- Email: [email protected]
Detonation nanodiamond toxicity in human airway epithelial cells is modulated by air oxidation
Diamond & Related Materials 58 (2015) 16–23
Contents lists available at ScienceDirect
Diamond & Related Materials journal homepage: www.elsevier.com/locate/diamond
Detonation nanodiamond toxicity in human airway epithelial cells is modulated by air oxidation☆ Robert Silbajoris a, William Linak b, Olga Shenderova c, Christopher Winterrowd d, Huan-Cheng Chang e, Jay L. Zweier f, Anirudh Kota g, Lisa A. Dailey a, Nicholas Nunn c, Philip A. Bromberg h, James M. Samet a,⁎ a
Environmental Public Health Division, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC, United States Air Pollution Prevention and Control Division, National Risk Management Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC, United States Adámas Nanotechnologies, Inc., Research Triangle Park, NC, United States d ARCADIS U.S., Durham, NC, United States e Institute of Atomic and Molecular Sciences, Academia Sinica, Taipei, Taiwan f The Dorothy M. Davis Heart and Lung Research Institute, and the Division of Cardiovascular Medicine, Department of Internal Medicine, College of Medicine, The Ohio State University Medical Center, Columbus, OH, United States g Department of Chemical Engineering, North Carolina State University, Raleigh, NC, United States h Center for Environmental Medicine, Asthma and Lung Biology, University of North Carolina at Chapel Hill, Chapel Hill, NC, United States b c
a r t i c l e
i n f o
Article history: Received 7 April 2015 Received in revised form 12 May 2015 Accepted 20 May 2015 Available online 22 May 2015 Keywords: Nanodiamond Toxicity Human airway epithelial cells Interleukin-8 Zeta potential
a b s t r a c t Detonation nanodiamonds (DNDs), a nanomaterial with an increasing range of industrial and biomedical applications, have previously been shown to induce a pro-inflammatory response in cultured human airway epithelial cells (HAECs). We now show that surface modifications induced by air oxidation of DND (AO-DND), including an increase in oxygen content, formation of carboxylic groups associated with the appearance of high negative zeta potential and a decrease in unpaired electron content, are accompanied by a significant loss of bioactivity, as measured by levels of interleukin-8 mRNA in HAEC. These findings are relevant to the identification of chemical determinants and molecular mechanisms of the inhalational toxicity of carbonaceous nanomaterials. Published by Elsevier B.V.
1. Introduction Like its graphitic polymorph, diamond is a crystalline form of carbon. However, while the sp2 C_C bonds in graphite lead to a planar arrangement, the sp3 C–C bonds in diamond form the tetrahedral structure that gives diamond its unique physicochemical properties, including electrical insulation, exceptional hardness and optical transparency. In recent years, nano-scale diamond particles have been the subject of considerable interest due to their expanding range of applications in industrial, research and biomedical settings [1]. Confined detonation of explosives in a metallic chamber is an efficient, environmentally friendly and cost-effective method to synthesize ☆ Disclaimer: The research described in this article has been reviewed by the National Health and Environmental Effects Research Laboratory, U.S. EPA, and approved for publication. The contents of this article should not be construed to represent Agency policy nor does mention of trade names or commercial products constitute endorsement or recommendation for use.The authors declare that they have no actual or potential competing financial interests. ⁎ Corresponding author at: EPA Human Studies Facility, 104 Mason Farm Rd, Chapel Hill, NC 27599-7315, United States. E-mail address: [email protected] (J.M. Samet).
nanodiamonds, termed detonation nanodiamonds (DNDs). A major limitation of DND is that the surface of the particles is typically contaminated with graphitic (sp2 hybridized) carbon and non-combustible metallic impurities, which adversely alter the desirable mechanical and optical properties of these nanomaterials. A variety of methods have been developed to remove surface contaminants from DND postsynthesis, including treatment with strong acids or oxidizers such as HClO4 or ozone, each incurring significant economic and environmental drawbacks [2–4]. Osswald and colleagues demonstrated that heating DND in air at elevated temperatures is a simpler approach to oxidizing surface non-diamond carbon that results in raising the sp3 content of DND by increasing the concentration of oxygen-containing moieties [5]. As is the case with other commercially produced nanomaterials, the safety of nanodiamonds has not been adequately evaluated [6]. Studies have shown that intratracheally instilled nanodiamonds have low pulmonary toxicity in mice [7]. A separate investigation of neuroblastoma cells, keratinocytes and macrophages exposed to untreated as well as acid- or alkali-functionalized nanodiamond particles reported no effects on multiple markers of cytotoxicity [8]. On the other hand, there is increasing evidence that the state of oxidation of nanodiamonds can influence their toxicity. Xing et al. reported DNA damage in embryonic stem
R. Silbajoris et al. / Diamond & Related Materials 58 (2015) 16–23
cells exposed to oxidized nanodiamond particles [9], while Wehling and colleagues found bactericidal activity in nanodiamonds annealed in air [10]. Moreover, in a previous study [11], we showed that in vitro exposure to a commercial DND preparation induces a marked increase in the expression of the potent inflammatory chemokine interleukin-8 (IL-8) in cultured primary human airway epithelial cells (HAECs). We further showed that the mechanism involved in DND-induced IL-8 expression is dependent on the production of intracellular H2O2, suggesting that DND exposure presents an oxidative stress to HAEC. In order to gain insight into chemical factors that act as determinants of the toxicity of carbonaceous nanoparticles, in the present study we have investigated the relationship between the surface chemistry of DND and its bioactivity. We have used specific conditions for thermal desorption based on the method described by Osswald et al. [5] to modify the chemical composition of DND nanoparticle preparations and measured the effect that these modifications have on the bioactivity of the particles, using IL-8 mRNA expression by HAEC as a readout of inflammogenic potential. We report that changing the surface content of oxygen-containing functional groups by air oxidation reduces the inflammogenicity of DND nanoparticles.
17
from Corning (Corning, NY, USA). Purified bovine collagen was obtained from Advanced Biomatrix (San Diego, CA, USA). Nanodiamond particles were purchased from Nanodiamond.com (Massagno, Switzerland). 2.2. Cell culture Primary normal human airway epithelial cells (HAECs) were obtained from adult human volunteers by brush biopsy of the mainstem bronchi using a cytology brush during fiber optic bronchoscopy, conducted under a protocol approved by the Committee on the Protection of the Rights of Human Subjects at the University of North Carolina at Chapel Hill. HAECswere initially plated in bronchial epithelial cell basal medium (BEBM) supplemented with 52 mg/ml bovine pituitary extract, 5 mg/ml insulin, 0.5 mg/ml hydrocortisone, 0.1 ng/ml retinoic acid, 10 mg/ml transferrin, 6.5 ng/ml triiodothyronine, 0.5 mg/ml epinephrine, 0.5 ng/ml human epidermal growth factor, 50 mg/ml gentamycin and 50 ng/ml amphotericin-B (BEGM) on tissue culture plates coated with bovine collagen, grown to confluence at 37 °C/5% CO2 and then passaged two or three times in BEGM on ordinary tissue culture plates. 2.3. Nanodiamond particle synthesis, thermal treatment and HAEC exposures
2. Materials and methods 2.1. Reagents Tissue culture media and supplements were obtained from Lonza (Walkersville, MD, USA). Costar tissue culture plates were purchased
According to the manufacturer (www.nanodiamond.com), nanodiamond particles were produced by detonation of carboncontaining explosives. The resulting diamond-graphite powder is
ND
12000
DND DND 450o C, 2h DND 425o C, 5h DND 400o C, 5h DND 375o C, 5h
Raman signal intensity (a.u.)
10000
8000
6000
4000
2000
0 1000
1200
1400
1600
Wavenumber (cm-1) Fig. 1. Raman spectra of the starting DND and DNDs heated in air for 2–5 h at temperatures ranging from 375 to 450 °C. The spectrum of the reference ND sample with particle size of 100 nm is also included for comparison.
18
R. Silbajoris et al. / Diamond & Related Materials 58 (2015) 16–23
purified with an oxidizing mixture of sulfuric and nitric acid at 230– 305 °C. The final powder is stated to be up to 99.5% by weight pure diamond with an average individual particle diameter of 5 nm. The particles are rounded in shape and are stated to have a surface area of ~ 300 m2/g. During synthesis and purification, the primary particles form tightly bound aggregates with sizes exceeding 100 nm in diameter. A horizontal bench-scale reactor was used to thermally process nanodiamond powder samples. The reactor was composed of a 4 cm (ID) by 71 cm long borosilicate glass tube nested inside a 46 cm long electric furnace (Thermcraft, Winston-Salem, NC, USA). Socket joints
A
at each end of the tube allowed attachment of ball end caps. Glass nipples on the ball end caps and tube ends provided access for thermocouples (type E; Omega, Stamford, CT, USA) and attachment of ultra-high purity air and nitrogen gas cylinders. Gas flow was maintained at 500 cm3/min during all phases of heating and cooling. Nanodiamond samples (~50 mg) were placed in disposable aluminum pans and placed into the pre-heated reactor. DND samples were heated in the furnace under air or N2 flow at 425 °C for 5–300 min and then gradually cooled under air or N2 flow to room temperature. In some experiments, samples were pre-heated at 150 °C for 15 min and then moved inside the furnace. Samples were allowed to cool at 50 °C for 10 min. When
24
lL-8 mRNA Fold Increase Over Media Control (corrected for GAPDH mRNA)
22 20 18 16 14 12 10 8 6 4 2
0 375oC
DND
IL-8 mRNA Fold Increase Over Media Control (% heated/unheated DD )
B
400oC
425oC
450oC
140 130 120 110 100 90 80 70
60 50 40 30 20
10 0 AO-DND
N2-DND
1 hour heating
AO-DND
N2-DND
5 hour heating
Fig. 2. Inflammogenicity of starting DND and DND heated in air or nitrogen. (A) Confluent HAECs were exposed to DND or AO-DND at 114 μg/ml-well (30 μg/cm2) for 4 h. IL-8 mRNA levels were measured using TaqMan-based real-time PCR, normalized to levels of GAPDH mRNA and compared to media controls (n = 3 separate cell exposure assays). (B) DND particles were heated for either 1 or 5 h at 425 °C in either air (AO-DND) or N2 (N2-DND). AO-DNDs were cooled in air; N2-DNDs were cooled in N2. HAECs were exposed to DND, AO-DND or N2-DND for 4 h at 114 μg/ml/well (30 μg/cm2). IL-8 mRNA levels were measured using TaqMan-based real-time PCR, normalized to levels of GAPDH mRNA and compared to media controls. (n = 3 separate particle heating experiments, each assayed in 3 separate cell exposure experiments, using cells from multiple donors).
R. Silbajoris et al. / Diamond & Related Materials 58 (2015) 16–23
thermal processing was complete, the aluminum pan was removed from the reactor and samples were transferred into glass vials. Method controls using air or nitrogen flow with the reactor at room temperature were also generated. All thermal treatments were performed in triplicate. In our experiments, DND suspensions were prepared by sonicating the particles in supplement-free basal medium (BEBM) in an ultrasonic water bath immediately prior to cell exposure. Confluent 12-well HAEC cultures were incubated overnight in BEBM and then treated with 1 ml of freshly prepared DND suspension (114 μg/ml (30 μg/cm2)) per well for 4 h. In spite of the procedure, HAECs were likely exposed to agglomerates of DND (see below) that settled on the cultures. 2.4. Real-time PCR Relative gene expression in HAEC was quantified using real-time PCR. Total RNA was isolated using an RNeasy kit according to manufacturer's instructions (Qiagen, Valencia, CA, USA) and reverse transcribed to generate cDNA using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA). Oligonucleotide primer pairs and dual-labeled fluorescent probes for Interleukin-8 (IL8) (forward primer 5′TTGGCAGCCTTCCTGATTTC3′, reverse primer 5′ TATGCACTGACATCTAAGTTCTTTAGCA3′, probe 5′CCTTGGCAAAACTG CACCTTCACACA3′) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (forward primer 5′GAAGGTGAAGGTCGGAGTC3′, reverse primer 5′GAAGATGGTGATGGGATTTC3′, probe 5′CAAGCTTCCCGTTCTC AGCC3′) were obtained from Integrated DNA Technologies (Coralville, IA, USA). Quantitative fluorogenic amplification of cDNA was performed using the ABI Prism 7500 Sequence Detection System (Applied Biosystems), primer/probe sets of interest and TaqMan Universal PCR Master Mix (Applied Biosystems). The relative abundance of mRNA levels was determined from standard curves generated from a serially diluted standard pool of cDNA prepared from HAEC. The relative abundance of GAPDH mRNA was used to normalize levels of IL-8 mRNA. 2.5. Raman spectroscopy Silicon wafers were soaked in a sulphuric acid:hydrogen peroxide mixture (3:1) overnight, sequentially washed with water/acetone/ water and dried under nitrogen. 80 μl of a 3 mg/ml suspension of DND was placed on a silicon wafer and allowed to air dry. Micro-Raman analyses were performed using a Horiba Jobin Yvon HR800 Raman spectrometer (Horiba Instruments, Irvine, CA, USA). The 785 nm diode laser (30 mW) was focused using a 100× objective onto the sample surface down to a spot size of 20 μm. Spectra were recorded using 1200 lines/mm grating with an exposure time of 10 s.
19
Table 1 Physicochemical characteristics and inflammogenic potency of detonation nanodiamond particles before and after heating in air or N2. ND Unheated N2 425
a
XPS C 1 s (mass %) XPS O 1 s (mass %) b Zeta potential (mV) c EPR (arbitrary units) d IL-8 mRNA (% heated/unheated)
90.9 7.2 +47.4 1.7e+10 100
N2 425
Air 425
°C 1h
°C 5h
°C 1 h
92.0 6.3 +43.9 0.9e+10 106.3
91.3 7.0 +44.6 113.2
Air 425 °C 5 h
82.4 81.3 16.1 16.7 −49.9 –33.2 0.6e+10 48.2 46.6
a The fractional content of C 1 s and O 1 s on the surface the DND was analyzed using X-ray photoelectron spectroscopy. b Zeta potential was determined by measuring electrophoretic mobility. c Free radical content of nanoparticles as determined from the intensity of the electron paramagnetic spin resonance (EPR) signal intensity. The data is reported in arbitrary signal intensity units. d Levels of interleukin-8 mRNA in cultured confluent primary human airway epithelial cells exposed to 30 μg/cm2 of DND for 4 h were measured using RT-PCR.
The electrophoretic mobility of DND particles was measured using the laser Doppler electrophoresis method and these values were used for the calculation of the electrokinetic (zeta) potentials of the samples. Zeta potential values were derived from the measured electrophoretic mobility using Smoluchowski's approximation for Henry's function (approximately 1.5). This is justified by the relatively large size of the particles [12]. The resistivity of DI water used in the measurements was 18 MΩ°cm. Five milliliters of each sample was sonicated for 5 min prior to the measurements. Three measurements were taken at room temperature for each sample and the average results were reported. 2.8. X-ray photoelectron spectroscopy (XPS) DNDs were suspended in 100 μl of water at 1 mg/ml. The suspension was placed on a gold surface and allowed to dry. XPS data were collected on a Kratos Axis Ultra DLD system (Manchester, UK) with a monochromatic aluminum Kα X-ray source operated at 150 W. The base
2.6. Electron paramagnetic spin resonance spectroscopy (EPR) EPR measurements were performed on DND samples at X-band, 9.87 GHz, with a Bruker EMX spectrometer (Billerica, MA, USA) with spectra recorded using the following parameters: microwave power 20 mW, modulation amplitude 1.0 G, modulation frequency 100 kHz, and 200 G sweep width. Equal weights of each sample were measured in identical 50 μl capillary tubes. 2.7. Zeta potential and size A Zetasizer NanoZS (Malvern Instruments, Worcestershire, UK) was used to measure particle sizes and electrophoretic mobility of 0.1 wt.% suspensions of DND in DI water. A dynamic light scattering (DLS) method was used for the particle size distribution measurements. Average volumetric particle sizes for the tight aggregates of the studied DND samples dispersed by sonication in DI water were approximately 130–140 nm. Particle agglomerates ranging from 400 nm–1000 nm formed in seconds following suspension in BEBM.
Fig. 3. Electron paramagnetic resonance spectroscopy changes induced by air oxidation of DND. Samples of equal mass of DND that were left untreated or heated at 425 °C for 1 h were analyzed by EPR at X-band, 9.87 GHz using 50 μl capillary tubes.
20
R. Silbajoris et al. / Diamond & Related Materials 58 (2015) 16–23
Fig. 4. Correlation between DND inflammogenicity and particle zeta potential. The inflammogenic potency of DND particles was determined by exposing cells to 30 μg/cm2 DND for 4 h. IL8 mRNA levels were measured using RT-PCR and are shown plotted against the corresponding zeta potential for that DND sample (p = 0.0044, r2 = 0.505).
pressure in the system is ca. 3 × 10−9 Torr. Pass energies of 80 eV and 20 eV were used for survey and high resolution scans, respectively. All XPS data were corrected to the C1s peak at 286.4 eV. The sample geometry used allowed measurement of a depth of approximately 10 nm of the sample surface. 2.9. Fourier transform infrared spectroscopy (FTIR) FTIR analysis of the composition of the surface groups for initial and oxidized DND samples was performed using a Thermo Electron Nicolet 8700 FTIR spectrometer (ThermoScientific, Madison, WI, USA). For FTIR measurements, ~10 mg of the DND samples was mixed with ~300 mg of KBr powder, pressed into pellets 0.5–0.7 mm thick and measured in transmission mode in a N2-purged chamber. The KBr used for the pellets was stored desiccated under N2 and the pellets were prepared immediately before analysis. A pure KBr pellet was used to generate the background spectrum. 3. Results and discussion We followed the experimental conditions described by Osswald et al. [5] to generate air oxidized DND (AO-DND). As shown in Fig. 1, comparison of the Raman spectra of AO-DND heated at 375–425 °C for 5 h with those of the untreated DND and a reference high-pressure high-temperature (HPHT) monocrystalline nanodiamond material with 100 nm particle size (ND) showed temperature-dependent changes consistent with a loss of surface sp2-bonded carbon (~1600 cm−1) and an accompanying increase in the relative strength of the diamond peak at ~1325 cm−1. After 2 h of heating at 450 °C there were appreciable mass losses suggestive of DND combustion. These analyses confirmed the effectiveness of heating in air as a method to remove nondiamond carbon from the surface of the DND. We have reported previously that acute exposure to non-cytotoxic levels of DND induces a marked increase in the expression of the gene encoding the chemokine interleukin 8 (IL-8) by cultured human airway epithelial cells (HAECs) [11]. We therefore used mRNA levels of IL-8 as an indicator of the inflammogenic potency of AO-DND using DND as a reference in this study. Exposure of HAEC to 114 μg/ml (30 μg/cm2) of AO-DND generated at temperatures ranging from 375 to 425 °C for 5 h resulted in levels of IL-8 expression that were significantly reduced relative to the levels induced by exposure to the starting (untreated) DND (Fig. 2A). These data provided a correlation between the loss of
non-diamond carbon from the DND surface and its inflammogenicity. Further studies in which the duration of heating of the DND was varied showed that a heating period as short as 5 min resulted in a 40% reduction in bioactivity towards HAEC (data not shown). Such short heating periods, however, were not sufficient to produce changes in the Raman spectra of AO-DND relative to DND (data not shown). Our previous study showed that the molecular mechanism that mediates DND-induced IL-8 gene expression in HAEC involves oxidative stress presented by reactive oxygen species (ROS), specifically H2O2 as an effector molecule, and that the activity of the DND is not extractable, implying that it is an intrinsic property of the surface of the particle [11]. Given the evidence of ROS involvement in the bioactivity of DND, in the present study we investigated the role of surface oxygen content on DND bioactivity by heating it in an atmosphere containing 100% nitrogen at 425 °C to generate a sample of annealed DND (N2-DND). In contrast to cells treated with AO-DND, the level of IL-8 mRNA in HAEC exposed to N2-DND was not reduced from that induced by DND (Fig. 2B and Table 1), indicating that the availability of O2 during heating is required to effect the loss of inflammogenic potency of the DND surface and thus suggesting a role of oxygen-containing functional groups in the toxicity of DND. Given the aforementioned mechanistic involvement of ROS in the toxicity of DND that we reported previously, we measured the content of unpaired electrons on the nanodiamond particles using electron paramagnetic resonance spectroscopy (EPR). Compared to DND, the EPR signal strength for AO-DND was reduced by ~65%, indicating that air oxidation decreased the radical concentration of the nanodiamond (Fig. 3). Heating in anoxic conditions was somewhat less effective in diminishing the concentration of unpaired electrons associated with DND, with N2-DND showing a ~47% reduction in EPR signal strength relative to that in DND (Table 1). An implication of these EPR data is that heat treatment of the particles can drive free radical quenching on the surface of the DND due to surface reconstruction. However, given that the changes in the inflammogenic potency of DND changed significantly with the same air oxidation treatment that resulted in only a modest decrease in the unpaired electron concentration, other surface characteristics may be more important contributors to the inflammogenicity of DND. Zeta potential, defined as the electrical potential between the layer of fluid around a particle and the medium in which it is suspended, has been shown to be a marker of the bioactivity of nanomaterials of various types [13]. A positive charge is generally associated with increased particle cytotoxicity when compared to particles with the
R. Silbajoris et al. / Diamond & Related Materials 58 (2015) 16–23
21
Fig. 5. FTIR spectra of the starting and heated DND. DND (A), DND heated for 1 h in Air (B) and in N2 (C). Inset (D) shows detail corresponding to the 1400–2000 cm−1 region for the three DND samples. Signal intensity scales were adjusted for clarity. All spectra are raw values with background subtracted.
22
R. Silbajoris et al. / Diamond & Related Materials 58 (2015) 16–23
same composition bearing a neutral or anionic surface charge [14–16]. Positive charges on a wide variety of particle compositions have been shown to interact strongly with membrane components, leading to bilayer thinning, erosion and perforation, and potentially altering membrane permeability irreparably [17]. The zeta potential of the starting DND particles was found to be strongly positive and remained unchanged by heating under anoxic conditions for 1–5 h. In contrast, the presence of air during heating for 1 or 5 h resulted in highly negative values of the zeta potential of AO-DND (Table 1). We further investigated the predictive value of zeta potential as a marker of DND bioactivity by analyzing the statistical correlation between surface charge and IL-8 mRNA levels induced by exposure of HAEC to a total of 14 different nanodiamond preparations. As shown in Fig. 4, nanodiamond zeta potentials clustered in two groups between − 26 mV to − 50 mV and + 35 mV to + 47 mV, and zeta values were significantly correlated with the magnitude of IL-8 expression by HAEC. A limitation of using IL-8 transcript levels as a readout of bioactivity is that the dynamic range of the response of the cells, which is a function of the activity of intracellular signaling processes that regulate transcriptional expression and the half-life of the mRNA, is not defined in this study. Nonetheless, the fact that we observed a statistically significant positive correlation between the zeta potential value of DND and its potency in inducing elevations in IL-8 mRNA levels in HAEC supports a role for surface charge in activating a pro-inflammatory cellular response to DND exposure. The carbon and oxygen content of the starting and heated nanodiamond particles was analyzed by X-ray photoelectron spectroscopy (XPS). As seen in Table 1, a comparison of the mass concentration of C and O values for DND and AO-DND prepared by heating in air for 1–5 h showed a significant increase in the relative content of oxygen, while the O concentration in N2-DND particles produced by heating in N2 for 1–5 h showed a slight decrease in comparison to the starting material. Heating DND in an inert atmosphere or vacuum causes thermal decomposition and desorption of the surface groups, where specific groups desorb within specific temperature intervals [18,19]. For example, carboxylic groups are released from the DND surface during heating between approximately 200 °C and 400 °C. At 400 °C some fraction of lactones and acid anhydride groups can also be lost from the DND surface. There are two processes that can occur during heating in an inert atmosphere: (i) the condensation of different oxygen-containing groups with release of water molecules, and (ii) the decomposition of acidic groups (carboxyl, anhydride, and lactone groups) releasing CO2 and CO. The slight decrease of the oxygen content (Table 1) after heating at 400 °C in N2 probably reflects decomposition of carboxylic groups. However, it can be assumed that the majority of the O-containing groups in the starting sample are the more thermally stable hydroxylic, ketonic and ether groups. FTIR spectroscopy was also used to characterize changes in the content of functional groups in the DNDs subjected to air oxidation or heating in nitrogen. As Fig. 5 shows, the FTIR spectrum in the region of 1500–1900 cm− 1 demonstrates pronounced peaks for the starting DND that are indicative of the presence of hydroxyl and carbonyl groups (1630 and 1730 cm−1, respectively). Heating of DND for 1 h in the presence of air to generate AO-DND produced major changes in the FTIR spectrum consistent with the formation of lactones and carboxylic acid anhydrides (~1820 cm−1). Air oxidation of the DND resulted in a shift in the carbonyl peak suggestive of the formation of lactones and acid anhydrides that were detectable in the FTIR spectrum by 5 min of heating (data not shown). In contrast, the carbonyl peak in the spectrum for N2-DND is located in the same position as that of DND (~1720 cm−1, Fig. 5). These data are largely in agreement with the findings of Osswald et al. [5], showing that air oxidation induces rapid production of carbonyl species on DND associated with the formation of lactones and acid anhydrides, at the apparent expense of carbonyl within keto, aldehyde and ester groups. Air oxidation results in changes in the speciation of C–O groups on the surface of DND that are accompanied by a reduction in
inflammogenic activity towards HAEC. The shift in zeta potential likely reflects the changes in oxygenated surface moieties seen in AO-DND and may represent a fundamental determinant that underlies the loss of bioactivity induced by heating DND in the presence of air. Loss of surface radicals may also contribute to this decrease. The present findings demonstrating correlation between changes in the composition of the oxygen-containing surface groups of DND with the loss of bioactivity reveal an important link between the toxicity of DND and the content of its specific oxygen-containing moieties. Additional investigation is needed to identify specific functional groups that are responsible for the toxicity of DND preparations, and to elucidate molecular mechanisms through which adverse cellular responses to carbonaceous nanomaterials are initiated in HAEC. Prime novelty statement The subject of this study bridges an unusually wide distance between chemistry and biology. It follows on a 2009 study which we published in Nanotoxicology, describing in detail the intracellular mechanism through which nanodiamonds induce inflammatory responses in human lung cells. In the present study, the objective was to identify chemical determinants of the toxicity of a nanodiamond preparation in the human respiratory epithelium. Rather than use an immortalized cell line, in this study we took the challenge of using primary cultures of human bronchial epithelial cells in order to maximize the relevance and extrapolation value of the data to human health. This study addresses the toxicity of nanodiamonds and may also be generalizable to the bioactivity of other carbonaceous materials present in the air in environmental and occupational settings. Acknowledgments The authors are indebted to Drs. M. Carraway and A. Ghio for their procurement of the human airway epithelial cells, to Dr. V. Vaijayanthimala for her technical assistance with the Raman spectroscopy analyses, to Mr. Andrew Vargas for the Zeta potential measurements and to Mr. Craig Hemann for the EPR analyses. The input of Dr. Carrie Donley of the Chapel Hill Analytical and Nanofabrication Laboratory and Dr. Mark Walters of the Shared Materials Instrumentation Facility at Duke University is also gratefully acknowledged. References [1] V.N. Mochalin, O. Shenderova, D. Ho, Y. Gogotsi, The properties and applications of nanodiamonds, Nat. Nanotechnol. 7 (1) (2012) 11–23. [2] O.A. Shenderova, D.M. Gruen, Ultrananocrystalline Diamond Synthesis, Properties and Applications, William Andrew, 2006. [3] V.Y. Dolmatov, Detonation synthesis ultradispersed diamonds: properties and applications, Usp. Khim. 70 (2001) 687–708. [4] O. Shenderova, A. Koscheev, N. Zaripov, I. Petrov, Y. Skryabin, P. Detkov, S. Turner, G. Van Tendeloo, Surface chemistry and properties of ozone-purified detonation nanodiamonds, J. Phys. Chem. C 115 (20) (2011) 9827–9837. [5] S. Osswald, G. Yushin, V. Mochalin, S.O. Kucheyev, Y. Gogotsi, Control of sp2/sp3 carbon ratio and surface chemistry of nanodiamond powders by selective oxidation in air, J. Am. Chem. Soc. 128 (35) (2006) 11635–11642. [6] Y. Yuan, Y. Chen, J.-H. Liu, H. Wang, Y. Liu, Biodistribution and fate of nanodiamonds in vivo, Diam. Relat. Mater. 18 (1) (2009) 95–100. [7] Y. Yuan, X. Wang, G. Jia, J.-H. Liu, T. Wang, Y. Gu, S.-T. Yang, S. Zhen, H. Wang, Y. Liu, Pulmonary toxicity and translocation of nanodiamonds in mice, Diam. Relat. Mater. 19 (4) (2010) 291–299. [8] A.M. Schrand, H. Huang, C. Carlson, J.J. Schlager, E. Omacr Sawa, S.M. Hussain, L. Dai, Are diamond nanoparticles cytotoxic? J. Phys. Chem. B 111 (1) (2007) 2–7. [9] Y. Xing, W. Xiong, L. Zhu, E. Osawa, S. Hussin, L. Dai, DNA damage in embryonic stem cells caused by nanodiamonds, ACS Nano 5 (3) (2011) 2376–2384. [10] J. Wehling, R. Dringen, R.N. Zare, M. Maas, K. Rezwan, Bactericidal activity of partially oxidized nanodiamonds, ACS Nano 8 (6) (2014) 6475–6483. [11] R. Silbajoris, J.M. Huang, W.-Y. Cheng, L. Dailey, T.L. Tal, I. Jaspers, A.J. Ghio, P.A. Bromberg, J.M. Samet, Nanodiamond particles induce I1-8 expression through a transcript stabilization mechanism in human airway epithelial cells, Nanotoxicology 3 (2) (2009) 152–160. [12] N. Petrova, A. Zhukov, F. Gareeva, L. Kooscheev, I. Petrov, O. Shenderova, Interpretation of electrokinetic measurements of nanodiamond particles, Diam. Relat. Mater. 30 (2012) 62–69.
R. Silbajoris et al. / Diamond & Related Materials 58 (2015) 16–23 [13] A.E. Nel, L. Madler, D. Velegol, T. Xia, E.M. Hoek, P. Somasundaran, F. Klaessig, V. Castranova, M. Thompson, Understanding biophysicochemical interactions at the nano-bio interface, Nat. Mater. 8 (7) (2009) 543–557. [14] X.Z. Wang, Y. Yang, R. Li, C. McGuinnes, J. Adamson, I.L. Megson, K. Donaldson, Principal component and causal analysis of structural and acute in vitro toxicity data for nanoparticles, Nanotoxicology 8 (5) (2013) 465–476. [15] V. Kasturirangan, B.M. Nair, M.T. Kariapper, W.G. Lesniak, W. Tan, R. Bizimungu, P. Kanter, K. Toth, S. Buitrago, Y.M. Rustum, A. Hutson, L.P. Balogh, M.K. Khan, In vivo toxicity evaluation of gold–dendrimer composite nanodevices with different surface charges, Nanotoxicology 7 (4) (2013) 441–451. [16] A. Lankoff, M. Arabski, A. Wegierek-Ciuk, M. Kruszewski, H. Lisowska, A. BanasikNowak, K. Rozga-Wijas, M. Wojewodzka, S. Slomkowski, Effect of surface
23
modification of silica nanoparticles on toxicity and cellular uptake by human peripheral blood lymphocytes in vitro, Nanotoxicology 7 (3) (2013) 235–250. [17] P.R. Leroueil, S.A. Berry, K. Duthie, G. Han, V.M. Rotello, D.Q. McNerny, J.R. Baker Jr., B.G. Orr, M.M. Holl, Wide varieties of cationic nanoparticles induce defects in supported lipid bilayers, Nano Lett. 8 (2) (2008) 420–424. [18] A.P. Kosheev, Thermodesorption mass spectrometry in the light of solution of the problem of certification and unification of the surface properties of detonation nanodiamonds, Russ. J. Gen. Chem. 79 (2009) 2033–2044. [19] V.L. Kuznetsov, Y.V. Butenko, Diamond Phase Transitions at Nanoscale, in: O. Shenderova, D.M. Gruen (Eds.), Ultrananocrystalline Diamond, Second ed.Elsevier 2012, pp. 181–244.
Contents lists available at ScienceDirect
Diamond & Related Materials journal homepage: www.elsevier.com/locate/diamond
Detonation nanodiamond toxicity in human airway epithelial cells is modulated by air oxidation☆ Robert Silbajoris a, William Linak b, Olga Shenderova c, Christopher Winterrowd d, Huan-Cheng Chang e, Jay L. Zweier f, Anirudh Kota g, Lisa A. Dailey a, Nicholas Nunn c, Philip A. Bromberg h, James M. Samet a,⁎ a
Environmental Public Health Division, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC, United States Air Pollution Prevention and Control Division, National Risk Management Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC, United States Adámas Nanotechnologies, Inc., Research Triangle Park, NC, United States d ARCADIS U.S., Durham, NC, United States e Institute of Atomic and Molecular Sciences, Academia Sinica, Taipei, Taiwan f The Dorothy M. Davis Heart and Lung Research Institute, and the Division of Cardiovascular Medicine, Department of Internal Medicine, College of Medicine, The Ohio State University Medical Center, Columbus, OH, United States g Department of Chemical Engineering, North Carolina State University, Raleigh, NC, United States h Center for Environmental Medicine, Asthma and Lung Biology, University of North Carolina at Chapel Hill, Chapel Hill, NC, United States b c
a r t i c l e
i n f o
Article history: Received 7 April 2015 Received in revised form 12 May 2015 Accepted 20 May 2015 Available online 22 May 2015 Keywords: Nanodiamond Toxicity Human airway epithelial cells Interleukin-8 Zeta potential
a b s t r a c t Detonation nanodiamonds (DNDs), a nanomaterial with an increasing range of industrial and biomedical applications, have previously been shown to induce a pro-inflammatory response in cultured human airway epithelial cells (HAECs). We now show that surface modifications induced by air oxidation of DND (AO-DND), including an increase in oxygen content, formation of carboxylic groups associated with the appearance of high negative zeta potential and a decrease in unpaired electron content, are accompanied by a significant loss of bioactivity, as measured by levels of interleukin-8 mRNA in HAEC. These findings are relevant to the identification of chemical determinants and molecular mechanisms of the inhalational toxicity of carbonaceous nanomaterials. Published by Elsevier B.V.
1. Introduction Like its graphitic polymorph, diamond is a crystalline form of carbon. However, while the sp2 C_C bonds in graphite lead to a planar arrangement, the sp3 C–C bonds in diamond form the tetrahedral structure that gives diamond its unique physicochemical properties, including electrical insulation, exceptional hardness and optical transparency. In recent years, nano-scale diamond particles have been the subject of considerable interest due to their expanding range of applications in industrial, research and biomedical settings [1]. Confined detonation of explosives in a metallic chamber is an efficient, environmentally friendly and cost-effective method to synthesize ☆ Disclaimer: The research described in this article has been reviewed by the National Health and Environmental Effects Research Laboratory, U.S. EPA, and approved for publication. The contents of this article should not be construed to represent Agency policy nor does mention of trade names or commercial products constitute endorsement or recommendation for use.The authors declare that they have no actual or potential competing financial interests. ⁎ Corresponding author at: EPA Human Studies Facility, 104 Mason Farm Rd, Chapel Hill, NC 27599-7315, United States. E-mail address: [email protected] (J.M. Samet).
nanodiamonds, termed detonation nanodiamonds (DNDs). A major limitation of DND is that the surface of the particles is typically contaminated with graphitic (sp2 hybridized) carbon and non-combustible metallic impurities, which adversely alter the desirable mechanical and optical properties of these nanomaterials. A variety of methods have been developed to remove surface contaminants from DND postsynthesis, including treatment with strong acids or oxidizers such as HClO4 or ozone, each incurring significant economic and environmental drawbacks [2–4]. Osswald and colleagues demonstrated that heating DND in air at elevated temperatures is a simpler approach to oxidizing surface non-diamond carbon that results in raising the sp3 content of DND by increasing the concentration of oxygen-containing moieties [5]. As is the case with other commercially produced nanomaterials, the safety of nanodiamonds has not been adequately evaluated [6]. Studies have shown that intratracheally instilled nanodiamonds have low pulmonary toxicity in mice [7]. A separate investigation of neuroblastoma cells, keratinocytes and macrophages exposed to untreated as well as acid- or alkali-functionalized nanodiamond particles reported no effects on multiple markers of cytotoxicity [8]. On the other hand, there is increasing evidence that the state of oxidation of nanodiamonds can influence their toxicity. Xing et al. reported DNA damage in embryonic stem
R. Silbajoris et al. / Diamond & Related Materials 58 (2015) 16–23
cells exposed to oxidized nanodiamond particles [9], while Wehling and colleagues found bactericidal activity in nanodiamonds annealed in air [10]. Moreover, in a previous study [11], we showed that in vitro exposure to a commercial DND preparation induces a marked increase in the expression of the potent inflammatory chemokine interleukin-8 (IL-8) in cultured primary human airway epithelial cells (HAECs). We further showed that the mechanism involved in DND-induced IL-8 expression is dependent on the production of intracellular H2O2, suggesting that DND exposure presents an oxidative stress to HAEC. In order to gain insight into chemical factors that act as determinants of the toxicity of carbonaceous nanoparticles, in the present study we have investigated the relationship between the surface chemistry of DND and its bioactivity. We have used specific conditions for thermal desorption based on the method described by Osswald et al. [5] to modify the chemical composition of DND nanoparticle preparations and measured the effect that these modifications have on the bioactivity of the particles, using IL-8 mRNA expression by HAEC as a readout of inflammogenic potential. We report that changing the surface content of oxygen-containing functional groups by air oxidation reduces the inflammogenicity of DND nanoparticles.
17
from Corning (Corning, NY, USA). Purified bovine collagen was obtained from Advanced Biomatrix (San Diego, CA, USA). Nanodiamond particles were purchased from Nanodiamond.com (Massagno, Switzerland). 2.2. Cell culture Primary normal human airway epithelial cells (HAECs) were obtained from adult human volunteers by brush biopsy of the mainstem bronchi using a cytology brush during fiber optic bronchoscopy, conducted under a protocol approved by the Committee on the Protection of the Rights of Human Subjects at the University of North Carolina at Chapel Hill. HAECswere initially plated in bronchial epithelial cell basal medium (BEBM) supplemented with 52 mg/ml bovine pituitary extract, 5 mg/ml insulin, 0.5 mg/ml hydrocortisone, 0.1 ng/ml retinoic acid, 10 mg/ml transferrin, 6.5 ng/ml triiodothyronine, 0.5 mg/ml epinephrine, 0.5 ng/ml human epidermal growth factor, 50 mg/ml gentamycin and 50 ng/ml amphotericin-B (BEGM) on tissue culture plates coated with bovine collagen, grown to confluence at 37 °C/5% CO2 and then passaged two or three times in BEGM on ordinary tissue culture plates. 2.3. Nanodiamond particle synthesis, thermal treatment and HAEC exposures
2. Materials and methods 2.1. Reagents Tissue culture media and supplements were obtained from Lonza (Walkersville, MD, USA). Costar tissue culture plates were purchased
According to the manufacturer (www.nanodiamond.com), nanodiamond particles were produced by detonation of carboncontaining explosives. The resulting diamond-graphite powder is
ND
12000
DND DND 450o C, 2h DND 425o C, 5h DND 400o C, 5h DND 375o C, 5h
Raman signal intensity (a.u.)
10000
8000
6000
4000
2000
0 1000
1200
1400
1600
Wavenumber (cm-1) Fig. 1. Raman spectra of the starting DND and DNDs heated in air for 2–5 h at temperatures ranging from 375 to 450 °C. The spectrum of the reference ND sample with particle size of 100 nm is also included for comparison.
18
R. Silbajoris et al. / Diamond & Related Materials 58 (2015) 16–23
purified with an oxidizing mixture of sulfuric and nitric acid at 230– 305 °C. The final powder is stated to be up to 99.5% by weight pure diamond with an average individual particle diameter of 5 nm. The particles are rounded in shape and are stated to have a surface area of ~ 300 m2/g. During synthesis and purification, the primary particles form tightly bound aggregates with sizes exceeding 100 nm in diameter. A horizontal bench-scale reactor was used to thermally process nanodiamond powder samples. The reactor was composed of a 4 cm (ID) by 71 cm long borosilicate glass tube nested inside a 46 cm long electric furnace (Thermcraft, Winston-Salem, NC, USA). Socket joints
A
at each end of the tube allowed attachment of ball end caps. Glass nipples on the ball end caps and tube ends provided access for thermocouples (type E; Omega, Stamford, CT, USA) and attachment of ultra-high purity air and nitrogen gas cylinders. Gas flow was maintained at 500 cm3/min during all phases of heating and cooling. Nanodiamond samples (~50 mg) were placed in disposable aluminum pans and placed into the pre-heated reactor. DND samples were heated in the furnace under air or N2 flow at 425 °C for 5–300 min and then gradually cooled under air or N2 flow to room temperature. In some experiments, samples were pre-heated at 150 °C for 15 min and then moved inside the furnace. Samples were allowed to cool at 50 °C for 10 min. When
24
lL-8 mRNA Fold Increase Over Media Control (corrected for GAPDH mRNA)
22 20 18 16 14 12 10 8 6 4 2
0 375oC
DND
IL-8 mRNA Fold Increase Over Media Control (% heated/unheated DD )
B
400oC
425oC
450oC
140 130 120 110 100 90 80 70
60 50 40 30 20
10 0 AO-DND
N2-DND
1 hour heating
AO-DND
N2-DND
5 hour heating
Fig. 2. Inflammogenicity of starting DND and DND heated in air or nitrogen. (A) Confluent HAECs were exposed to DND or AO-DND at 114 μg/ml-well (30 μg/cm2) for 4 h. IL-8 mRNA levels were measured using TaqMan-based real-time PCR, normalized to levels of GAPDH mRNA and compared to media controls (n = 3 separate cell exposure assays). (B) DND particles were heated for either 1 or 5 h at 425 °C in either air (AO-DND) or N2 (N2-DND). AO-DNDs were cooled in air; N2-DNDs were cooled in N2. HAECs were exposed to DND, AO-DND or N2-DND for 4 h at 114 μg/ml/well (30 μg/cm2). IL-8 mRNA levels were measured using TaqMan-based real-time PCR, normalized to levels of GAPDH mRNA and compared to media controls. (n = 3 separate particle heating experiments, each assayed in 3 separate cell exposure experiments, using cells from multiple donors).
R. Silbajoris et al. / Diamond & Related Materials 58 (2015) 16–23
thermal processing was complete, the aluminum pan was removed from the reactor and samples were transferred into glass vials. Method controls using air or nitrogen flow with the reactor at room temperature were also generated. All thermal treatments were performed in triplicate. In our experiments, DND suspensions were prepared by sonicating the particles in supplement-free basal medium (BEBM) in an ultrasonic water bath immediately prior to cell exposure. Confluent 12-well HAEC cultures were incubated overnight in BEBM and then treated with 1 ml of freshly prepared DND suspension (114 μg/ml (30 μg/cm2)) per well for 4 h. In spite of the procedure, HAECs were likely exposed to agglomerates of DND (see below) that settled on the cultures. 2.4. Real-time PCR Relative gene expression in HAEC was quantified using real-time PCR. Total RNA was isolated using an RNeasy kit according to manufacturer's instructions (Qiagen, Valencia, CA, USA) and reverse transcribed to generate cDNA using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA). Oligonucleotide primer pairs and dual-labeled fluorescent probes for Interleukin-8 (IL8) (forward primer 5′TTGGCAGCCTTCCTGATTTC3′, reverse primer 5′ TATGCACTGACATCTAAGTTCTTTAGCA3′, probe 5′CCTTGGCAAAACTG CACCTTCACACA3′) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (forward primer 5′GAAGGTGAAGGTCGGAGTC3′, reverse primer 5′GAAGATGGTGATGGGATTTC3′, probe 5′CAAGCTTCCCGTTCTC AGCC3′) were obtained from Integrated DNA Technologies (Coralville, IA, USA). Quantitative fluorogenic amplification of cDNA was performed using the ABI Prism 7500 Sequence Detection System (Applied Biosystems), primer/probe sets of interest and TaqMan Universal PCR Master Mix (Applied Biosystems). The relative abundance of mRNA levels was determined from standard curves generated from a serially diluted standard pool of cDNA prepared from HAEC. The relative abundance of GAPDH mRNA was used to normalize levels of IL-8 mRNA. 2.5. Raman spectroscopy Silicon wafers were soaked in a sulphuric acid:hydrogen peroxide mixture (3:1) overnight, sequentially washed with water/acetone/ water and dried under nitrogen. 80 μl of a 3 mg/ml suspension of DND was placed on a silicon wafer and allowed to air dry. Micro-Raman analyses were performed using a Horiba Jobin Yvon HR800 Raman spectrometer (Horiba Instruments, Irvine, CA, USA). The 785 nm diode laser (30 mW) was focused using a 100× objective onto the sample surface down to a spot size of 20 μm. Spectra were recorded using 1200 lines/mm grating with an exposure time of 10 s.
19
Table 1 Physicochemical characteristics and inflammogenic potency of detonation nanodiamond particles before and after heating in air or N2. ND Unheated N2 425
a
XPS C 1 s (mass %) XPS O 1 s (mass %) b Zeta potential (mV) c EPR (arbitrary units) d IL-8 mRNA (% heated/unheated)
90.9 7.2 +47.4 1.7e+10 100
N2 425
Air 425
°C 1h
°C 5h
°C 1 h
92.0 6.3 +43.9 0.9e+10 106.3
91.3 7.0 +44.6 113.2
Air 425 °C 5 h
82.4 81.3 16.1 16.7 −49.9 –33.2 0.6e+10 48.2 46.6
a The fractional content of C 1 s and O 1 s on the surface the DND was analyzed using X-ray photoelectron spectroscopy. b Zeta potential was determined by measuring electrophoretic mobility. c Free radical content of nanoparticles as determined from the intensity of the electron paramagnetic spin resonance (EPR) signal intensity. The data is reported in arbitrary signal intensity units. d Levels of interleukin-8 mRNA in cultured confluent primary human airway epithelial cells exposed to 30 μg/cm2 of DND for 4 h were measured using RT-PCR.
The electrophoretic mobility of DND particles was measured using the laser Doppler electrophoresis method and these values were used for the calculation of the electrokinetic (zeta) potentials of the samples. Zeta potential values were derived from the measured electrophoretic mobility using Smoluchowski's approximation for Henry's function (approximately 1.5). This is justified by the relatively large size of the particles [12]. The resistivity of DI water used in the measurements was 18 MΩ°cm. Five milliliters of each sample was sonicated for 5 min prior to the measurements. Three measurements were taken at room temperature for each sample and the average results were reported. 2.8. X-ray photoelectron spectroscopy (XPS) DNDs were suspended in 100 μl of water at 1 mg/ml. The suspension was placed on a gold surface and allowed to dry. XPS data were collected on a Kratos Axis Ultra DLD system (Manchester, UK) with a monochromatic aluminum Kα X-ray source operated at 150 W. The base
2.6. Electron paramagnetic spin resonance spectroscopy (EPR) EPR measurements were performed on DND samples at X-band, 9.87 GHz, with a Bruker EMX spectrometer (Billerica, MA, USA) with spectra recorded using the following parameters: microwave power 20 mW, modulation amplitude 1.0 G, modulation frequency 100 kHz, and 200 G sweep width. Equal weights of each sample were measured in identical 50 μl capillary tubes. 2.7. Zeta potential and size A Zetasizer NanoZS (Malvern Instruments, Worcestershire, UK) was used to measure particle sizes and electrophoretic mobility of 0.1 wt.% suspensions of DND in DI water. A dynamic light scattering (DLS) method was used for the particle size distribution measurements. Average volumetric particle sizes for the tight aggregates of the studied DND samples dispersed by sonication in DI water were approximately 130–140 nm. Particle agglomerates ranging from 400 nm–1000 nm formed in seconds following suspension in BEBM.
Fig. 3. Electron paramagnetic resonance spectroscopy changes induced by air oxidation of DND. Samples of equal mass of DND that were left untreated or heated at 425 °C for 1 h were analyzed by EPR at X-band, 9.87 GHz using 50 μl capillary tubes.
20
R. Silbajoris et al. / Diamond & Related Materials 58 (2015) 16–23
Fig. 4. Correlation between DND inflammogenicity and particle zeta potential. The inflammogenic potency of DND particles was determined by exposing cells to 30 μg/cm2 DND for 4 h. IL8 mRNA levels were measured using RT-PCR and are shown plotted against the corresponding zeta potential for that DND sample (p = 0.0044, r2 = 0.505).
pressure in the system is ca. 3 × 10−9 Torr. Pass energies of 80 eV and 20 eV were used for survey and high resolution scans, respectively. All XPS data were corrected to the C1s peak at 286.4 eV. The sample geometry used allowed measurement of a depth of approximately 10 nm of the sample surface. 2.9. Fourier transform infrared spectroscopy (FTIR) FTIR analysis of the composition of the surface groups for initial and oxidized DND samples was performed using a Thermo Electron Nicolet 8700 FTIR spectrometer (ThermoScientific, Madison, WI, USA). For FTIR measurements, ~10 mg of the DND samples was mixed with ~300 mg of KBr powder, pressed into pellets 0.5–0.7 mm thick and measured in transmission mode in a N2-purged chamber. The KBr used for the pellets was stored desiccated under N2 and the pellets were prepared immediately before analysis. A pure KBr pellet was used to generate the background spectrum. 3. Results and discussion We followed the experimental conditions described by Osswald et al. [5] to generate air oxidized DND (AO-DND). As shown in Fig. 1, comparison of the Raman spectra of AO-DND heated at 375–425 °C for 5 h with those of the untreated DND and a reference high-pressure high-temperature (HPHT) monocrystalline nanodiamond material with 100 nm particle size (ND) showed temperature-dependent changes consistent with a loss of surface sp2-bonded carbon (~1600 cm−1) and an accompanying increase in the relative strength of the diamond peak at ~1325 cm−1. After 2 h of heating at 450 °C there were appreciable mass losses suggestive of DND combustion. These analyses confirmed the effectiveness of heating in air as a method to remove nondiamond carbon from the surface of the DND. We have reported previously that acute exposure to non-cytotoxic levels of DND induces a marked increase in the expression of the gene encoding the chemokine interleukin 8 (IL-8) by cultured human airway epithelial cells (HAECs) [11]. We therefore used mRNA levels of IL-8 as an indicator of the inflammogenic potency of AO-DND using DND as a reference in this study. Exposure of HAEC to 114 μg/ml (30 μg/cm2) of AO-DND generated at temperatures ranging from 375 to 425 °C for 5 h resulted in levels of IL-8 expression that were significantly reduced relative to the levels induced by exposure to the starting (untreated) DND (Fig. 2A). These data provided a correlation between the loss of
non-diamond carbon from the DND surface and its inflammogenicity. Further studies in which the duration of heating of the DND was varied showed that a heating period as short as 5 min resulted in a 40% reduction in bioactivity towards HAEC (data not shown). Such short heating periods, however, were not sufficient to produce changes in the Raman spectra of AO-DND relative to DND (data not shown). Our previous study showed that the molecular mechanism that mediates DND-induced IL-8 gene expression in HAEC involves oxidative stress presented by reactive oxygen species (ROS), specifically H2O2 as an effector molecule, and that the activity of the DND is not extractable, implying that it is an intrinsic property of the surface of the particle [11]. Given the evidence of ROS involvement in the bioactivity of DND, in the present study we investigated the role of surface oxygen content on DND bioactivity by heating it in an atmosphere containing 100% nitrogen at 425 °C to generate a sample of annealed DND (N2-DND). In contrast to cells treated with AO-DND, the level of IL-8 mRNA in HAEC exposed to N2-DND was not reduced from that induced by DND (Fig. 2B and Table 1), indicating that the availability of O2 during heating is required to effect the loss of inflammogenic potency of the DND surface and thus suggesting a role of oxygen-containing functional groups in the toxicity of DND. Given the aforementioned mechanistic involvement of ROS in the toxicity of DND that we reported previously, we measured the content of unpaired electrons on the nanodiamond particles using electron paramagnetic resonance spectroscopy (EPR). Compared to DND, the EPR signal strength for AO-DND was reduced by ~65%, indicating that air oxidation decreased the radical concentration of the nanodiamond (Fig. 3). Heating in anoxic conditions was somewhat less effective in diminishing the concentration of unpaired electrons associated with DND, with N2-DND showing a ~47% reduction in EPR signal strength relative to that in DND (Table 1). An implication of these EPR data is that heat treatment of the particles can drive free radical quenching on the surface of the DND due to surface reconstruction. However, given that the changes in the inflammogenic potency of DND changed significantly with the same air oxidation treatment that resulted in only a modest decrease in the unpaired electron concentration, other surface characteristics may be more important contributors to the inflammogenicity of DND. Zeta potential, defined as the electrical potential between the layer of fluid around a particle and the medium in which it is suspended, has been shown to be a marker of the bioactivity of nanomaterials of various types [13]. A positive charge is generally associated with increased particle cytotoxicity when compared to particles with the
R. Silbajoris et al. / Diamond & Related Materials 58 (2015) 16–23
21
Fig. 5. FTIR spectra of the starting and heated DND. DND (A), DND heated for 1 h in Air (B) and in N2 (C). Inset (D) shows detail corresponding to the 1400–2000 cm−1 region for the three DND samples. Signal intensity scales were adjusted for clarity. All spectra are raw values with background subtracted.
22
R. Silbajoris et al. / Diamond & Related Materials 58 (2015) 16–23
same composition bearing a neutral or anionic surface charge [14–16]. Positive charges on a wide variety of particle compositions have been shown to interact strongly with membrane components, leading to bilayer thinning, erosion and perforation, and potentially altering membrane permeability irreparably [17]. The zeta potential of the starting DND particles was found to be strongly positive and remained unchanged by heating under anoxic conditions for 1–5 h. In contrast, the presence of air during heating for 1 or 5 h resulted in highly negative values of the zeta potential of AO-DND (Table 1). We further investigated the predictive value of zeta potential as a marker of DND bioactivity by analyzing the statistical correlation between surface charge and IL-8 mRNA levels induced by exposure of HAEC to a total of 14 different nanodiamond preparations. As shown in Fig. 4, nanodiamond zeta potentials clustered in two groups between − 26 mV to − 50 mV and + 35 mV to + 47 mV, and zeta values were significantly correlated with the magnitude of IL-8 expression by HAEC. A limitation of using IL-8 transcript levels as a readout of bioactivity is that the dynamic range of the response of the cells, which is a function of the activity of intracellular signaling processes that regulate transcriptional expression and the half-life of the mRNA, is not defined in this study. Nonetheless, the fact that we observed a statistically significant positive correlation between the zeta potential value of DND and its potency in inducing elevations in IL-8 mRNA levels in HAEC supports a role for surface charge in activating a pro-inflammatory cellular response to DND exposure. The carbon and oxygen content of the starting and heated nanodiamond particles was analyzed by X-ray photoelectron spectroscopy (XPS). As seen in Table 1, a comparison of the mass concentration of C and O values for DND and AO-DND prepared by heating in air for 1–5 h showed a significant increase in the relative content of oxygen, while the O concentration in N2-DND particles produced by heating in N2 for 1–5 h showed a slight decrease in comparison to the starting material. Heating DND in an inert atmosphere or vacuum causes thermal decomposition and desorption of the surface groups, where specific groups desorb within specific temperature intervals [18,19]. For example, carboxylic groups are released from the DND surface during heating between approximately 200 °C and 400 °C. At 400 °C some fraction of lactones and acid anhydride groups can also be lost from the DND surface. There are two processes that can occur during heating in an inert atmosphere: (i) the condensation of different oxygen-containing groups with release of water molecules, and (ii) the decomposition of acidic groups (carboxyl, anhydride, and lactone groups) releasing CO2 and CO. The slight decrease of the oxygen content (Table 1) after heating at 400 °C in N2 probably reflects decomposition of carboxylic groups. However, it can be assumed that the majority of the O-containing groups in the starting sample are the more thermally stable hydroxylic, ketonic and ether groups. FTIR spectroscopy was also used to characterize changes in the content of functional groups in the DNDs subjected to air oxidation or heating in nitrogen. As Fig. 5 shows, the FTIR spectrum in the region of 1500–1900 cm− 1 demonstrates pronounced peaks for the starting DND that are indicative of the presence of hydroxyl and carbonyl groups (1630 and 1730 cm−1, respectively). Heating of DND for 1 h in the presence of air to generate AO-DND produced major changes in the FTIR spectrum consistent with the formation of lactones and carboxylic acid anhydrides (~1820 cm−1). Air oxidation of the DND resulted in a shift in the carbonyl peak suggestive of the formation of lactones and acid anhydrides that were detectable in the FTIR spectrum by 5 min of heating (data not shown). In contrast, the carbonyl peak in the spectrum for N2-DND is located in the same position as that of DND (~1720 cm−1, Fig. 5). These data are largely in agreement with the findings of Osswald et al. [5], showing that air oxidation induces rapid production of carbonyl species on DND associated with the formation of lactones and acid anhydrides, at the apparent expense of carbonyl within keto, aldehyde and ester groups. Air oxidation results in changes in the speciation of C–O groups on the surface of DND that are accompanied by a reduction in
inflammogenic activity towards HAEC. The shift in zeta potential likely reflects the changes in oxygenated surface moieties seen in AO-DND and may represent a fundamental determinant that underlies the loss of bioactivity induced by heating DND in the presence of air. Loss of surface radicals may also contribute to this decrease. The present findings demonstrating correlation between changes in the composition of the oxygen-containing surface groups of DND with the loss of bioactivity reveal an important link between the toxicity of DND and the content of its specific oxygen-containing moieties. Additional investigation is needed to identify specific functional groups that are responsible for the toxicity of DND preparations, and to elucidate molecular mechanisms through which adverse cellular responses to carbonaceous nanomaterials are initiated in HAEC. Prime novelty statement The subject of this study bridges an unusually wide distance between chemistry and biology. It follows on a 2009 study which we published in Nanotoxicology, describing in detail the intracellular mechanism through which nanodiamonds induce inflammatory responses in human lung cells. In the present study, the objective was to identify chemical determinants of the toxicity of a nanodiamond preparation in the human respiratory epithelium. Rather than use an immortalized cell line, in this study we took the challenge of using primary cultures of human bronchial epithelial cells in order to maximize the relevance and extrapolation value of the data to human health. This study addresses the toxicity of nanodiamonds and may also be generalizable to the bioactivity of other carbonaceous materials present in the air in environmental and occupational settings. Acknowledgments The authors are indebted to Drs. M. Carraway and A. Ghio for their procurement of the human airway epithelial cells, to Dr. V. Vaijayanthimala for her technical assistance with the Raman spectroscopy analyses, to Mr. Andrew Vargas for the Zeta potential measurements and to Mr. Craig Hemann for the EPR analyses. The input of Dr. Carrie Donley of the Chapel Hill Analytical and Nanofabrication Laboratory and Dr. Mark Walters of the Shared Materials Instrumentation Facility at Duke University is also gratefully acknowledged. References [1] V.N. Mochalin, O. Shenderova, D. Ho, Y. Gogotsi, The properties and applications of nanodiamonds, Nat. Nanotechnol. 7 (1) (2012) 11–23. [2] O.A. Shenderova, D.M. Gruen, Ultrananocrystalline Diamond Synthesis, Properties and Applications, William Andrew, 2006. [3] V.Y. Dolmatov, Detonation synthesis ultradispersed diamonds: properties and applications, Usp. Khim. 70 (2001) 687–708. [4] O. Shenderova, A. Koscheev, N. Zaripov, I. Petrov, Y. Skryabin, P. Detkov, S. Turner, G. Van Tendeloo, Surface chemistry and properties of ozone-purified detonation nanodiamonds, J. Phys. Chem. C 115 (20) (2011) 9827–9837. [5] S. Osswald, G. Yushin, V. Mochalin, S.O. Kucheyev, Y. Gogotsi, Control of sp2/sp3 carbon ratio and surface chemistry of nanodiamond powders by selective oxidation in air, J. Am. Chem. Soc. 128 (35) (2006) 11635–11642. [6] Y. Yuan, Y. Chen, J.-H. Liu, H. Wang, Y. Liu, Biodistribution and fate of nanodiamonds in vivo, Diam. Relat. Mater. 18 (1) (2009) 95–100. [7] Y. Yuan, X. Wang, G. Jia, J.-H. Liu, T. Wang, Y. Gu, S.-T. Yang, S. Zhen, H. Wang, Y. Liu, Pulmonary toxicity and translocation of nanodiamonds in mice, Diam. Relat. Mater. 19 (4) (2010) 291–299. [8] A.M. Schrand, H. Huang, C. Carlson, J.J. Schlager, E. Omacr Sawa, S.M. Hussain, L. Dai, Are diamond nanoparticles cytotoxic? J. Phys. Chem. B 111 (1) (2007) 2–7. [9] Y. Xing, W. Xiong, L. Zhu, E. Osawa, S. Hussin, L. Dai, DNA damage in embryonic stem cells caused by nanodiamonds, ACS Nano 5 (3) (2011) 2376–2384. [10] J. Wehling, R. Dringen, R.N. Zare, M. Maas, K. Rezwan, Bactericidal activity of partially oxidized nanodiamonds, ACS Nano 8 (6) (2014) 6475–6483. [11] R. Silbajoris, J.M. Huang, W.-Y. Cheng, L. Dailey, T.L. Tal, I. Jaspers, A.J. Ghio, P.A. Bromberg, J.M. Samet, Nanodiamond particles induce I1-8 expression through a transcript stabilization mechanism in human airway epithelial cells, Nanotoxicology 3 (2) (2009) 152–160. [12] N. Petrova, A. Zhukov, F. Gareeva, L. Kooscheev, I. Petrov, O. Shenderova, Interpretation of electrokinetic measurements of nanodiamond particles, Diam. Relat. Mater. 30 (2012) 62–69.
R. Silbajoris et al. / Diamond & Related Materials 58 (2015) 16–23 [13] A.E. Nel, L. Madler, D. Velegol, T. Xia, E.M. Hoek, P. Somasundaran, F. Klaessig, V. Castranova, M. Thompson, Understanding biophysicochemical interactions at the nano-bio interface, Nat. Mater. 8 (7) (2009) 543–557. [14] X.Z. Wang, Y. Yang, R. Li, C. McGuinnes, J. Adamson, I.L. Megson, K. Donaldson, Principal component and causal analysis of structural and acute in vitro toxicity data for nanoparticles, Nanotoxicology 8 (5) (2013) 465–476. [15] V. Kasturirangan, B.M. Nair, M.T. Kariapper, W.G. Lesniak, W. Tan, R. Bizimungu, P. Kanter, K. Toth, S. Buitrago, Y.M. Rustum, A. Hutson, L.P. Balogh, M.K. Khan, In vivo toxicity evaluation of gold–dendrimer composite nanodevices with different surface charges, Nanotoxicology 7 (4) (2013) 441–451. [16] A. Lankoff, M. Arabski, A. Wegierek-Ciuk, M. Kruszewski, H. Lisowska, A. BanasikNowak, K. Rozga-Wijas, M. Wojewodzka, S. Slomkowski, Effect of surface
23
modification of silica nanoparticles on toxicity and cellular uptake by human peripheral blood lymphocytes in vitro, Nanotoxicology 7 (3) (2013) 235–250. [17] P.R. Leroueil, S.A. Berry, K. Duthie, G. Han, V.M. Rotello, D.Q. McNerny, J.R. Baker Jr., B.G. Orr, M.M. Holl, Wide varieties of cationic nanoparticles induce defects in supported lipid bilayers, Nano Lett. 8 (2) (2008) 420–424. [18] A.P. Kosheev, Thermodesorption mass spectrometry in the light of solution of the problem of certification and unification of the surface properties of detonation nanodiamonds, Russ. J. Gen. Chem. 79 (2009) 2033–2044. [19] V.L. Kuznetsov, Y.V. Butenko, Diamond Phase Transitions at Nanoscale, in: O. Shenderova, D.M. Gruen (Eds.), Ultrananocrystalline Diamond, Second ed.Elsevier 2012, pp. 181–244.