTGGTAATTTTTTSACCACTT

ICR II, common to oriD, oriC and oriN. ICR III of oriD: (+) strand ICR III of oriC: (+) strand ICR III of oriN: (+) strand (+) strand of ICR IIIDb, no 4-thiothymidine (+) strand of ICR IIIDb, substituted at residue (+) strand of ICR IIIDb, substituted at residue (+) strand of ICR IIIDb, substituted at residue (+) strand of ICR IIIDb, substituted at residue (+) strand of ICR IIIDb, substituted at residue (+) strand of ICR IIIDb, substituted at residue (+) strand of ICR IIIDb, substituted at residue (+) strand of ICR IIIDb, substituted at residue (+) strand of ICR IIIDb, substituted at residue

4 7 10 11 12 13 14 15 16

Sequences are of the (+) strands only, written 5' : 3'. S denotes 4-thiothymidine. These substrates contained two terminal thymidine residues in place of cytosine to facilitate synthesis. An appropriate complementary sequence was synthesised for preparation of the double-stranded forms. a

b

by RepD: they share the same ICR II sequence but differ at ICR III (Figure 1). Such specificity was confirmed using 32P-labelled substrates (see below). Active site Tyr191 is not a requirement for binding to oriD, as shown by the binding of the RepD variant containing phenylalanine substituted at this position (Y191F). A further protein variant (34 kDa) lacks the 31 amino-terminal amino acid residues of wild-type RepD protein (37 kDa; Thomas et al., 1990b); binding is again observed, although the location of the shifted band is altered. The above binding studies were conducted in the absence of Mg2+, to ensure neither cleavage of nor covalent attachment to DNA by RepD. Variant Y191F is incapable of phosphodiester bond cleavage; the inclusion of Mg2+ with this protein does not alter the complex with oriD. However, the presence of a specific competitor DNA (the 23 bp ICR IIID sequence: Table 1) can interfere in the association of RepD with oriD. The gel mobility shift technique was also used to quantify the non-covalent binding affinity of RepD for oriD. RepD was incubated with small amounts of radiolabelled restriction fragments containing oriD followed by electrophoresis under non-denaturing conditions. Measurement of radioactivity in the free (unbound) and single retarded (bound) positions allowed calculation of the fraction of oriD bound by RepD, and hence the apparent dissociation constant, Kapp (Figure 3). This value was determined for wild-type RepD, the 34 kDa truncated form and the active site mutation Y191F. The data of Table 2 are compatible with the binding of one dimer of RepD to a single replication origin, with Kapp of the order of 10−9 M. Curve fitting (by equation (2)) suggested very slight positive cooperativity, of similar magnitude for both wild-type and 34 kDa forms of RepD but with tighter binding in the latter case. The Y191F variant displayed reduced affinity and greater cooperativity. Both parameters approached those of wild-type RepD on addition of 10 mM MgCl2 . No specific shift of radiolabelled fragments

containing oriC or oriN was observed using concentrations of RepD up to 1 mM, placing a limit on Kapp between RepD and these fragments of 10−6 M. Such non-sequence-specific DNA binding by RepD was also studied by measuring the binding of oriD by wild-type RepD in the presence of increasing amounts of unlabelled whole pC221cop903 plasmid DNA. Since the binding of RepD to the competitor DNA decreases the amount of protein free to bind to the labelled oriD fragment detected in the gel mobility shift assay, such measurements can be used to calculate the relative affinities of RepD for the oriD target and the added competitor. Variation of the concentration of RepD required to produce 50% binding to oriD with the concentration of added DNA (equation (4); Figure 4(a)) was used to calculate an average non-specific to specific binding affinity ratio (k) of 1700 2 180, suggesting a non-specific dissociation constant in excess of 2 × 10−6 M. Other species of competitor DNA tested in the RepD:oriD binding assay included oligonucleotides corresponding to both single-stranded and doublestranded ICR II, and double-stranded ICR III from oriC, oriD and oriN (Table 1; Figure 4(b) and (c)). In the presence of increasing amounts of synthetic ICR IIID less binding of RepD to the labelled oriD fragment was observed, suggestive of binding to the added oligonucleotide. The calculated dissociation constant (equation (3)) for the interaction between RepD and the 23 bp ICR IIID sequence is 3.7 (20.5) × 10−9 M. No significant competition by the other double-stranded oligonucleotides could be detected under such conditions, indicative of a dissociation constant greater than 10−6 M in each case. Competition experiments with single-stranded ICR II ((+) strand) yielded a dissociation constant of greater than 350 × 10−9 M, although the data were highly variable. Specific retardation of radiolabelled 23 bp ICR IIID was detected by the gel mobility shift technique (data not shown), but the direct determination of reliable dissociation constants by this method was not possible.

384 (a)

(b)

(c)

Interactions of RepD at ICR III

oligonucleotides were crosslinked to RepD by exposure to UV light; potassium phosphate buffers were used in preference to Tris-HCl as use of the latter resulted in severe degradation of RepD on UV irradiation. Crosslinking between each potential substrate and RepD (wild-type or 34 kDa variant) produced a single species migrating slower than normal through denaturing polyacrylamide gels (Figure 5). The amount of crosslinking (as a percentage of total oligonucleotide present) is listed in Table 3. No UV-induced crosslinking of unsubstituted ICR III substrates to RepD could be detected under the conditions used. Although the amount of crosslinking observed was small for each oligonucleotide, two substitutions showed notably higher efficiency, namely those at positions T4 and T7. Specificity of interaction was demonstrated by competition studies involving crosslinking in the presence of ICR III substrates containing no 4-thiothymidine (Table 3). The addition of an excess of the unsubstituted 23 bp ICR IIID sequence substantially reduced crosslinking, whereas ICR III substrates based on the non-cognate oriC sequence failed to prevent crosslinking. Partial proteolysis of RepD was used to localise the crosslinking of the substituted oligonucleotide. Proteinase K cleaves RepD and the 34 kDa variant at amino acid position 207, producing fragments from the latter with apparent molecular masses of 21 kDa and 14 kDa (Thomas et al., 1990b; and see Figure 8(a)). Similar patterns of crosslinked species were obtained whether proteolysis at the amino acid 207 site was performed before or after UV-induced crosslinking. A single major species was produced under such conditions, migrating at approximately 19 kDa on electrophoresis (Figure 5). This species corresponds to crosslinking of the DNA to the 14 kDa fragment of RepD, derived from the carboxyl-terminal 108 amino acid residues of RepD. Topoisomerase activity

Figure 3. Data from binding experiments using 32 P-labelled oriD with (a) wild-type, (b) Y191F and (c) 34 kDa forms of RepD is presented, and the curves obtained by fitting equation (2) superimposed. Curve parameters are given in Table 2. r is the fraction of 32 P-labelled oriD bound at the indicated concentration of RepD. Binding studies using variant Y191F were repeated in the presence of 10 mM MgCl2 as indicated by the broken line in (b).

Crosslinking of substrates containing 4-thiothymidine Oligonucleotide substrates containing substitutions of 4-thiothymidine for thymidine nucleotides within the (+) strand of ICR IIID were prepared (Table 1). Double-stranded, substituted

RepD is known to relax negatively supercoiled plasmids containing the ICR II sequence of oriD, oriC or oriN (Thomas et al., 1990a). The topoisomerase-I-like reaction requires divalent metal ions such as Mg2+ and is most efficient at 300 mM KCl and pH 9.0. To assess the relative importance of ICR Table 2. Apparent dissociation constants for the oriD sequence RepDa

Kapp (nM)b

n

WT Y191F Y191F + Mg2+c 34 kDa

1.40 2 0.08 2.27 2 0.09 1.36 2 0.05 1.03 2 0.04

1.06 2 0.04 1.21 2 0.02 1.05 2 0.02 1.04 2 0.02

a

Variants of RepD are as described in the text. Values of Kapp and n were calculated according to equation (2), and are given 2 standard error. c Studies conducted in the presence of 10 mM MgCl2 . b

385

Interactions of RepD at ICR III

(a)

(b)

(c)

Figure 5. Crosslinking of ICR IIID to RepD. Wild-type RepD (WT: lanes 1 and 6), the 34 kDa variant (34k, lanes 2 and 7), or a mixture of 21 and 14 kDa fragments obtained by proteolytic digestion of the 34 kDa form (P, lanes 3 and 8) were crosslinked to a radiolabelled substrate oligonucleotide substituted with 4-thiothymidine at T4 (lanes 1 to 3, and 6 to 8). The protein fragments stained with Coomassie blue following SDS-PAGE are presented in lanes 1 to 5. Crosslinked fragments were not detected by this stain; instead, an autoradiograph of lanes 1 to 3 is depicted in lanes 6 to 8, showing each radiolabelled, crosslinked species to migrate slower than its uncrosslinked counterpart (WT-T4, 34k-T4, 14k-T4) and distinct from uncrosslinked substrate ( 32P-T4). The size difference is greatest for the 14 kDa DNA complex, which migrates with an apparent molecular mass of 19 kDa. Variants of RepD without added DNA are presented for comparison in lanes 4 and 5 (M, mixture of WT and 34 kDa RepD).

of plasmid relaxation) was measured after one hour. The addition of a large molar excess of oligonucleotide duplexes corresponding to ICR IIID, IIIC or IIIN did not prevent relaxation of pC221cop903, nor did the double-stranded form of ICR II have any noticeable effect (Figure 6). However, presence of the target (+) strand of ICR II Figure 4. The effect of added competitor DNAs on the binding of RepD to oriD. (a) The concentration of wild-type RepD required for half-maximal binding of oriD in the presence of varying concentrations of whole plasmid pC221cop903 is plotted against plasmid concentration. Curve parameters (equation (4)) are given in the text. (b) and (c) The effect of added oligonucleotides on binding of RepD to oriD is presented: the oligonucleotides present in (b) have little effect on RepD, whereas the addition of ICR IIID in (c) has a strong competitive effect. The curve fit to data for competitor ICR IIID by equation (3) is superimposed on these data.

II and III regions, RepD was preincubated with the competitor oligonucleotides before mixing with negatively supercoiled plasmid pC221cop903. Subsequent plasmid nicking (as the initial event

Table 3. Crosslinking of 4-thiothymidine-substituted oligonucleotides to RepD Substitution T4 T7 T10 T11 T12 T13 T14 T15 T16

Crosslinkinga 1.43 2 0.45 1.39 2 0.33 0.08 2 0.01 0.05 2 0.00 0.11 2 0.03 0.19 2 0.03 0.15 2 0.02 0.22 2 0.04 0.24 2 0.11

+ IIICb

+ IIIDc

1.60 2 0.01 0.07 2 0.01 1.28 2 0.18 0.14 2 0.00 −d − − − − − − − − − − − − −

a Values are expressed as the percentage of the total substituted oligonucleotide crosslinked to the protein. b,c Crosslinking experiments repeated in the presence of a 30-fold excess of unsubstituted (competitor) oligonucleotide over 4-thiothymidine substrate. d −, Not tested.

386

Interactions of RepD at ICR III

(a)

Figure 6. Quantification of oligonucleotide competition in the topoisomerase assay. RepD was incubated with plasmid pC221cop903 in the presence of competitor oligonucleotides (Table 1). The graph depicts the percentage of negatively supercoiled (SC) plasmid substrate remaining after a total reaction time of one hour at each concentration of competitor.

alone was sufficient to affect topoisomerisation by RepD. This single-stranded ICR II competitor has the potential to form a hairpin structure, presenting the target sequence within a singlestranded loop. Such a structure is postulated as the target site for the topoisomerase (nicking/closing) activity of RepD, the product of the RepD-competitor interaction in this case probably leading to formation of a RepD-oligonucleotide covalent adduct (Thomas et al., 1990a) with reduced topoisomerase activity. Although both oriD plasmid pC221cop903 and oriC plasmid pT181cop608 are relaxed by RepD, it was noted that the relative rates of relaxation of these plasmids by RepD differed. These rates were quantified by mixing plasmid substrates with various amounts of RepD, sampling the reaction mixture at various times, and separation of products by agarose gel electrophoresis. The rate of disappearance of negatively supercoiled substrate followed a single exponential decay (Figure 7), suggestive of a single process kinetically dominating the pathway from the initial encounter between RepD and the plasmid substrate to the formation of the nicked plasmid species with covalently attached protein. At a given plasmid concentration of 0.5 mg/30 ml (corresponding to 6.1 nM, both plasmids being 04.2 kb in size) the rate is directly proportional to the concentration of RepD, and from such data pseudo first-order rate constants for the nicking of negatively supercoiled plasmid by RepD were calculated as 5.4 × 10−2 min−1 nM−1 RepD for pC221cop903, and 1.9 × 10−4 min−1 nM−1 RepD for pT181cop608. Thus the presence of the correct ICR III sequence for recognition by RepD in the former improves the rate of nicking approximately 300-fold over the latter, a magnitude similar to the discrimination observed by gel mobility shift analysis.

(b)

Figure 7. Relative topoisomerase activities. Topoisomerase (nicking) assays were conducted at different concentrations of RepD with either (a) pC221cop903 or (b) pT181cop608 as substrate. Each reaction (30 ml) contained 0.5 mg plasmid DNA and either (a) 6.25 (W), 12.5 (Q), 18.75 (R) or 25 ng (T); or (b) 250 (w), 500 (q), 750 (r) or 1000 ng (t) of RepD. The reaction was stopped by the addition of 20 mM EDTA at various time-points, and samples separated by electrophoresis. The disappearance of negatively supercoiled DNA was calculated by digital image analysis and exponential rates fit to the data. Each inset shows the variation in rate with RepD concentration, the pseudo-first order rate constants being 5.43 × 10−2 min−1 nM−1 RepD with pC221cop903 and 1.86 × 10−2 min−1 nM−1 RepD for pT181cop608.

Discussion Each replication initiator protein of the pT181 family displays specificity in vivo towards its cognate replication origin, despite the high level of sequence identity of not only Rep proteins of the family but also of the replication origins themselves. All these origins contain the same nick site that is used to initiate replication: discrimination must make use of factors external to this site. The gel mobility shift assay clearly demonstrates the discrimination by RepD between the cognate origin, oriD, and other plasmid origin sequences, even though the latter may contain the same nick site as oriD. Although RepD appears to bind

387

Interactions of RepD at ICR III

(a)

(b)

non-covalently to random DNA sequences, the affinity for oriD is three orders of magnitude greater. The efficiency of the 23 bp ICR IIID oligonucleotide as a competitor for binding to RepD highlights the major contribution of this sequence towards the binding of RepD to the origin as a whole: the affinity of RepD for the oligonucleotide is very similar to that for the entire replication origin. Although there is undoubtedly an interaction between RepD and the adjacent ICR II sequence when the latter is nicked and becomes covalently attached to the protein, ICR III is the principal component involved in non-covalent binding. Such data are in full agreement with other approaches to the study of Rep protein specificity, including DNA footprinting in vitro (Koepsel et al., 1986; Thomas et al., 1988) and the results of origin mutagenesis studies in vivo (Wang et al., 1993). The difference in magnitude of interactions of RepD with cognate and non-cognate origins is also in agreement with the observation that cross-reactivity in vivo, such as between RepD and oriC, requires

Figure 8. Interactions between RepD and oriD. (a) A representation of the primary structure of RepD. Differences between Rep proteins (consensus length: 314 residues) are indicated by the shaded regions. The replication origin, oriD, is encoded within the Rep reading frame and is shown as a crosshatched box. ICR II and ICR III, segments of the replication origin, are shown underneath. RepD is cleaved by proteinase K (PrK) before residues Phe35 and Ser207. Active site residue Y191, responsible for cleavage of ICR II, is indicated, as is the region of six amino acid residues (6aa) known to confer sequence specificity by mutagenic studies. Arrows indicate major interactions between parts of the RepD protein and the replication origin. (b) Helical representation of the oligonucleotide substrate ICR IIID. The centre of dyad symmetry is indicated by the vertical broken line. Shaded rectangles indicate the positions of T4 and T7 substitutions described in Tables 1 and 3. These residues, as well as those of the complementary residues in the (−) strand, are boxed in the sequence shown. The Figure represents a side view of the interaction between RepD and the DNA, showing that T4 and T7 substitutions are accessible via the major groove. Arrows indicate the likely bending of the DNA conferred by the (T)7 sequence at the centre of ICR III.

increased expression of the Rep protein in addition to inactivation of the donor origin sequence (Iordanescu, 1989). Crosslinking experiments using 4-thiothymidinesubstituted oligonucleotides reveal much about the nature of the RepD:DNA complex. Attachment to the protein can occur via either the C-4 or C-6 positions of the pyrimidine ring (Favre, 1990), positions exposed in the major groove of DNA. The substitutions most strongly linked to RepD, T4 and T7, are represented by symmetry in the (−) strand of the ICR IIID sequence at positions 17 and 20; thymidine residues are also found at positions 4 and 7 (in the (+) strand) and 17 (in the (−) strand) of the oriI sequence of plasmid pUB112, which has also been reported to interact with RepD (Wang et al., 1992). Figure 8(b) shows how these residues are all presented on the same ‘‘face’’ of the double helix, thus RepD may approach the DNA and bind predominantly to this face, the dyad axis of symmetry in the oligonucleotide being continued through the axis between the monomers constituting the RepD dimer. At the centre of ICR IIID is a

388 stretch of many T:A base-pairs; such a sequence (Ulanovsky & Trifonov, 1987) may allow distortion of ICR IIID with the result that the DNA wraps around RepD to a limited extent. Crosslinking also reveals the proximity in three-dimensional space between the carboxylterminal fragment of RepD and ICR IIID, a result in agreement with that arising from the alteration of residues 265 to 270, which has been shown to affect the specificity of the Rep proteins (Dempsey et al., 1992; Wang et al., 1992). Although DNA binding is undoubtedly centred at ICR III, the latter authors have shown the importance of correct location of this sequence relative to ICR II (Wang et al., 1993), the presence of which imposes an inherent asymmetry on the structure, and the importance of the proximal arm of ICR III in leading to a productive interaction at ICR II in vivo. The improvement in yield of crosslinking between RepD and the T4 and T7 substitutions is the focus of current work to identify the amino acids linked to the DNA. In addition to crosslinking to the carboxyl-terminal part of RepD, the results of binding studies with the 34 kDa variant show that the amino-terminal region is not required for the interaction at ICR III. Although the 34 kDa:oriD complex migrates ahead of that formed with wild-type RepD, the affinity of oriD for the 34 kDa form is comparable with that for the full-length protein. Nor is active site tyrosine 191 required for binding, suggesting that residues of the active site involved in phosphodiester bond cleavage and attachment at ICR II are likely to be distinct from those involved in recognition of ICR III. Such a distinction between residues of the active site and of ICR III binding is also seen in the topoisomerase assay: the absolute ability of RepD to relax either cognate or non-cognate plasmids of the pT181 family depends solely on the presence of the ICR II sequence, and ICR III competitor oligonucleotides do not prevent this relaxation. Although the complex formed between oriD and the Y191F variant of RepD appears to be the same as that formed with the wild-type protein (as judged from their identical gel shifts), the positive cooperativity apparent in binding Y191F infers a complexity beyond the simple equilibrium describing the binding of a single protein dimer to a single binding site on the DNA. No direct relationship between the coefficient, n, representing cooperativity, and the stoichiometry between protein and DNA can be inferred (Senear & Brenowitz, 1991). A favoured interpretation of the data is that the interaction between subunits of the mutant protein is weakened; a shifted monomerdimer equilibrium perturbs the amount of protein dimer available to interact with ICR III in the assay. Interestingly the addition of magnesium ions abolishes this effect, suggesting that they stabilise the dimeric form, compensating for inter-subunit interactions lost through the alteration of tyrosine to phenylalanine. The implication of this model is

Interactions of RepD at ICR III

for an active site that is shared between subunits, where Mg2+ serves not only to facilitate the phosphodiester bond cleavage and attachment to Tyr191 but also to hold the two subunits comprising the active site together, thereby modulating the interaction with the origin and hence the efficiency of initiation of replication. Evidence for such an arrangement with active site residues at the dimer interface has been found in other proteins involved in phosphodiester bond cleavage and religation, most notably the Flp recombinase (Chen et al., 1993). Thus the model for Rep protein activity comprises a protein dimer that recognises the ICR III sequence through the carboxyl-terminal part of the protein, allowing an interaction between the active site, possibly at the dimer interface, and ICR II. Interactions with ICR III are sequence-specific to allow discrimination between related origins; such specificity is determined by the sequence divergence between Rep proteins at the carboxyl terminus. By contrast, the functions of cleavage and attachment to the ICR II sequence are conserved between all the Rep proteins; hence the sequence conservation in the major central section of the protein. Partial proteolysis of RepD with proteinase K divides the protein into fragments corresponding to these functions (21 kDa, 14 kDa, Figure 8(a)), but the isolated expression of these fragments has yet to yield protein soluble in the absence of denaturants. However, on the basis of sequence comparisons a domain structure separating ICR III binding and ICR II cleavage is considered likely. Gel mobility shift analysis is a useful tool for the study of sequence specificity in vitro, but contributes little to the understanding of the mechanism of phosphodiester bond cleavage by RepD. With regard to the latter, the sequence-specific topoisomerase activity of the protein is seen to represent the events of bond cleavage and religation that are a requirement for initiation and termination of replication. The competitor experiments described show how such nicking/closing activity is inhibited by the presence of an excess of competitor oligonucleotide corresponding to the singlestranded (rather than double-stranded) form of the cleavage site, consistent with extrusion of this sequence as a cruciform-like structure from the plasmid (Noirot et al., 1990) prior to interaction with Tyr191 at the active site. ICR IIID competitors did not appear to affect the relaxation of plasmid substrates by RepD. However, recent work (data not presented) suggests that the half-life of the RepD:ICR IIID oligonucleotide complex may be of the order of a few minutes rather than the hour taken for this assay. Although the cognate ICR III sequence within pC221cop903 is not an absolute requirement for topoisomerase activity by RepD, the topoisomerase rate analyses presented above show how this greatly facilitates the nicking reaction, presumably by locating RepD adjacent to ICR II prior to relaxation.

389

Interactions of RepD at ICR III

Materials and Methods Preparation of RepD

Figure 9. Model for interaction at ICR II. Plasmid pC221 is represented in (a) in a highly-simplified, negatively supercoiled form, and in (b) as a partially relaxed molecule owing to the extrusion of cruciform ICR II. The adjacent specificity site ICR III is also indicated. Binding of RepD to negatively supercoiled DNA (c) promotes the extrusion of ICR II (d), the conformation that is the substrate for the nicking/closing (topoisomerase) activity of RepD. Plasmids carrying ICR II but lacking the appropriate ICR III sequence, such as pT181, may also extrude the cruciform (e). In this case the only specific interaction between RepD and the replication origin is at ICR II; formation of this complex is a comparatively rare event as no RepD:ICR III complex can be formed.

Wild-type RepD, mutant Y191F and the 34 kDa variant were expressed in Escherichia coli and purified by ammonium sulphate fractionation and heparin-Sepharose chromatography essentially as described (Thomas et al., 1990a) with 50 mM Tris-HCl in all buffers, at pH 7.5 for wild-type and 34 kDa variants and pH 7.0 for Y191F. Proteolytic fragments of RepD were generated by the addition of proteinase K (Boehringer) to 1% (w/w) relative to RepD and incubation at 30°C for 30 minutes in 50 mM Tris-HCl (pH 7.5), 200 mM KCl, 1 mM EDTA, 10% (v/v) ethanediol. Proteases were inactivated by the addition of phenylmethylsulphonylfluoride to 1 mM. All protein concentrations were measured using the method of Bradford (1976). A vector for the expression of the 34 kDa polypeptide (M34-K314) was created by oligonucleotide mismatch mutagenesis (Kunkel et al., 1987) of the repD reading frame to create a ClaI restriction site at position 1285 of the pC221 sequence and to replace the codon for K34 with that for an initiator methionine (residues are numbered according to the consensus alignment of known Rep sequences; RepD lacks three residues at the amino terminus compared with the other proteins). The resulting 2173 bp ClaI fragment containing this shortened repD gene, deleted for the 31 amino-terminal residues of RepD, was reinserted into Escherichia coli vector pHD (Thomas et al., 1990a). Preparation of plasmid DNA substrates

Indeed, this binding with its potential distortion of the double helix in the immediate vicinity may be a requirement to facilitate ICR II extrusion. In contrast, no specific association between RepD and non-cognate plasmids such as pT181cop608 occurs: either a random non-specific association adjacent to ICR II or the unassisted extrusion of ICR II alone are required before relaxation can occur (Figure 9). The relative values of the pseudo first-order rates of nicking measured above (a 300-fold increase for the plasmid containing oriD over that with oriC) is of similar magnitude to the selectivity of RepD for oriD over other DNA sequences observed by gel mobility shift analysis (a 1700-fold difference). Thus rate analysis of the topoisomerase activity in vitro may contribute greatly to our understanding of the events of initiation and termination of replication in vivo. In conclusion, we have learnt the magnitude of the discrimination by RepD for ICR IIID over non-specific DNA sequences, demonstrated the physical interaction of the carboxyl terminus of the protein with this sequence, and can now propose models not only for the interaction between the protein dimer and one face of the DNA helix but also for the role of magnesium ions in the structural integrity of the complex. Discrimination for ICR IIID is reflected in the nicking of negatively supercoiled DNA; the Rep:ICR III interaction determines the rate of such nicking, and hence the efficiency and specificity of initiation in vivo.

Plasmid constructions containing oriC, oriD and oriN have been described (Thomas et al., 1990a). Negatively supercoiled plasmid DNA was isolated by two rounds of caesium chloride/ethidium bromide density-gradient ultracentrifugation (Sambrook et al., 1989). Plasmids pC221cop903 and pT191cop608 contain deletions in the copy control region, and were used in preference to their wild-type counterparts due to their high copy number. Their origin sequences are unaltered. Preparation of oligonucleotides Conventional oligonucleotides were synthesised using an Applied Biosystems 380B DNA synthesiser, and purified from polyacrylamide gels as described. (+) strand sequences are given in Table 1. Double-stranded substrates were prepared by synthesis of the complementary sequence and annealing together in equimolar amounts. Oligonucleotides containing 4-thiothymidine used S-(2-cyanoethyl)-4-thiothymidine as precursor, and ‘‘fast oligonucleotide deprotection’’ phosphoramidites (Applied Biosystems) for synthesis. Such sequences were prepared with trityl groups attached; after synthesis, oligonucleotides were deprotected by treating with 0.3 M 1,8-diazabicyclo(5,4,0)undec-7-ene in acetonitrile for one hour at room temperature, then cleaved from the solid support by incubation in concentrated aqueous ammonia overnight. Trityl groups were removed with 80% (v/v) acetic acid, and oligonucleotides were purified by ion-exchange using a Pharmacia MonoQ column, binding in 10 mM NaOH and eluting with a 0.5 M to 1 M gradient of NaCl. Oligonucleotides were 5'-end labelled using [g-32P]ATP (Amersham) and phage T4 polynucleotide kinase (BRL) to a specific activity of greater than 200 Bq/ng.

390

Interactions of RepD at ICR III

Gel mobility shift assays Plasmids pUC-C, pUC-D and pUC-N were each digested with PstI and XbaI to release fragments containing oriC, oriD and oriN, respectively. Plasmid pC221cop903 was cut with DraI and HinfI, and the 250 bp fragment containing oriD isolated by excision from a 6% polyacrylamide gel following electrophoresis. DNA was labelled using phage T4 polynucleotide kinase (Pharmacia) and [g-32P]ATP (Amersham) to greater than 370 Bq/ng. Protein (1 to 100 ng), substrate DNA (E0.5 ng radiolabelled or 1 mg unlabelled), and competitor DNA (where indicated) were combined in 30 ml of 50 mM Tris-HCl (pH 7.5), 200 mM KCl, 1 mM EDTA, 10% (v/v) ethanediol, and incubated at 30°C for 15 minutes. After addition of 2 ml dye/EDTA (50% (v/v) glycerol, 200 mM EDTA (pH 8.0), 0.1% (w/v) bromophenol blue), protein-DNA mixtures were electrophoresed through 6% polyacrylamide gels for 1.5 hours at 15 V/cm, using Tris-acetate/EDTA (Sambrook et al., 1989) as running buffer. Unlabelled DNA was detected by staining with ethidium bromide following electrophoresis. Gels containing radioactive samples were fixed, dried onto Whatman 3 MM paper and bands located by autoradiography. Quantification of radioactivity was by liquid scintillation counting using Optiphase Safe (Fisons) as scintillant. Each data set was collected and averaged from between three and six separate experiments. Analysis of binding data Quantification of radioactivity in the retarded and normally migrating DNA bands allowed calculation of the proportion of all labelled oriD in the bound, retarded form (r) and the ratio of unbound to bound forms (u). Binding parameters were evaluated based on the simple dissociation constants describing the binding of RepD to the oriD target initially given by: u = (1 − r)/r = Kapp /[Rt ]

(1)

where Kapp is the apparent dissociation constant. Under the conditions used the concentration of unbound RepD (measured as the dimer; Thomas, 1988) approximates to the total amount of protein, Rt . Closer approximations to the binding curves obtained were made using equation (2): u = Kapp /[Rt ]n

(2)

where the cooperativity factor n is the Hill coefficient, notionally equivalent to the number of (dimer) molecules of RepD bound per molecule of DNA. The effect of competing DNA species was quantified by equation (3): uRt = Kapp + Dt u/(1 + u) + Ct /(k + 1/u)

(3)

where Dt is the concentration of oriD in the form measured directly by autoradiography, Ct is the total concentration of competitor binding sites calculated from the length of added DNA fragment and the fragment concentration, and k is the averaged ratio of binding affinities of the competitor site to that for oriD (a similar derivation has been described elsewhere (Hager et al., 1990)). In the case of added plasmid DNA containing one oriD site per plasmid there are potentially (L − 1)Dt competitor sites, where L is the length of the plasmid in base-pairs. By determination of Rt values at which u = 1 over a range of values of Dt equation (4) applies: Rt = Kapp + Dt [(L − 1)/(k + 1) + 12 ]

(4)

The length of plasmid pC221cop903 as used in such studies is 4169 bp. Experimental data were fit to equations (1) to (4) using the computer program GRAFIT (Erithacus Software). Crosslinking experiments Double-stranded ICR III substrates were prepared by annealing various (+) strands containing 4-thiothymidine with an unsubstituted (−) strand. Substrates (54 ng) were then bound to 3 mg of RepD in 20 ml of 200 mM potassium phosphate (pH 7.5), 1 mM EDTA. After incubation for 15 minutes at 30°C to allow non-covalent binding, samples were irradiated for 15 to 30 seconds by placing as close as possible to the output of a Spot-cure light source (UV Products, Cambridge, U.K.) capable of 800 to 1000 mW/ cm2 intensity at 365 nm (manufacturer’s figures). Products were analysed by SDS-PAGE (Laemmli, 1970) and protein detected by Coomassie staining, followed by detection and quantification of radioactivity using a Molecular Dynamics PhosphorImager with ImageQuant software. Topoisomerase assays Topoisomerase assays were conducted in 50 mM Tris-HCl (pH 9.0), 300 mM KCl, 10 mM MgCl2 , 1 mM EDTA, 10% (v/v) ethanediol. Amounts of RepD as indicated were incubated with 0.5 mg of negatively supercoiled plasmid substrate in a total volume of 30 ml. Competitor DNAs were preincubated with 25 ng of RepD for 15 minutes prior to addition of substrate plasmid. After reaction for one hour at 30°C, 4 ml of dye/EDTA was added and products analysed by electrophoresis through 1% agarose in the presence of 1 mg/ml ethidium bromide (Thomas et al., 1990a). Gel images were captured digitally and band intensities quantified with ImageQuant software. Correction factors, determined empirically, were applied to compensate for differences in fluorescence between open circular (1.5 × ) and relaxed, covalently closed (0.68 × ) topological forms compared with negatively supercoiled DNA. Topoisomerase rates were determined by taking samples during a reaction, quenching the reaction with dye/EDTA, separation of topological forms by gel electrophoresis, and fitting the disappearance of negatively supercoiled DNA to a single exponential decay.

Acknowledgements We thank John Keyte, Jim Turner and Debra Langton for oligonucleotide synthesis, Kathryn Lilley and Elizabeth Cavanagh for amino acid sequence analysis, and Lisa Jennings for technical assistance. We are indebted to Dr Vaman Rao of Cruachem, UK for making available pre-production samples of the phosphoramidite precursor of 4-thiothymidine for oligonucleotide synthesis. This work was supported by the Biomolecular Sciences programme of the Science and Engineering Research Council (C.D.T. and W.V.S.) and the Medical Research Council (T.T.N. and B.A.C.). C.D.T. holds a Research Career Development Fellowship from the Wellcome Trust (ref. 041984/Z/94), from which a grant made possible the purchase of the PhosphorImager (ref. 039375/Z/93).

Interactions of RepD at ICR III

References Balson, D. F. & Shaw, W. V. (1990). Nucleotide sequence of the rep gene of staphylococcal plasmid pCW7. Plasmid, 24, 74–80. Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Brenner, D. G. & Shaw, W. V. (1985). The use of synthetic oligonucleotides with universal templates for rapid DNA sequencing: results with staphylococcal replicon pC221. EMBO J. 4, 561–568. Chen, J. W., Yang, S. H. & Jayaram, M. (1993). Tests for the fractional active-site model in Flp site-specific recombination: Assembly of a functional recombination complex in half-site and full-site strand transfer. J. Biol. Chem. 268, 14417–14425. Dempsey, L. A., Birch, P. & Khan, S. A. (1992). Six amino acids determine the sequence-specific DNA binding and replication specificity of the initiator proteins of the pT181 family. J. Biol. Chem. 267, 24538–24543. Favre, A. (1990). 4-Thiouridine as an intrinsic photoaffinity probe of nucleic acid structure and interactions. In Bioorganic Photochemistry (Morrison, H., ed.), vol. 1, pp. 379–425, John Wiley and Sons, New York. Gennaro, M. L., Iordanescu, S., Novick, R. P., Murray, R. W., Steck, T. R. & Khan, S. A. (1989). Functional organization of the plasmid pT181 replication origin. J. Mol. Biol. 205, 355–362. Hager, P. W., Reich, N. O., Day, J. P., Coche, T. G., Boyer, H. W., Rosenberg, J. M. & Greene, P. J. (1990). Probing the role of glutamic acid 144 in the EcoRI endonuclease using aspartic acid and glutamine replacements. J. Biol. Chem. 265, 21520–21526. Iordanescu, S. (1989). Specificity of the interactions between the Rep proteins and the origins of replication of Staphylococcus aureus plasmids pT181 and pC221. Mol. Gen. Genet. 217, 481–487. Iordanescu, S. & Projan, S. J. (1988). Replication termination for staphylococcal plasmids: plasmids pT181 and pC221 cross-react in the termination process. J. Bacteriol. 170, 3427–3434. Khan, S. A. & Novick, R. P. (1983). Complete nucleotide sequence of pT181, a tetracycline-resistance plasmid from Staphylococcus aureus. Plasmid, 10, 251–259. Koepsel, R. R., Murray, R. W., Rosenblum, W. D. & Khan, S. A. (1985). The replication initiator protein of plasmid pT181 has sequence-specific endonuclease and topoisomerase-like activities. Proc. Natl Acad. Sci. USA, 82, 6845–6849. Koepsel, R. R., Murray, R. W. & Khan, S. A. (1986). Sequence-specific interaction between the replication initiator protein of plasmid pT181 and its origin of replication. Proc. Natl Acad. Sci. USA, 83, 5484–5488. Kunkel, T. A., Roberts, J. D. & Zakour, R. A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods. Enzymol. 154, 367–382. Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680–685. Lane, D., Prentki, P. & Chandler, M. (1992). Use of gel retardation to analyze protein-nucleic acid interactions. Microbiol. Rev. 56, 509–528. Majumder, S. & Novick, R. P. (1988). Intermediates in

391 plasmid pT181 DNA replication. Nucl. Acids Res. 16, 2897–2912. Murray, R. W., Koepsel, R. R. & Khan, S. A. (1989). Synthesis of single-stranded plasmid pT181 DNA in vitro: initiation and termination of DNA replication. J. Biol. Chem. 264, 1051–1057. Nikiforov, T. T. & Connolly, B. A. (1992). Oligodeoxynucleotides containing 4-thiothymidine and 6thiodeoxyguanosine as affinity labels for the EcoRV restriction endonuclease and modification methylase. Nucl. Acids Res. 20, 1209–1214. Noirot, P., Bargonetti, J. & Novick, R. P. (1990). Initiation of rolling-circle replication in pT181 plasmid: Initiator protein enhances cruciform extrusion at the origin. Proc. Natl Acad. Sci. USA, 87, 8560–8564. Novick, R. P. (1989). Staphylococcal plasmids and their replication. Annu. Rev. Microbiol. 43, 537–565. Projan, S. J. & Novick, R. (1988). Comparative analysis of five related staphylococcal plasmids. Plasmid, 19, 203–221. Projan, S. J., Kornblum, J., Moghazeh, S. L., Edelman, I., Gennaro, M. L. & Novick, R. P. (1985). Comparative sequence and functional analysis of pT181 and pC221, cognate plasmid replicons from Staphylococcus aureus. Mol. Gen. Genet. 199, 452–464. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). In Molecular Cloning: A Laboratory Manual, 2nd edit. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Senear, D. F. & Brenowitz, M. (1991). Determination of binding constants for cooperative site-specific protein-DNA interactions using the gel mobility-shift assay. J. Biol. Chem. 266, 13661–13671. Thomas, C. D. (1988). Mechanistic studies of RepD, a staphylococcal plasmid replication initiator protein. PhD thesis, University of Leicester, UK. Thomas, C. D., Balson, D. F. & Shaw, W. V. (1988). Identification of the tyrosine residue involved in bond formation between replication origin and initiator protein of plasmid pC221. Biochem. Soc. Trans. 16, 758–759. Thomas, C. D., Balson, D. F. & Shaw, W. V. (1990a). In vitro studies of the initiation of staphylococcal plasmid replication. Specificity of RepD for its origin (oriD), and characterization of the Rep-ori tyrosyl ester intermediate. J. Biol. Chem. 265, 5519–5530. Thomas, C. D., Balson, D. F., Wigley, D. B. & Shaw, W. V. (1990b). Structure and function of the RepD protein of plasmid pC221. In Molecular Biology of the Staphylococci (Novick, R. P., ed.), pp. 211–218, VCH, New York. Ulanovsky, L. E. & Trifonov, E. T. (1987). Estimation of wedge components in curved DNA. Nature, 326, 720–722. Wang, P.-Z., Projan, S. J., Henriquez, V. & Novick, R. P. (1992). Specificity of origin recognition by replication initiator protein in plasmids of the pT181 family is determined by a six amino acid residue element. J. Mol. Biol. 223, 145–158. Wang, P. Z., Projan, S. J., Henriquez, V. & Novick, R. P. (1993). Origin recognition specificity in pT181 plasmids is determined by a functionally asymmetric palindromic DNA element. EMBO J. 12, 45–52. Zock, J. M., Birch, P. & Khan, S. A. (1990). Specificity of RepC protein in plasmid pT181 DNA replication. J. Biol. Chem. 265, 3484–3488.

Edited by N. Sternberg (Received 2 May 1995; accepted 19 September 1995)