- Email: [email protected]
Determination of the population structure of common bean (Phaseolus vulgaris L.) accessions using lipoxygenase and resistance gene analog markers
Biochemical Systematics and Ecology 59 (2015) 107e115
Contents lists available at ScienceDirect
Biochemical Systematics and Ecology journal homepage: www.elsevier.com/locate/biochemsyseco
Determination of the population structure of common bean (Phaseolus vulgaris L.) accessions using lipoxygenase and resistance gene analog markers Seda Nemli a, Burcu Kutlu b, Bahattin Tanyolac b, * a b
Gumushane University, Department of Genetics and Bioengineering, Gumushane 29100, Turkey Ege University, Department of Bioengineering, Bornova-Izmir 35100, Turkey
a r t i c l e i n f o
a b s t r a c t
Article history: Received 13 November 2014 Accepted 17 January 2015 Available online
The common bean (Phaseolus vulgaris L.) is an important food legume throughout the world. Because of the conservation across different plant species, it is possible to evaluate the degree of genetic diversity in the common bean using gene-based marker techniques. The lipoxygenase (LOX) and resistance gene analog (RGA) genes play an important role in the response to biotic and abiotic stresses. Eighty-six common bean accessions were genotyped using gene-based LOX and RGA markers. The total number of polymorphic bands ranged from 193 for LOX to 17 for RGA markers. We detected considerable diversity with a mean of 8.7 alleles per primer for the LOX analysis. For the RGA markers, the number of alleles per polymorphic locus varied from 1 to 4 with an average allele number of 2.8. The genetic similarity between the accessions based on the LOX and RGA markers ranged from 0.12 to 0.55. Using STRUCTURE, 3 groups were revealed among the accessions. The results of this study should provide valuable information for future studies on the genetic diversity of common bean accessions and for association mapping studies examining the relationships between the genotypic and phenotypic traits related to the stress response. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Common bean LOX RGA Population structure
1. Introduction Phaseolus vulgaris or the common bean is an important food legume in many countries around the world because it has a high protein level and is a good source of important vitamins and minerals. The common bean represents a principal source of daily protein for direct human consumption (Singh, 2000). According to archaeological observations, the common bean originated in Peru and the southwestern United States (Gepts et al., 1988). Currently, it has become the most widely cultivated legume in many developing countries, particularly in Africa, due to its nutritive components (Broughton et al., 2003). Globally, the annual production of green and dry beans is 17 Million tons (FAO, 2010). Common bean production is almost twice that of the second most important legume, the chickpea (Cicer arietinum L.) (Gepts et al., 2008). The genus Phaseolus contains approximately 70 species, providing a large genetic resource (Kwak and Gepts, 2009). Therefore, it is important to understand the genetic diversity of the common bean germplasm. The common bean is a diploid (2n ¼ 2x ¼ 22) with a genome size of 588
* Corresponding author. Tel./fax: þ90 232 388 4955. E-mail address: [email protected] (B. Tanyolac). http://dx.doi.org/10.1016/j.bse.2015.01.016 0305-1978/© 2015 Elsevier Ltd. All rights reserved.
108
S. Nemli et al. / Biochemical Systematics and Ecology 59 (2015) 107e115
mega base pairs (Mbp) and it is a predominantly self-crossing species (Arumuganthan and Earle, 1991). Despite the mediumsized genome, the common bean is a model organism for other legumes. Lipoxygenase (linoleate:oxygen oxidoreductase, EC 1.13.11.12, LOX) enzymes are non-heme iron-containing enzymes that catalyze the conversion of polyunsaturated fatty acids (PUFAs) to hydroperoxy fatty acids in plants, animals, and microorganisms (Prigge et al., 1996). LOXs are present in the seeds, seedlings, and leaves of many plant species, particularly legumes (Hessler et al., 2002; Siedow, 1991). For instance, the LOX protein accounts for up to 2% of the total protein content of soybean seeds (Loiseau et al., 2001). The two most common substrates for LOX are linoleic acid and linolenic acid in higher plants which serve as precursors of several metabolites, including the well-known hormone jasmonic acid (Feussner and Wasternack, 2002). The LOX enzyme plays important roles in several processes including the response to pathogens and wounding, nitrogen storage, senescence, mobilization of stored lipids during germination and the biosynthesis of regulatory molecules (Loiseau et al., 2001). The LOX genes have been shown to be conserved across plant and mammalian genomes (De La Fuente et al., 2013) and plant LOXs can be grouped into two gene subfamilies depending on their sequence similarity. The first subfamily is the LOX1type LOXs, which have been identified in several plants including potato (Geerts et al., 1994) and cucumber (Matsui et al., 2006). The other subfamily, called type 2, has been characterized in plants such as tomato (Heitz et al., 1997). LOX1-type genes have high sequence similarity (75%) while LOX2-type genes show only moderate sequence similarity (35%) (Liavonchanka and Feussner, 2006). For example, 15-LOX from soybean shows 25% identity with the mammalian 15-LOX enzymes and the two human 15-LOXs share 35% identity with each other. On the other hand, distinct subgroups among close species exhibit 70e95% sequence identity (Brash, 1999). Additionally, several studies have examined the similarity of LOX enzymes in the common bean. LOX1 (Eiben and Slusarenko, 1994) and pLOX3 (Meier et al., 1993) show 84.2% and 72.7% homology, respectively, to PvLOX2 in the common bean genome (Porta et al., 1999). Plant disease-resistance (R) genes are classified based on their protein structures (Dangl and Jones, 2001). Approximately 75% of the R genes, such as Arabidopsis RPM1 (Grant et al., 1995) and pepper CaMi (Chen et al., 2007) have been identified in the plant genome. These genes are crucial because of the complex mechanisms of resistance and the interactions involved in pathogen recognition (Selvaraj et al., 2011). Resistance gene analog (RGA) markers are designed using the conserved motifs of the nucleotide-binding site (NBS), the leucine-rich repeat (LRR) and the protein kinase domain of genes that are the most likely to be target genes for disease resistance (Chen et al., 1998). RGA primers have several advantages over arbitrary markers: (i) these markers are useful for different plant species because of the use of conserved sequences and (ii) they are highly reproducible due to the use of longer primers (Naik et al., 2006). Several RGA markers have been successfully used in many studies involving the genetic mapping of resistance genes (Kanazin et al., 1996; Maleki et al., 2003; Zhang et al., 2002) and investigation of the diversity and genetic variation of rice (Ren et al., 2013), wheat (Dong et al., 2009) and common bean (Mutlu et al., 2006). The main objectives of this work were to detect genetic diversity among the common bean population using the conserved LOX gene and RGA primers as resistance gene base markers. To the best of our knowledge, this is the first LOX- and RGA-based genetic diversity study in the common bean. 2. Materials and methods 2.1. Plant material and extraction of DNA Eighty-six accessions of the common bean were used in this study are listed in selected to represent the most important accessions in Table 1. The genomic DNA was extracted from young leaf tissues of seedlings for each accession. A hundred mg of leaf tissue was ground to a powder in liquid nitrogen using Tissue Lyser (Technogen Co. Izmir, Turkey). The DNA was extracted using the DNeasy Plant Mini Kit (Qiagen #69106). The quality of the DNA was confirmed by electrophoresis in a 0.8% agarose gel, and the DNA concentration was measured using a Qubit® 2.0 Fluorometer (Thermo Fisher Scientific Inc., Waltham, MA, USA). The final DNA concentration was adjusted to 100 ng/mL for LOX and 30 ng/mL for RGA analysis, and the diluted DNA was stored at 20 C for the PCR reactions. 2.2. LOX analysis The twenty-four LOX primers that were obtained from Liu et al. (2011) and used for genotyping are listed in Table 2. The LOX primers were modified by the addition of an M13 tail (CACGACGTTGTAAAACGAC) to the 50 end of the forward primer labeled with two different fluorescent dyes, IRD 700 and IRD 800 (Maccaferri et al., 2008). The reverse primers were unlabeled. The amplified products were size separated by 8% polyacrylamide gel electrophoresis in 1 TBE (Tris-borate-EDTA) buffer under the conditions of 1500 V and 40 mA in a LiCor 4300s DNA Analyzer. Image processing to evaluate the fragments was performed using SAGA software (LiCOR Biosciences, Lincoln, NE, USA). 2.3. RGA analysis Eight RGA markers were analyzed in this study (Dong et al., 2009) are listed in Table 2. PCR was carried out in a 20 mL reaction volume containing 30 ng/mL genomic DNA, 1 unit of Taq DNA polymerase (Thermo Sci. Co.), 20 mM MgSO4, 10 mM of
Code number (#)
Name of the variety
Location
Code number (#)
Name of the variety
Location
Code number (#)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22
Surmeli barbunya Alacali barbunya Seker barbun Alacali Ayse Ege barbunya Elindar Yerli barbunya Ayse kadin Kula barbunya Ak Melka Boncuk Sarikiz fasulye Ayse kadin Sari seker Kaynarca Kuru fasulye Beyon Horoz Manda Fasulye Boncuk Ayse Hatay Oturak
Golcuk/Turkey Bozdag/Turkey Golcuk/Turkey Golcuk/Turkey Golcuk/Turkey Golcuk/Turkey Bozdag/Turkey Golcuk/Turkey Bozdag/Turkey Kirklareli/Turkey Kirklareli/Turkey Bandirma/Turkey Bandirma/Turkey Bandirma/Turkey Bandirma/Turkey Bandirma/Turkey Golcuk/Turkey Golcuk/Turkey Kirklareli/Turkey Kirklareli/Turkey Bandirma/Turkey Bandirma/Turkey
23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44
Gino Sarikiz Yalova 5 Yalova 17 Gino 10 Dilme sarikiz Taze Gunluk Piyazlik Horan Mora Ispir Arba Taze fasulye Alman ayse Alman sarikiz Meksika fasulyesi Kuru fasulye 13 Volare Mergseed Volare Mergseed
Bandirma/Turkey 45 Kirklareli/Turkey 46 Yalova5/Turkey 47 Yalova17/Turkey 48 Gino/Turkey 49 Sarikiz/Turkey 50 Selcuk/Turkey 51 Tokat/Turkey 52 Tire/Turkey 53 Antalya/Turkey 54 Tekirdag/Turkey 55 Karadeniz/Turkey 56 Isparta/Turkey 57 Isparta/Turkey 58 Karadeniz/Turkey 59 Turkey 60 Sarikiz/Turkey 61 Turkey 62 Turkey 63 Turkey 64 Turkey 65 Bulgaria 66
Name of the variety
Location
Code number (#)
Name of the variety
Location
Helda Emergo155 Purple teepe 141 Sarıkız Roma 2 Roma 2 Admires 3060 Dolic hos Flora Lima Maxi Cobra Algarve Magnum Alman ays¸e 5 Limka no:209 Maxi bell Provider E-Z Pick Fortex Kolti
Turkey Germany Germany Turkey Turkey Turkey Netherlands India India USA England England England Turkey Bursa/Turkey Netherlands Netherlands USA USA USA USA Turkey
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86
Naham Mergseed 2 Boncuk ays¸e Pearl 3010 Algarve 41.520 Dolic hos Ays¸e kadın Güz fasulye Ays¸e kadın Yerli 1 Blue Lake 274 Primol Baroma Isabel Solista Akdag 1085 Yerli 25 GITA Green jumbo
Turkey Bulgaria Turkey Netherlands Germany India Trabzon/Turkey Trabzon/Turkey Trabzon/Turkey Bursa/Turkey USA England England England England Samsun/Turkey Samsun/Turkey Ankara/Turkey USA USA
S. Nemli et al. / Biochemical Systematics and Ecology 59 (2015) 107e115
Table 1 A list of the 86 P. vulgaris genotypes and locations.
109
110
Table 2 Primer sequences for LOX and RGA marker were used to genetic diversity analysis in this study. Primer forward (50 -30 ) M13 Labeled
Primer reverse
RGA primer name
Primer forward
Primer reverse
LOX01 LOX02 LOX03 LOX04 LOX05 LOX06 LOX07 LOX08 LOX09 LOX10 LOX11 LOX12 LOX13 LOX14 LOX15 LOX16 LOX17 LOX18 LOX19 LOX20 LOX21 LOX22 LOX23 actin
CACGACGTTGTAAAACGACTGAGCGTGCTTCATCCAATCC CACGACGTTGTAAAACGACCATGAAGGGCTGAAGATACCC CACGACGTTGTAAAACGACTGGTGGAAAGAGGTTAGA CACGACGTTGTAAAACGACATTTGCTATGGAGTTGTCTTC CACGACGTTGTAAAACGACACACCCTCAACATAACAA CACGACGTTGTAAAACGACAACCAAATCTCAAGTCCATCA CACGACGTTGTAAAACGACCGTATCAACGCAAATGCT CACGACGTTGTAAAACGACGCTGATGGGATTATTGAAAC CACGACGTTGTAAAACGACGAGCCATTCATCATTGGAACA CACGACGTTGTAAAACGACTCATTCCGTACTGCTTCATCG CACGACGTTGTAAAACGACGAAATCGAGATCCCAACC CACGACGTTGTAAAACGACCGTAAGAACCTCATCAATGCCA CACGACGTTGTAAAACGACCCACCAAGCTTGTAGCTCTG CACGACGTTGTAAAACGACGCTTGCAGCTCTTTATCATTAG CACGACGTTGTAAAACGACTCAAGAACATCACGACCGTAGT CACGACGTTGTAAAACGACGGCGAAAGGGTAGTCTTCTATG CACGACGTTGTAAAACGACAAGCCTTTCACCGACTTTAC CACGACGTTGTAAAACGACACAACATTTGGGTTGGGATAG CACGACGTTGTAAAACGACAGGGTAGTCTTCAATAGCAAGC CACGACGTTGTAAAACGACTGCTGGTCTTAACCCATACAG CACGACGTTGTAAAACGACGAATTTAAGTTCCGCTTTCAG CACGACGTTGTAAAACGACACGCCACAAGCAACTGGACAT CACGACGTTGTAAAACGACTGCCTCCAACACCTTCTTCAA CACGACGTTGTAAAACGACTCGTGCTGGATTCTGGTG
CATGTTTCTTGTCAGCGTGGC GTCCTTGTTAATGGTGATGGTC TATGCCTACGACTTATTG CATGCTTCATGTTTCTTGTCA CTCAATAATGCCATCAAC CTTCATCCAATTCACAAGCTG ATTGGCGAAAGGGTAGTC TCACTCATTGGACGAGTTGA CATCGACTGCGTAAGGGTAAT GCTGCTCCATCCTCACTTTCG TCTTCCCGTATGAGTGTC GCTTGCAGCTCTTTATCATTTG CTCGTAAGAACCTTATCAATGCT GTGGCATCATTGAAGGAACAT CAAATAGGCAATTGAGTACGG AACTCGTTGTTCACTGGCTTAG GCTGATTCTTGAGGACCATA GCGTGGAACCTTATGTGATTG CTTACATCATTGCAGCAAACAG CCTAAGTGTTCCATCCTCGTT CCATCAATAGGTGGTCGTGTC TTTGTAAGCTGCGGCACTGAT CTTCCATATCAAATCGCCACA GGCAGTGGTGGTGAACAT
RGA-RLRR RGA-XLRR-INV1 RGA-Pto kin3 RGA-XLRR RGA-NLRR RGA-Cre3Ploop RGA-NLRR-INV1 RGA-Pto-kin1 IN1
CGCAACCACTAGAGTAAC TTGTCAGGCCAGATACCC TACTTCGGACGTTTACAT CCGTTGGACAGGAAGGAG TAGGGCCTCTTGCATCGT GCGGGTCTGGGAAATCTACC TGCTACGTTCTCCGGG AAGTGGAACAAGGTTAGG
ACACTGGTCCATGAGGTT GAGGAAGGACAGGTTGCC AGTGTCTTGTAGGGTATC CCCATAGACCGGACTGTT TATAAAAAGTGCCGGACT CTGCAGTAAGCAAAGCAACG TCAGGCCGTGAAAAATAT GATGCACCACCAGGGGG
S. Nemli et al. / Biochemical Systematics and Ecology 59 (2015) 107e115
LOX primer name
S. Nemli et al. / Biochemical Systematics and Ecology 59 (2015) 107e115
111
Table 3 Characteristics of the LOX and RGA profiles used for genotyping of common bean accessions. No
LOX primer pair name
PIC
Number of polymorphic bands
No
LOX primer pair name
PIC
Number of polymorphic bands
No
RGA primer name
PIC
Number of polymorphic bands
1 2 3 4 5 6 7 8 9 10 11
LOX1 LOX2 LOX3 LOX4 LOX5 LOX6 LOX7 LOX9 LOX10 LOX11 LOX12
0.2 0.5 0.1 0.1 0.3 0.3 0.3 0.1 0.3 0.1 0.3
41 2 7 4 5 8 4 6 6 2 5
12 13 14 15 16 17 18 19 20 21 22
LOX13 LOX14 LOX15 LOX16 LOX17 LOX18 LOX19 LOX20 LOX21 LOX23 actin Average
0.1 0.1 0.5 0.3 0.1 0.4 0.2 0.2 0.1 0.3 0.3 0.23
3 5 7 5 22 18 15 15 3 7 3 Total 193
1 2 3 4 5 6
RLRR XLRR-INV1 XLRR NLRR Cre3Ploop Pto-kin1 IN1 Average
0.2 0.5 0.4 0.3 0.7 0.5 0.43
2 3 3 4 1 4 Total 17
each dNTP (Thermo Sci. Co), 10 pmol of each primer pair (forward and reverse), 10 PCR buffer (200 mM TriseHCl, pH 8.3, 100 mM KCl, 100 mM (NH4)2SO4, 1% Triton X-100, 1 g/ml BSA). A Peltier thermal cycler (DNA Engine DYAD™ Bio-Rad, Hercules, CA, USA) was programmed as follows: an initial denaturation step of 3 min at 94 C, 40 cycles of denaturation for 30 s at 94 C, annealing for 40 s at 45e65 C (depending on the nucleotide content of the primers), extension for 30 s at 72 C and a final extension for 5 min at 72 C. The thermal cycler was programmed to hold the product at 4 C. After amplification, the reaction products and a 100 bp DNA ladder (Thermo Sci. Co.) were separated by electrophoresis in 2% agarose gels in 1 TBE buffer for approximately 3 h at 120 V. The gels were photographed using a G-box SYNGENE gel documentation system. 2.4. Statistical analysis and population structure Only reproducible and clearly amplified bands were scored for the construction of the data matrix. The robust polymorphic bands were scored as present (1) or absent (0) for each primer, as described for conserved gene-based markers (Collard and Mackill, 2009; Xiong et al., 2013). The genetic similarity was determined between accessions using the software NTSYS-pc (Numerical Taxonomy and Multiware Analysis System, version 2.0) according to Jaccard's similarity matrix (Rohlf, 1988). The polymorphism information content (PIC) for each LOX and RGA marker was calculated (Anderson et al., 1993) P using the equation PIC ¼ 1 pi 2 , where pi is the proportion of the population with the i-th.
Fig. 1. LOX profiles of 48 common bean accessions obtained with the primer pair LOX1.
112
S. Nemli et al. / Biochemical Systematics and Ecology 59 (2015) 107e115
Fig. 2. RGA profiles of 68 common bean accessions obtained with the primer pair XLRR INV1.
Model-based cluster analysis was performed to infer the genetic structure of three datasets (LOX data, RGA data, both LOX and RGA data) using STRUCTURE version 2.2 (Pritchard et al., 2000a, 2000b). In this model, a number of populations (K) is assumed to be present, each of which is characterized by a set of distinctive allele frequencies at each locus, and individuals are placed into K clusters. The program was run ten times for each value of populations K varying from 2 to 10; for except K ¼ 1, where only one run was performed. The posterior probabilities were estimated using the Markov Chain Monte Carlo (MCMC) method. The MCMC chains were run with a 100,000-iteration burn-in period, followed by 100,000 iterations using a model allowing for admixture and correlated allele frequencies. The most likely value for K was estimated using Evanno's DK method (Evanno et al., 2005) using STRUCTURE HARVESTER (Earl and VonHoldt, 2011). 3. Results and discussion A total of 24 and 8 pairs of primers amplified fragments from the LOX and RGA regions in 86 common bean accessions, respectively. A total of 28 primers generated polymorphisms, with 22 polymorphisms for LOX and 6 for RGA. The primers for LOX-8, LOX-22, RGA Pto kin3 and RGA NLRR-INV1 detected no polymorphism therefore, these primers were excluded from the analysis. The total number of polymorphic bands was 193 for LOX and 17 for RGA (Table 3). A representative gel for the LOX-1 primer pair is presented in Fig. 1, and a gel showing XLRR INV1 is presented in Fig. 2. Naik et al. (2006) used the same
Fig. 3. Bar graph generated using STRUCTURE 2.2 software showing relationships among common bean accessions using LOX and RGA markers data. Each population is represented by a different color. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
S. Nemli et al. / Biochemical Systematics and Ecology 59 (2015) 107e115
113
RGA primer pairs, including XLRR-INV1, Pto kin3, and XLRR, and they detected 8 polymorphic loci using 5 RGA primer pairs in apple. The copy number of the same region in the common bean is more than that in apple. This situation also demonstrated that the RGA copy number varied from species to species. And they reported that RGA markers could also help to characterize the genetic structure and geographic distribution in crops, including rice, wheat, barley, and banana (Ren et al., 2013). The ability of RGA primers to detect variation in the common bean has also been demonstrated previously. For example, Hanai et al. (2010) analyzed common bean RIL population using 4 RGA primer pairs for mapping based on the NBS-profiling method and scored a total of 32 polymorphic bands. For common bean accessions, analysis of LOX and RGA gene-based markers with 24 primer combinations identified a total of 210 scorable bands as a multiple banding pattern. This may be explained by the presence of short, conserved DNA regions at multi-copy sites within the common bean genome (Nemli et al., 2014). Similarly, Salvia miltiorrhiza (Wang et al., 2009), apple (Gulsen et al., 2010), and common bean (Nemli et al., 2014) obtained multiple bands in their studies using primers design based on conserved DNA sequences such as CoRAP, Target Region Amplification Polymorphism (TRAP) and POX. Wang et al. (2009) detected a total of 20 polymorphic bands using four CoRAP primer combinations, and each primer pair produced an average of 3.3 polymorphic bands in miltiorrhiza (Wang et al., 2009). In this study, the number of alleles per polymorphic locus varied from 2 to 41 with an average of 8.7 for LOX gene-based analysis. The largest number of different alleles was detected with the primers for LOX-1 (41), whereas the smallest number (2) was found with primers for LOX-2 and LOX-11. For the RGA gene-based markers, the number of alleles per polymorphic locus varied from 1 to 4, with an average allele number of 2.8. The primers that detected the highest numbers of polymorphisms were Pto kin1 IN1 and NLRR (4 bands) for RGA. Mutlu et al. (2008) reported that the average number of fragments per primer was 1.5 for RGA in eggplant. The mean number of alleles obtained with all primers (LOX and RGA) was 7.5 (Table 3). Similarly, Jayashree et al. (2010) detected 458 polymorphic bands, with a mean of 16 bands using 29 RGA primers among 40 sugarcane cultivars. This high level of polymorphism is expected for sugarcane due to its genome size, which is approximately et al., 2005). 20 times larger than that of the common bean (Edme The polymorphism information content varied from 0.1 (LOX-3, 4, 9, 11, 13, 14, 17, and 21) to 0.7 (RGA marker Cre3Ploop), with an average of 0.3 which was lower than the values found in previous common bean studies (Nemli et al., 2014) (Table 3). Cre3Ploop was the best marker for discriminating between genotypes due to its higher PIC values. Nemli et al. (2014) found that the mean PIC value for POX products was 0.40 among common bean accessions (Nemli et al., 2014). LOX gene-based markers (0.23) had lower allelic richness than RGA gene-based markers (0.43) regardless of the marker size analyzed. The ability of the markers to distinguish among common bean genotypes (PIC) was similarly variable, which is consistent with previous studies (Benchimol et al., 2007). The genetic similarity between the accessions based on the LOX and RGA markers ranged from 0.12 to 0.55 with a mean value of 0.34. These results revealed a low degree of genetic diversity at the LOX and RGA level. The similarity value (0.55) demonstrated that the two most closely related accessions were #8 (Ayse kadin-Golcuk/Turkey) and #10 (Ak-Kirklareli/ Turkey). These results are in accordance with Nemli et al. (2014) who analyzed the same genotypes as those analyzed here. The authors found similarity coefficients ranging between 0.7 and 1. The lowest values of genetic similarity (0.12) were observed for comparisons between accession #9 (Kula barbunya-Bozdag/Turkey) and accession #42 (Mergseed-Turkey), indicating that these cultivars were highly distinct from each other. In this study, the population structure of 86 common bean accessions was characterized with the software STRUCTURE version 2.2 according to data for LOX and RGA (Fig. 3). The results implied that it was the most reasonable to divide the 86 common bean accessions into 3 populations designated as POP1, POP2, and POP3 and each population contained 22e35 common bean accessions. Population 1 consisted of 22 accessions [15 from Turkey (Golcuk, Bozdag, Bandirma, Tokat, Kirklareli, Bursa) and 7 from different countries (Netherlands, England, Bulgaria, Germany, USA)]. Population 2 contained 29 accessions almost all of which (93%) were accessions from Turkey; only 2 were from different countries (#57; England and #62; USA). Population 3 comprised the majority of the groups including cultivar accessions of various origins (17 from Turkey and 18 from different countries). Similarly, Ceylan et al. (2014) identified 3 populations among the common bean genotypes using STRUCTURE with 3 different marker systems (SRAP, POGP and cpSSR). Nemli et al. (2014) determined the population structure among 67 common bean accessions and detected 5 groups of populations with 80 POX gene-based markers. On the other hand, the present study revealed that the genetic materials used in the current study could be divided into 9 groups using 193 LOX markers and into 6 groups using 17 RGAs. This result may suggest that analyzing the LOX and RGA markers separately provides better resolution for discriminating the populations (Nemli et al., 2014). According to the amplification results, it was observed that the LOX markers are more polymorphic compared with the RGA markers.
References Anderson, J.A., Churchill, G.A., Autrique, J.E., Tanksley, S.D., Sorrells, M.E., 1993. Optimizing parental selection for genetic-linkage maps. Genome 36, 181e186. Arumuganthan, K., Earle, E., 1991. Nuclear DNA content of some important plant species. Plant Mol. Biol. Rep. 9, 208e218. ^a, L.R.L., Souza, A.P., 2007. Structure of genetic diversity Benchimol, L.L., Campos, T., Carbonell, S.A.M., Colombo, C., Chioratto, A.F., Formighieri, E.F., Gouve among common bean (Phaseolus vulgaris L.) varieties of Mesoamerican and Andean origins using new developed microsatellite markers. Genet. Resour. Crop Evol. 54, 1747e1762. Brash, A.R., 1999. Lipoxygenases: occurrence, functions, catalysis, and acquisition of substrate. J. Biol. Chem. 274, 23679e23682. andez, G., Blair, M., Beebe, S., Gepts, P., Vanderleyden, J., 2003. Beans (Phaseolus spp.) e model food legumes. Plant Soil 55e128. Broughton, W.J., Hern
114
S. Nemli et al. / Biochemical Systematics and Ecology 59 (2015) 107e115
€ Ceylan, A., Ocal, N., Akbulut, M., 2014. Genetic diversity among the Turkish common bean cultivars (Phaseolus vulgaris L.) as assessed by SRAP, POGP and cpSSR markers. Biochem. Syst. Ecol. 54, 129e229. Chen, R.G., Li, H.X., Zhang, L.Y., Zhang, J.H., Xiao, J.H., Ye, Z.B., 2007. CaMi, a root-knot nematode resistance gene from hot pepper (Capsium annuum L.) confers nematode resistance in tomato. Plant Cell. Rep. 26, 895e905. Chen, X.M., Line, R.F., Leung, H., 1998. Genome scanning for resistance-gene analogs in rice, barley, and wheat by high-resolution electrophoresis. Theor. Appl. Genet. 97, 345e355. Collard, B.C.Y., Mackill, D.J., 2009. Conserved DNA-derived polymorphism (CDDP): a simple and novel method for generating DNA markers in plants. Plant Mol. Biol. Report. 27, 558e562. Dangl, J.L., Jones, J.D.G., 2001. Plant pathogens and integrated defence responses to infection. Nature 411, 826e833. De La Fuente, G.N., Murray, S.C., Isakeit, T., Park, Y.S., Yan, Y., Warburton, M.L., Kolomiets, M.V., 2013. Characterization of genetic diversity and linkage disequilibrium of ZmLOX4 and ZmLOX5 loci in maize. Plos One 8 (1), e53973. http://dx.doi.org/10.1371/journal.pone.0053973. Dong, P., Wei, Y.M., Chen, G.Y., Li, W., Nevo, E., Zheng, Y.L., 2009. Resistance gene analog polymorphisms (RGAPs) in wild emmer wheat (Triticum dicoccoides) and their ecological associations. Genet. Resour. Crop Evol. 56, 121e136. Earl, D., VonHoldt, B., 2011. STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 4, 359e361. , S.J., Comstock, J.C., Miller, J.D., Tai, P.Y.P., 2005. Determination of DNA content and genome size in sugarcane. J. Am. Soc. Sugarcane Tech. 25, 1e16. Edme Eiben, H.G., Slusarenko, A.J., 1994. Complex spatial and temporal expression of lipoxygenase genes during Phaseolus vulgaris (L.) development. Plant J 5, 123e135. Evanno, G., Regnaut, S., Goudet, J., 2005. Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol. Ecol. 14, 2611e2620. FAO, 2010. Food and Agriculture Organization of the United Nations. Feussner, I., Wasternack, C., 2002. The lipoxygenase pathway. Annu. Rev. Plant Biol. 53, 275e297. Geerts, A., Feltkamp, D., Rosahl, S., 1994. Expression of lipoxygenase in wounded tubers of Solanum tuberosum L. Plant Physiol. 105, 269e277. Gepts, P., FL, A., deBarros, E., Blair, M., Brondani, R., Broughton, W., Galasso, I., Hernandez, G., Kami, J., Lariguet, P., et al., 2008. Genomics of Phaseolus beans, a major source of dietary protein and micronutrients in the tropics. In: Genomics of Tropical Crop Plants. Springer, Philadelphia. Gepts, P., Kmiecik, K., Pereira, P., Bliss, F.A., 1988. Dissemination pathways of common bean (Phaseolus vulgaris, Fabaceae) deduced from phaseolin electrophoretic variability. Am. Econ. Bot. 42, 73e85. Grant, M.R., Godiard, L., Straube, E., Ashfield, T., Lewald, J., Sattler, A., Innes, R.W., Dangl, J.L., 1995. Structure of the Arabidopsis Rpm1 gene enabling dualspecificity disease resistance. Science 269, 843e846. Gulsen, O., Kaymak, S., Ozongun, S., Uzun, A., 2010. Genetic analysis of Turkish apple germplasm using peroxidase gene-based markers. Sci. Hortic. 125, 368e373. Hanai, L.R., Santini, L., Camargo, L.E.A., Fungaro, M.H.P., Gepts, P., Tsai, S.M., Vieira, M.L.C., 2010. Extension of the core map of common bean with EST-SSR, RGA, AFLP, and putative functional markers. Mol. Breed. 25, 25e45. Heitz, T., Bergey, D.R., Ryan, C.A., 1997. A gene encoding a chloroplast-targeted lipoxygenase in tomato leaves is transiently induced by wounding, systemin, and methyl jasmonate. Plant Physiol. 114, 1085e1093. Hessler, T.G., Thomson, M.J., Benscher, D., Nachit, M.M., Sorrells, M.E., 2002. Association of a lipoxygenase locus, Lpx-B1, with variation in lipoxygenase activity in durum wheat seeds. Crop Sci. 42, 1695e1700. Jayashree, J., Selvi, A., Nair, N.V., 2010. Characterization of resistance gene analog polymorphisms in sugarcane cultivars with varying levels of red rot resistance. Electron. J. Plant Breed. 1, 1191e1199. Kanazin, V., Marek, L.F., Shoemaker, R.C., 1996. Resistance gene analogs are conserved and clustered in soybean. Proc. Natl. Acad. Sci. U. S. A. 93, 11746e11750. Kwak, M., Gepts, P., 2009. Structure of genetic diversity in the two major gene pools of common bean (Phaseolus vulgaris L., Fabaceae). Theor. Appl. Genet. 118, 979e992. Liavonchanka, A., Feussner, N., 2006. Lipoxygenases: occurrence, functions and catalysis. J. Plant Physiol. 163, 348e357. Liu, S.Q., Liu, X.H., Jiang, L.W., 2011. Genome-wide identification, phylogeny and expression analysis of the lipoxygenase gene family in cucumber. Genet. Mol. Res. 10, 2613e2636. Loiseau, J., Vu, B.L., Macherel, M.H., Le Deunff, Y., 2001. Seed lipoxygenases: occurrence and functions. Seed Sci. Res. 11, 199e211. Maccaferri, M., Sanguineti, M.C., Corneti, S., Ortega, J.L.A., Ben Salem, M., Bort, J., DeAmbrogio, E., del Moral, L.F.G., Demontis, A., et al., 2008. Quantitative trait loci for grain yield and adaptation of durum wheat (Triticum durum Desf.) across a wide range of water availability. Genetics 178, 489e511. Maleki, L., Faris, J.D., Bowden, R.L., Gill, B.S., Fellers, J.P., 2003. Physical and genetic mapping of wheat kinase analogs and NBS-LRR resistance gene analogs. Crop Sci. 43, 660e670. Matsui, K., Minami, A., Hornung, E., Shibata, H., Kishimoto, K., Ahnert, V., Kindl, H., Kajiwara, T., Feussner, I., 2006. Biosynthesis of fatty acid derived aldehydes is induced upon mechanical wounding and its products show fungicidal activities in cucumber. Phytochem 67, 649e657. Meier, B., Shaw, N., Slusarenko, A.J., 1993. Spatial and temporal accumulation of defense gene transcripts in bean (Phaseolus vulgaris) leaves in relation to bacteria-induced hypersensitive cell death. Mol. Plant Microbe Interact 6, 453e466. Mutlu, N., Boyaci, F.H., Gocmen, M., Abak, K., 2008. Development of SRAP, SRAP-RGA, RAPD and SCAR markers linked with a Fusarium wilt resistance gene in eggplant. Theor. Appl. Genet. 117, 1303e1312. Mutlu, N., Miklas, P.N., Coyne, D.P., 2006. Resistance gene analog polymorphism (RGAP) markers co-localize with disease resistance genes and QTL in common bean. Mol. Breed 17, 127e135. Naik, S., Hampson, C., Gasic, K., Bakkeren, G., Korban, S.S., 2006. Development and linkage mapping of E-STS and RGA markers for functional gene homologues in apple. Genome 49, 959e968. Nemli, S., Kaya, H.B., T, B., 2014. Genetic assessment of common bean (Phaseolus vulgaris L.) accessions by peroxidase gene-based markers. J. Sci. Food Agric. 94, 1672e1680. Porta, H., Rueda-Benitez, P., Campos, F., Colmenero-Flores, J.M., Colorado, J.M., Carmona, M.J., Covarrubias, A.A., Rocha-Sosa, M., 1999. Analysis of lipoxygenase mRNA accumulation in the common bean (Phaseolus vulgaris L.) during development and under stress conditions. Plant Cell Physiol. 40, 850e858. Prigge, S., Boyington, J., Gaffney, B., Amzel, M., 1996. Lipoxygenases: Structure and Function. AOCS Press, Champaign, IL. Pritchard, J., Stephens, M., Donnelly, P., 2000a. Inference of population structure using multilocus genotype data. Genetics 155, 945e959. Pritchard, J., Stephens, M., Rosenberg, N., Donnelly, P., 2000b. Association mapping in structured populations. Am. J. Hum. Genet. 67, 170e181. Ren, J.S., Yu, Y.C., Gao, F.Y., Zeng, L.H., Lu, X.J., Wu, X.T., Yan, W.G., Ren, G.J., 2013. Application of resistance gene analog markers to analyses of genetic structure and diversity in rice. Genome 56, 377e387. Rohlf, F., 1988. NTSYS-pc Numerical Taxonomy and Multivariate Analysis System (New York). Selvaraj, C.I., Babu, S., Sankar, P.D., Nagarajan, P., Sabesan, M., 2011. Genome scanning for identification of resistance gene analogs (RGAs) in a highly durable blast resistance rice (Oryza sativa L.) cultivar, Moroberekan. Afr. J. Biotechnol. 10, 6418e6433. Siedow, J.N., 1991. Plant lipoxygenase e structure and function. Ann. Rev. Plant Physiol. Plant Mol. Biol. 42, 145e188. Singh, S.P., 2000. Broadening the genetic base of common bean cultivars: a review. Crop Sci. 41, 1659e1675. Wang, Q.H., Zhang, B.L., Lu, Q.S., 2009. Conserved region amplification polymorphism (CoRAP), a novel marker technique for plant genotyping in Salvia miltiorrhiza. Plant Mol. Biol. Rep. 27, 139e143.
S. Nemli et al. / Biochemical Systematics and Ecology 59 (2015) 107e115
115
Xiong, F.Q., Liu, J.X., Zhong, R.C., Jiang, J., Han, Z.Q., He, L.Q., Li, Z., Tang, X.M., Tang, R.H., 2013. Intron targeted amplified polymorphism (ITAP), a new sequence related amplified polymorphism-based technique for generating molecular markers in higher plant species. Plant Omics 6, 128e134. Zhang, L.P., Khan, A., Nino-Liu, D., Foolad, M.R., 2002. A molecular linkage map of tomato displaying chromosomal locations of resistance gene analogs based on a Lycopersicon esculentum x Lycopersicon hirsutum cross. Genome 45, 133e146.
Contents lists available at ScienceDirect
Biochemical Systematics and Ecology journal homepage: www.elsevier.com/locate/biochemsyseco
Determination of the population structure of common bean (Phaseolus vulgaris L.) accessions using lipoxygenase and resistance gene analog markers Seda Nemli a, Burcu Kutlu b, Bahattin Tanyolac b, * a b
Gumushane University, Department of Genetics and Bioengineering, Gumushane 29100, Turkey Ege University, Department of Bioengineering, Bornova-Izmir 35100, Turkey
a r t i c l e i n f o
a b s t r a c t
Article history: Received 13 November 2014 Accepted 17 January 2015 Available online
The common bean (Phaseolus vulgaris L.) is an important food legume throughout the world. Because of the conservation across different plant species, it is possible to evaluate the degree of genetic diversity in the common bean using gene-based marker techniques. The lipoxygenase (LOX) and resistance gene analog (RGA) genes play an important role in the response to biotic and abiotic stresses. Eighty-six common bean accessions were genotyped using gene-based LOX and RGA markers. The total number of polymorphic bands ranged from 193 for LOX to 17 for RGA markers. We detected considerable diversity with a mean of 8.7 alleles per primer for the LOX analysis. For the RGA markers, the number of alleles per polymorphic locus varied from 1 to 4 with an average allele number of 2.8. The genetic similarity between the accessions based on the LOX and RGA markers ranged from 0.12 to 0.55. Using STRUCTURE, 3 groups were revealed among the accessions. The results of this study should provide valuable information for future studies on the genetic diversity of common bean accessions and for association mapping studies examining the relationships between the genotypic and phenotypic traits related to the stress response. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Common bean LOX RGA Population structure
1. Introduction Phaseolus vulgaris or the common bean is an important food legume in many countries around the world because it has a high protein level and is a good source of important vitamins and minerals. The common bean represents a principal source of daily protein for direct human consumption (Singh, 2000). According to archaeological observations, the common bean originated in Peru and the southwestern United States (Gepts et al., 1988). Currently, it has become the most widely cultivated legume in many developing countries, particularly in Africa, due to its nutritive components (Broughton et al., 2003). Globally, the annual production of green and dry beans is 17 Million tons (FAO, 2010). Common bean production is almost twice that of the second most important legume, the chickpea (Cicer arietinum L.) (Gepts et al., 2008). The genus Phaseolus contains approximately 70 species, providing a large genetic resource (Kwak and Gepts, 2009). Therefore, it is important to understand the genetic diversity of the common bean germplasm. The common bean is a diploid (2n ¼ 2x ¼ 22) with a genome size of 588
* Corresponding author. Tel./fax: þ90 232 388 4955. E-mail address: [email protected] (B. Tanyolac). http://dx.doi.org/10.1016/j.bse.2015.01.016 0305-1978/© 2015 Elsevier Ltd. All rights reserved.
108
S. Nemli et al. / Biochemical Systematics and Ecology 59 (2015) 107e115
mega base pairs (Mbp) and it is a predominantly self-crossing species (Arumuganthan and Earle, 1991). Despite the mediumsized genome, the common bean is a model organism for other legumes. Lipoxygenase (linoleate:oxygen oxidoreductase, EC 1.13.11.12, LOX) enzymes are non-heme iron-containing enzymes that catalyze the conversion of polyunsaturated fatty acids (PUFAs) to hydroperoxy fatty acids in plants, animals, and microorganisms (Prigge et al., 1996). LOXs are present in the seeds, seedlings, and leaves of many plant species, particularly legumes (Hessler et al., 2002; Siedow, 1991). For instance, the LOX protein accounts for up to 2% of the total protein content of soybean seeds (Loiseau et al., 2001). The two most common substrates for LOX are linoleic acid and linolenic acid in higher plants which serve as precursors of several metabolites, including the well-known hormone jasmonic acid (Feussner and Wasternack, 2002). The LOX enzyme plays important roles in several processes including the response to pathogens and wounding, nitrogen storage, senescence, mobilization of stored lipids during germination and the biosynthesis of regulatory molecules (Loiseau et al., 2001). The LOX genes have been shown to be conserved across plant and mammalian genomes (De La Fuente et al., 2013) and plant LOXs can be grouped into two gene subfamilies depending on their sequence similarity. The first subfamily is the LOX1type LOXs, which have been identified in several plants including potato (Geerts et al., 1994) and cucumber (Matsui et al., 2006). The other subfamily, called type 2, has been characterized in plants such as tomato (Heitz et al., 1997). LOX1-type genes have high sequence similarity (75%) while LOX2-type genes show only moderate sequence similarity (35%) (Liavonchanka and Feussner, 2006). For example, 15-LOX from soybean shows 25% identity with the mammalian 15-LOX enzymes and the two human 15-LOXs share 35% identity with each other. On the other hand, distinct subgroups among close species exhibit 70e95% sequence identity (Brash, 1999). Additionally, several studies have examined the similarity of LOX enzymes in the common bean. LOX1 (Eiben and Slusarenko, 1994) and pLOX3 (Meier et al., 1993) show 84.2% and 72.7% homology, respectively, to PvLOX2 in the common bean genome (Porta et al., 1999). Plant disease-resistance (R) genes are classified based on their protein structures (Dangl and Jones, 2001). Approximately 75% of the R genes, such as Arabidopsis RPM1 (Grant et al., 1995) and pepper CaMi (Chen et al., 2007) have been identified in the plant genome. These genes are crucial because of the complex mechanisms of resistance and the interactions involved in pathogen recognition (Selvaraj et al., 2011). Resistance gene analog (RGA) markers are designed using the conserved motifs of the nucleotide-binding site (NBS), the leucine-rich repeat (LRR) and the protein kinase domain of genes that are the most likely to be target genes for disease resistance (Chen et al., 1998). RGA primers have several advantages over arbitrary markers: (i) these markers are useful for different plant species because of the use of conserved sequences and (ii) they are highly reproducible due to the use of longer primers (Naik et al., 2006). Several RGA markers have been successfully used in many studies involving the genetic mapping of resistance genes (Kanazin et al., 1996; Maleki et al., 2003; Zhang et al., 2002) and investigation of the diversity and genetic variation of rice (Ren et al., 2013), wheat (Dong et al., 2009) and common bean (Mutlu et al., 2006). The main objectives of this work were to detect genetic diversity among the common bean population using the conserved LOX gene and RGA primers as resistance gene base markers. To the best of our knowledge, this is the first LOX- and RGA-based genetic diversity study in the common bean. 2. Materials and methods 2.1. Plant material and extraction of DNA Eighty-six accessions of the common bean were used in this study are listed in selected to represent the most important accessions in Table 1. The genomic DNA was extracted from young leaf tissues of seedlings for each accession. A hundred mg of leaf tissue was ground to a powder in liquid nitrogen using Tissue Lyser (Technogen Co. Izmir, Turkey). The DNA was extracted using the DNeasy Plant Mini Kit (Qiagen #69106). The quality of the DNA was confirmed by electrophoresis in a 0.8% agarose gel, and the DNA concentration was measured using a Qubit® 2.0 Fluorometer (Thermo Fisher Scientific Inc., Waltham, MA, USA). The final DNA concentration was adjusted to 100 ng/mL for LOX and 30 ng/mL for RGA analysis, and the diluted DNA was stored at 20 C for the PCR reactions. 2.2. LOX analysis The twenty-four LOX primers that were obtained from Liu et al. (2011) and used for genotyping are listed in Table 2. The LOX primers were modified by the addition of an M13 tail (CACGACGTTGTAAAACGAC) to the 50 end of the forward primer labeled with two different fluorescent dyes, IRD 700 and IRD 800 (Maccaferri et al., 2008). The reverse primers were unlabeled. The amplified products were size separated by 8% polyacrylamide gel electrophoresis in 1 TBE (Tris-borate-EDTA) buffer under the conditions of 1500 V and 40 mA in a LiCor 4300s DNA Analyzer. Image processing to evaluate the fragments was performed using SAGA software (LiCOR Biosciences, Lincoln, NE, USA). 2.3. RGA analysis Eight RGA markers were analyzed in this study (Dong et al., 2009) are listed in Table 2. PCR was carried out in a 20 mL reaction volume containing 30 ng/mL genomic DNA, 1 unit of Taq DNA polymerase (Thermo Sci. Co.), 20 mM MgSO4, 10 mM of
Code number (#)
Name of the variety
Location
Code number (#)
Name of the variety
Location
Code number (#)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22
Surmeli barbunya Alacali barbunya Seker barbun Alacali Ayse Ege barbunya Elindar Yerli barbunya Ayse kadin Kula barbunya Ak Melka Boncuk Sarikiz fasulye Ayse kadin Sari seker Kaynarca Kuru fasulye Beyon Horoz Manda Fasulye Boncuk Ayse Hatay Oturak
Golcuk/Turkey Bozdag/Turkey Golcuk/Turkey Golcuk/Turkey Golcuk/Turkey Golcuk/Turkey Bozdag/Turkey Golcuk/Turkey Bozdag/Turkey Kirklareli/Turkey Kirklareli/Turkey Bandirma/Turkey Bandirma/Turkey Bandirma/Turkey Bandirma/Turkey Bandirma/Turkey Golcuk/Turkey Golcuk/Turkey Kirklareli/Turkey Kirklareli/Turkey Bandirma/Turkey Bandirma/Turkey
23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44
Gino Sarikiz Yalova 5 Yalova 17 Gino 10 Dilme sarikiz Taze Gunluk Piyazlik Horan Mora Ispir Arba Taze fasulye Alman ayse Alman sarikiz Meksika fasulyesi Kuru fasulye 13 Volare Mergseed Volare Mergseed
Bandirma/Turkey 45 Kirklareli/Turkey 46 Yalova5/Turkey 47 Yalova17/Turkey 48 Gino/Turkey 49 Sarikiz/Turkey 50 Selcuk/Turkey 51 Tokat/Turkey 52 Tire/Turkey 53 Antalya/Turkey 54 Tekirdag/Turkey 55 Karadeniz/Turkey 56 Isparta/Turkey 57 Isparta/Turkey 58 Karadeniz/Turkey 59 Turkey 60 Sarikiz/Turkey 61 Turkey 62 Turkey 63 Turkey 64 Turkey 65 Bulgaria 66
Name of the variety
Location
Code number (#)
Name of the variety
Location
Helda Emergo155 Purple teepe 141 Sarıkız Roma 2 Roma 2 Admires 3060 Dolic hos Flora Lima Maxi Cobra Algarve Magnum Alman ays¸e 5 Limka no:209 Maxi bell Provider E-Z Pick Fortex Kolti
Turkey Germany Germany Turkey Turkey Turkey Netherlands India India USA England England England Turkey Bursa/Turkey Netherlands Netherlands USA USA USA USA Turkey
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86
Naham Mergseed 2 Boncuk ays¸e Pearl 3010 Algarve 41.520 Dolic hos Ays¸e kadın Güz fasulye Ays¸e kadın Yerli 1 Blue Lake 274 Primol Baroma Isabel Solista Akdag 1085 Yerli 25 GITA Green jumbo
Turkey Bulgaria Turkey Netherlands Germany India Trabzon/Turkey Trabzon/Turkey Trabzon/Turkey Bursa/Turkey USA England England England England Samsun/Turkey Samsun/Turkey Ankara/Turkey USA USA
S. Nemli et al. / Biochemical Systematics and Ecology 59 (2015) 107e115
Table 1 A list of the 86 P. vulgaris genotypes and locations.
109
110
Table 2 Primer sequences for LOX and RGA marker were used to genetic diversity analysis in this study. Primer forward (50 -30 ) M13 Labeled
Primer reverse
RGA primer name
Primer forward
Primer reverse
LOX01 LOX02 LOX03 LOX04 LOX05 LOX06 LOX07 LOX08 LOX09 LOX10 LOX11 LOX12 LOX13 LOX14 LOX15 LOX16 LOX17 LOX18 LOX19 LOX20 LOX21 LOX22 LOX23 actin
CACGACGTTGTAAAACGACTGAGCGTGCTTCATCCAATCC CACGACGTTGTAAAACGACCATGAAGGGCTGAAGATACCC CACGACGTTGTAAAACGACTGGTGGAAAGAGGTTAGA CACGACGTTGTAAAACGACATTTGCTATGGAGTTGTCTTC CACGACGTTGTAAAACGACACACCCTCAACATAACAA CACGACGTTGTAAAACGACAACCAAATCTCAAGTCCATCA CACGACGTTGTAAAACGACCGTATCAACGCAAATGCT CACGACGTTGTAAAACGACGCTGATGGGATTATTGAAAC CACGACGTTGTAAAACGACGAGCCATTCATCATTGGAACA CACGACGTTGTAAAACGACTCATTCCGTACTGCTTCATCG CACGACGTTGTAAAACGACGAAATCGAGATCCCAACC CACGACGTTGTAAAACGACCGTAAGAACCTCATCAATGCCA CACGACGTTGTAAAACGACCCACCAAGCTTGTAGCTCTG CACGACGTTGTAAAACGACGCTTGCAGCTCTTTATCATTAG CACGACGTTGTAAAACGACTCAAGAACATCACGACCGTAGT CACGACGTTGTAAAACGACGGCGAAAGGGTAGTCTTCTATG CACGACGTTGTAAAACGACAAGCCTTTCACCGACTTTAC CACGACGTTGTAAAACGACACAACATTTGGGTTGGGATAG CACGACGTTGTAAAACGACAGGGTAGTCTTCAATAGCAAGC CACGACGTTGTAAAACGACTGCTGGTCTTAACCCATACAG CACGACGTTGTAAAACGACGAATTTAAGTTCCGCTTTCAG CACGACGTTGTAAAACGACACGCCACAAGCAACTGGACAT CACGACGTTGTAAAACGACTGCCTCCAACACCTTCTTCAA CACGACGTTGTAAAACGACTCGTGCTGGATTCTGGTG
CATGTTTCTTGTCAGCGTGGC GTCCTTGTTAATGGTGATGGTC TATGCCTACGACTTATTG CATGCTTCATGTTTCTTGTCA CTCAATAATGCCATCAAC CTTCATCCAATTCACAAGCTG ATTGGCGAAAGGGTAGTC TCACTCATTGGACGAGTTGA CATCGACTGCGTAAGGGTAAT GCTGCTCCATCCTCACTTTCG TCTTCCCGTATGAGTGTC GCTTGCAGCTCTTTATCATTTG CTCGTAAGAACCTTATCAATGCT GTGGCATCATTGAAGGAACAT CAAATAGGCAATTGAGTACGG AACTCGTTGTTCACTGGCTTAG GCTGATTCTTGAGGACCATA GCGTGGAACCTTATGTGATTG CTTACATCATTGCAGCAAACAG CCTAAGTGTTCCATCCTCGTT CCATCAATAGGTGGTCGTGTC TTTGTAAGCTGCGGCACTGAT CTTCCATATCAAATCGCCACA GGCAGTGGTGGTGAACAT
RGA-RLRR RGA-XLRR-INV1 RGA-Pto kin3 RGA-XLRR RGA-NLRR RGA-Cre3Ploop RGA-NLRR-INV1 RGA-Pto-kin1 IN1
CGCAACCACTAGAGTAAC TTGTCAGGCCAGATACCC TACTTCGGACGTTTACAT CCGTTGGACAGGAAGGAG TAGGGCCTCTTGCATCGT GCGGGTCTGGGAAATCTACC TGCTACGTTCTCCGGG AAGTGGAACAAGGTTAGG
ACACTGGTCCATGAGGTT GAGGAAGGACAGGTTGCC AGTGTCTTGTAGGGTATC CCCATAGACCGGACTGTT TATAAAAAGTGCCGGACT CTGCAGTAAGCAAAGCAACG TCAGGCCGTGAAAAATAT GATGCACCACCAGGGGG
S. Nemli et al. / Biochemical Systematics and Ecology 59 (2015) 107e115
LOX primer name
S. Nemli et al. / Biochemical Systematics and Ecology 59 (2015) 107e115
111
Table 3 Characteristics of the LOX and RGA profiles used for genotyping of common bean accessions. No
LOX primer pair name
PIC
Number of polymorphic bands
No
LOX primer pair name
PIC
Number of polymorphic bands
No
RGA primer name
PIC
Number of polymorphic bands
1 2 3 4 5 6 7 8 9 10 11
LOX1 LOX2 LOX3 LOX4 LOX5 LOX6 LOX7 LOX9 LOX10 LOX11 LOX12
0.2 0.5 0.1 0.1 0.3 0.3 0.3 0.1 0.3 0.1 0.3
41 2 7 4 5 8 4 6 6 2 5
12 13 14 15 16 17 18 19 20 21 22
LOX13 LOX14 LOX15 LOX16 LOX17 LOX18 LOX19 LOX20 LOX21 LOX23 actin Average
0.1 0.1 0.5 0.3 0.1 0.4 0.2 0.2 0.1 0.3 0.3 0.23
3 5 7 5 22 18 15 15 3 7 3 Total 193
1 2 3 4 5 6
RLRR XLRR-INV1 XLRR NLRR Cre3Ploop Pto-kin1 IN1 Average
0.2 0.5 0.4 0.3 0.7 0.5 0.43
2 3 3 4 1 4 Total 17
each dNTP (Thermo Sci. Co), 10 pmol of each primer pair (forward and reverse), 10 PCR buffer (200 mM TriseHCl, pH 8.3, 100 mM KCl, 100 mM (NH4)2SO4, 1% Triton X-100, 1 g/ml BSA). A Peltier thermal cycler (DNA Engine DYAD™ Bio-Rad, Hercules, CA, USA) was programmed as follows: an initial denaturation step of 3 min at 94 C, 40 cycles of denaturation for 30 s at 94 C, annealing for 40 s at 45e65 C (depending on the nucleotide content of the primers), extension for 30 s at 72 C and a final extension for 5 min at 72 C. The thermal cycler was programmed to hold the product at 4 C. After amplification, the reaction products and a 100 bp DNA ladder (Thermo Sci. Co.) were separated by electrophoresis in 2% agarose gels in 1 TBE buffer for approximately 3 h at 120 V. The gels were photographed using a G-box SYNGENE gel documentation system. 2.4. Statistical analysis and population structure Only reproducible and clearly amplified bands were scored for the construction of the data matrix. The robust polymorphic bands were scored as present (1) or absent (0) for each primer, as described for conserved gene-based markers (Collard and Mackill, 2009; Xiong et al., 2013). The genetic similarity was determined between accessions using the software NTSYS-pc (Numerical Taxonomy and Multiware Analysis System, version 2.0) according to Jaccard's similarity matrix (Rohlf, 1988). The polymorphism information content (PIC) for each LOX and RGA marker was calculated (Anderson et al., 1993) P using the equation PIC ¼ 1 pi 2 , where pi is the proportion of the population with the i-th.
Fig. 1. LOX profiles of 48 common bean accessions obtained with the primer pair LOX1.
112
S. Nemli et al. / Biochemical Systematics and Ecology 59 (2015) 107e115
Fig. 2. RGA profiles of 68 common bean accessions obtained with the primer pair XLRR INV1.
Model-based cluster analysis was performed to infer the genetic structure of three datasets (LOX data, RGA data, both LOX and RGA data) using STRUCTURE version 2.2 (Pritchard et al., 2000a, 2000b). In this model, a number of populations (K) is assumed to be present, each of which is characterized by a set of distinctive allele frequencies at each locus, and individuals are placed into K clusters. The program was run ten times for each value of populations K varying from 2 to 10; for except K ¼ 1, where only one run was performed. The posterior probabilities were estimated using the Markov Chain Monte Carlo (MCMC) method. The MCMC chains were run with a 100,000-iteration burn-in period, followed by 100,000 iterations using a model allowing for admixture and correlated allele frequencies. The most likely value for K was estimated using Evanno's DK method (Evanno et al., 2005) using STRUCTURE HARVESTER (Earl and VonHoldt, 2011). 3. Results and discussion A total of 24 and 8 pairs of primers amplified fragments from the LOX and RGA regions in 86 common bean accessions, respectively. A total of 28 primers generated polymorphisms, with 22 polymorphisms for LOX and 6 for RGA. The primers for LOX-8, LOX-22, RGA Pto kin3 and RGA NLRR-INV1 detected no polymorphism therefore, these primers were excluded from the analysis. The total number of polymorphic bands was 193 for LOX and 17 for RGA (Table 3). A representative gel for the LOX-1 primer pair is presented in Fig. 1, and a gel showing XLRR INV1 is presented in Fig. 2. Naik et al. (2006) used the same
Fig. 3. Bar graph generated using STRUCTURE 2.2 software showing relationships among common bean accessions using LOX and RGA markers data. Each population is represented by a different color. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
S. Nemli et al. / Biochemical Systematics and Ecology 59 (2015) 107e115
113
RGA primer pairs, including XLRR-INV1, Pto kin3, and XLRR, and they detected 8 polymorphic loci using 5 RGA primer pairs in apple. The copy number of the same region in the common bean is more than that in apple. This situation also demonstrated that the RGA copy number varied from species to species. And they reported that RGA markers could also help to characterize the genetic structure and geographic distribution in crops, including rice, wheat, barley, and banana (Ren et al., 2013). The ability of RGA primers to detect variation in the common bean has also been demonstrated previously. For example, Hanai et al. (2010) analyzed common bean RIL population using 4 RGA primer pairs for mapping based on the NBS-profiling method and scored a total of 32 polymorphic bands. For common bean accessions, analysis of LOX and RGA gene-based markers with 24 primer combinations identified a total of 210 scorable bands as a multiple banding pattern. This may be explained by the presence of short, conserved DNA regions at multi-copy sites within the common bean genome (Nemli et al., 2014). Similarly, Salvia miltiorrhiza (Wang et al., 2009), apple (Gulsen et al., 2010), and common bean (Nemli et al., 2014) obtained multiple bands in their studies using primers design based on conserved DNA sequences such as CoRAP, Target Region Amplification Polymorphism (TRAP) and POX. Wang et al. (2009) detected a total of 20 polymorphic bands using four CoRAP primer combinations, and each primer pair produced an average of 3.3 polymorphic bands in miltiorrhiza (Wang et al., 2009). In this study, the number of alleles per polymorphic locus varied from 2 to 41 with an average of 8.7 for LOX gene-based analysis. The largest number of different alleles was detected with the primers for LOX-1 (41), whereas the smallest number (2) was found with primers for LOX-2 and LOX-11. For the RGA gene-based markers, the number of alleles per polymorphic locus varied from 1 to 4, with an average allele number of 2.8. The primers that detected the highest numbers of polymorphisms were Pto kin1 IN1 and NLRR (4 bands) for RGA. Mutlu et al. (2008) reported that the average number of fragments per primer was 1.5 for RGA in eggplant. The mean number of alleles obtained with all primers (LOX and RGA) was 7.5 (Table 3). Similarly, Jayashree et al. (2010) detected 458 polymorphic bands, with a mean of 16 bands using 29 RGA primers among 40 sugarcane cultivars. This high level of polymorphism is expected for sugarcane due to its genome size, which is approximately et al., 2005). 20 times larger than that of the common bean (Edme The polymorphism information content varied from 0.1 (LOX-3, 4, 9, 11, 13, 14, 17, and 21) to 0.7 (RGA marker Cre3Ploop), with an average of 0.3 which was lower than the values found in previous common bean studies (Nemli et al., 2014) (Table 3). Cre3Ploop was the best marker for discriminating between genotypes due to its higher PIC values. Nemli et al. (2014) found that the mean PIC value for POX products was 0.40 among common bean accessions (Nemli et al., 2014). LOX gene-based markers (0.23) had lower allelic richness than RGA gene-based markers (0.43) regardless of the marker size analyzed. The ability of the markers to distinguish among common bean genotypes (PIC) was similarly variable, which is consistent with previous studies (Benchimol et al., 2007). The genetic similarity between the accessions based on the LOX and RGA markers ranged from 0.12 to 0.55 with a mean value of 0.34. These results revealed a low degree of genetic diversity at the LOX and RGA level. The similarity value (0.55) demonstrated that the two most closely related accessions were #8 (Ayse kadin-Golcuk/Turkey) and #10 (Ak-Kirklareli/ Turkey). These results are in accordance with Nemli et al. (2014) who analyzed the same genotypes as those analyzed here. The authors found similarity coefficients ranging between 0.7 and 1. The lowest values of genetic similarity (0.12) were observed for comparisons between accession #9 (Kula barbunya-Bozdag/Turkey) and accession #42 (Mergseed-Turkey), indicating that these cultivars were highly distinct from each other. In this study, the population structure of 86 common bean accessions was characterized with the software STRUCTURE version 2.2 according to data for LOX and RGA (Fig. 3). The results implied that it was the most reasonable to divide the 86 common bean accessions into 3 populations designated as POP1, POP2, and POP3 and each population contained 22e35 common bean accessions. Population 1 consisted of 22 accessions [15 from Turkey (Golcuk, Bozdag, Bandirma, Tokat, Kirklareli, Bursa) and 7 from different countries (Netherlands, England, Bulgaria, Germany, USA)]. Population 2 contained 29 accessions almost all of which (93%) were accessions from Turkey; only 2 were from different countries (#57; England and #62; USA). Population 3 comprised the majority of the groups including cultivar accessions of various origins (17 from Turkey and 18 from different countries). Similarly, Ceylan et al. (2014) identified 3 populations among the common bean genotypes using STRUCTURE with 3 different marker systems (SRAP, POGP and cpSSR). Nemli et al. (2014) determined the population structure among 67 common bean accessions and detected 5 groups of populations with 80 POX gene-based markers. On the other hand, the present study revealed that the genetic materials used in the current study could be divided into 9 groups using 193 LOX markers and into 6 groups using 17 RGAs. This result may suggest that analyzing the LOX and RGA markers separately provides better resolution for discriminating the populations (Nemli et al., 2014). According to the amplification results, it was observed that the LOX markers are more polymorphic compared with the RGA markers.
References Anderson, J.A., Churchill, G.A., Autrique, J.E., Tanksley, S.D., Sorrells, M.E., 1993. Optimizing parental selection for genetic-linkage maps. Genome 36, 181e186. Arumuganthan, K., Earle, E., 1991. Nuclear DNA content of some important plant species. Plant Mol. Biol. Rep. 9, 208e218. ^a, L.R.L., Souza, A.P., 2007. Structure of genetic diversity Benchimol, L.L., Campos, T., Carbonell, S.A.M., Colombo, C., Chioratto, A.F., Formighieri, E.F., Gouve among common bean (Phaseolus vulgaris L.) varieties of Mesoamerican and Andean origins using new developed microsatellite markers. Genet. Resour. Crop Evol. 54, 1747e1762. Brash, A.R., 1999. Lipoxygenases: occurrence, functions, catalysis, and acquisition of substrate. J. Biol. Chem. 274, 23679e23682. andez, G., Blair, M., Beebe, S., Gepts, P., Vanderleyden, J., 2003. Beans (Phaseolus spp.) e model food legumes. Plant Soil 55e128. Broughton, W.J., Hern
114
S. Nemli et al. / Biochemical Systematics and Ecology 59 (2015) 107e115
€ Ceylan, A., Ocal, N., Akbulut, M., 2014. Genetic diversity among the Turkish common bean cultivars (Phaseolus vulgaris L.) as assessed by SRAP, POGP and cpSSR markers. Biochem. Syst. Ecol. 54, 129e229. Chen, R.G., Li, H.X., Zhang, L.Y., Zhang, J.H., Xiao, J.H., Ye, Z.B., 2007. CaMi, a root-knot nematode resistance gene from hot pepper (Capsium annuum L.) confers nematode resistance in tomato. Plant Cell. Rep. 26, 895e905. Chen, X.M., Line, R.F., Leung, H., 1998. Genome scanning for resistance-gene analogs in rice, barley, and wheat by high-resolution electrophoresis. Theor. Appl. Genet. 97, 345e355. Collard, B.C.Y., Mackill, D.J., 2009. Conserved DNA-derived polymorphism (CDDP): a simple and novel method for generating DNA markers in plants. Plant Mol. Biol. Report. 27, 558e562. Dangl, J.L., Jones, J.D.G., 2001. Plant pathogens and integrated defence responses to infection. Nature 411, 826e833. De La Fuente, G.N., Murray, S.C., Isakeit, T., Park, Y.S., Yan, Y., Warburton, M.L., Kolomiets, M.V., 2013. Characterization of genetic diversity and linkage disequilibrium of ZmLOX4 and ZmLOX5 loci in maize. Plos One 8 (1), e53973. http://dx.doi.org/10.1371/journal.pone.0053973. Dong, P., Wei, Y.M., Chen, G.Y., Li, W., Nevo, E., Zheng, Y.L., 2009. Resistance gene analog polymorphisms (RGAPs) in wild emmer wheat (Triticum dicoccoides) and their ecological associations. Genet. Resour. Crop Evol. 56, 121e136. Earl, D., VonHoldt, B., 2011. STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 4, 359e361. , S.J., Comstock, J.C., Miller, J.D., Tai, P.Y.P., 2005. Determination of DNA content and genome size in sugarcane. J. Am. Soc. Sugarcane Tech. 25, 1e16. Edme Eiben, H.G., Slusarenko, A.J., 1994. Complex spatial and temporal expression of lipoxygenase genes during Phaseolus vulgaris (L.) development. Plant J 5, 123e135. Evanno, G., Regnaut, S., Goudet, J., 2005. Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol. Ecol. 14, 2611e2620. FAO, 2010. Food and Agriculture Organization of the United Nations. Feussner, I., Wasternack, C., 2002. The lipoxygenase pathway. Annu. Rev. Plant Biol. 53, 275e297. Geerts, A., Feltkamp, D., Rosahl, S., 1994. Expression of lipoxygenase in wounded tubers of Solanum tuberosum L. Plant Physiol. 105, 269e277. Gepts, P., FL, A., deBarros, E., Blair, M., Brondani, R., Broughton, W., Galasso, I., Hernandez, G., Kami, J., Lariguet, P., et al., 2008. Genomics of Phaseolus beans, a major source of dietary protein and micronutrients in the tropics. In: Genomics of Tropical Crop Plants. Springer, Philadelphia. Gepts, P., Kmiecik, K., Pereira, P., Bliss, F.A., 1988. Dissemination pathways of common bean (Phaseolus vulgaris, Fabaceae) deduced from phaseolin electrophoretic variability. Am. Econ. Bot. 42, 73e85. Grant, M.R., Godiard, L., Straube, E., Ashfield, T., Lewald, J., Sattler, A., Innes, R.W., Dangl, J.L., 1995. Structure of the Arabidopsis Rpm1 gene enabling dualspecificity disease resistance. Science 269, 843e846. Gulsen, O., Kaymak, S., Ozongun, S., Uzun, A., 2010. Genetic analysis of Turkish apple germplasm using peroxidase gene-based markers. Sci. Hortic. 125, 368e373. Hanai, L.R., Santini, L., Camargo, L.E.A., Fungaro, M.H.P., Gepts, P., Tsai, S.M., Vieira, M.L.C., 2010. Extension of the core map of common bean with EST-SSR, RGA, AFLP, and putative functional markers. Mol. Breed. 25, 25e45. Heitz, T., Bergey, D.R., Ryan, C.A., 1997. A gene encoding a chloroplast-targeted lipoxygenase in tomato leaves is transiently induced by wounding, systemin, and methyl jasmonate. Plant Physiol. 114, 1085e1093. Hessler, T.G., Thomson, M.J., Benscher, D., Nachit, M.M., Sorrells, M.E., 2002. Association of a lipoxygenase locus, Lpx-B1, with variation in lipoxygenase activity in durum wheat seeds. Crop Sci. 42, 1695e1700. Jayashree, J., Selvi, A., Nair, N.V., 2010. Characterization of resistance gene analog polymorphisms in sugarcane cultivars with varying levels of red rot resistance. Electron. J. Plant Breed. 1, 1191e1199. Kanazin, V., Marek, L.F., Shoemaker, R.C., 1996. Resistance gene analogs are conserved and clustered in soybean. Proc. Natl. Acad. Sci. U. S. A. 93, 11746e11750. Kwak, M., Gepts, P., 2009. Structure of genetic diversity in the two major gene pools of common bean (Phaseolus vulgaris L., Fabaceae). Theor. Appl. Genet. 118, 979e992. Liavonchanka, A., Feussner, N., 2006. Lipoxygenases: occurrence, functions and catalysis. J. Plant Physiol. 163, 348e357. Liu, S.Q., Liu, X.H., Jiang, L.W., 2011. Genome-wide identification, phylogeny and expression analysis of the lipoxygenase gene family in cucumber. Genet. Mol. Res. 10, 2613e2636. Loiseau, J., Vu, B.L., Macherel, M.H., Le Deunff, Y., 2001. Seed lipoxygenases: occurrence and functions. Seed Sci. Res. 11, 199e211. Maccaferri, M., Sanguineti, M.C., Corneti, S., Ortega, J.L.A., Ben Salem, M., Bort, J., DeAmbrogio, E., del Moral, L.F.G., Demontis, A., et al., 2008. Quantitative trait loci for grain yield and adaptation of durum wheat (Triticum durum Desf.) across a wide range of water availability. Genetics 178, 489e511. Maleki, L., Faris, J.D., Bowden, R.L., Gill, B.S., Fellers, J.P., 2003. Physical and genetic mapping of wheat kinase analogs and NBS-LRR resistance gene analogs. Crop Sci. 43, 660e670. Matsui, K., Minami, A., Hornung, E., Shibata, H., Kishimoto, K., Ahnert, V., Kindl, H., Kajiwara, T., Feussner, I., 2006. Biosynthesis of fatty acid derived aldehydes is induced upon mechanical wounding and its products show fungicidal activities in cucumber. Phytochem 67, 649e657. Meier, B., Shaw, N., Slusarenko, A.J., 1993. Spatial and temporal accumulation of defense gene transcripts in bean (Phaseolus vulgaris) leaves in relation to bacteria-induced hypersensitive cell death. Mol. Plant Microbe Interact 6, 453e466. Mutlu, N., Boyaci, F.H., Gocmen, M., Abak, K., 2008. Development of SRAP, SRAP-RGA, RAPD and SCAR markers linked with a Fusarium wilt resistance gene in eggplant. Theor. Appl. Genet. 117, 1303e1312. Mutlu, N., Miklas, P.N., Coyne, D.P., 2006. Resistance gene analog polymorphism (RGAP) markers co-localize with disease resistance genes and QTL in common bean. Mol. Breed 17, 127e135. Naik, S., Hampson, C., Gasic, K., Bakkeren, G., Korban, S.S., 2006. Development and linkage mapping of E-STS and RGA markers for functional gene homologues in apple. Genome 49, 959e968. Nemli, S., Kaya, H.B., T, B., 2014. Genetic assessment of common bean (Phaseolus vulgaris L.) accessions by peroxidase gene-based markers. J. Sci. Food Agric. 94, 1672e1680. Porta, H., Rueda-Benitez, P., Campos, F., Colmenero-Flores, J.M., Colorado, J.M., Carmona, M.J., Covarrubias, A.A., Rocha-Sosa, M., 1999. Analysis of lipoxygenase mRNA accumulation in the common bean (Phaseolus vulgaris L.) during development and under stress conditions. Plant Cell Physiol. 40, 850e858. Prigge, S., Boyington, J., Gaffney, B., Amzel, M., 1996. Lipoxygenases: Structure and Function. AOCS Press, Champaign, IL. Pritchard, J., Stephens, M., Donnelly, P., 2000a. Inference of population structure using multilocus genotype data. Genetics 155, 945e959. Pritchard, J., Stephens, M., Rosenberg, N., Donnelly, P., 2000b. Association mapping in structured populations. Am. J. Hum. Genet. 67, 170e181. Ren, J.S., Yu, Y.C., Gao, F.Y., Zeng, L.H., Lu, X.J., Wu, X.T., Yan, W.G., Ren, G.J., 2013. Application of resistance gene analog markers to analyses of genetic structure and diversity in rice. Genome 56, 377e387. Rohlf, F., 1988. NTSYS-pc Numerical Taxonomy and Multivariate Analysis System (New York). Selvaraj, C.I., Babu, S., Sankar, P.D., Nagarajan, P., Sabesan, M., 2011. Genome scanning for identification of resistance gene analogs (RGAs) in a highly durable blast resistance rice (Oryza sativa L.) cultivar, Moroberekan. Afr. J. Biotechnol. 10, 6418e6433. Siedow, J.N., 1991. Plant lipoxygenase e structure and function. Ann. Rev. Plant Physiol. Plant Mol. Biol. 42, 145e188. Singh, S.P., 2000. Broadening the genetic base of common bean cultivars: a review. Crop Sci. 41, 1659e1675. Wang, Q.H., Zhang, B.L., Lu, Q.S., 2009. Conserved region amplification polymorphism (CoRAP), a novel marker technique for plant genotyping in Salvia miltiorrhiza. Plant Mol. Biol. Rep. 27, 139e143.
S. Nemli et al. / Biochemical Systematics and Ecology 59 (2015) 107e115
115
Xiong, F.Q., Liu, J.X., Zhong, R.C., Jiang, J., Han, Z.Q., He, L.Q., Li, Z., Tang, X.M., Tang, R.H., 2013. Intron targeted amplified polymorphism (ITAP), a new sequence related amplified polymorphism-based technique for generating molecular markers in higher plant species. Plant Omics 6, 128e134. Zhang, L.P., Khan, A., Nino-Liu, D., Foolad, M.R., 2002. A molecular linkage map of tomato displaying chromosomal locations of resistance gene analogs based on a Lycopersicon esculentum x Lycopersicon hirsutum cross. Genome 45, 133e146.