- Email: [email protected]
Development and application of an indirect ELISA for the detection of antibodies to novel duck reovirus
G Model
ARTICLE IN PRESS
VIRMET 12776 1–5
Journal of Virological Methods xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Development and application of an indirect ELISA for the detection of antibodies to novel duck reovirus
1
2
3 4 5 6
Q1
Tao Yun a , Haipeng Chen b , Bin Yu a , Cun Zhang a,∗ , Liu Chen a , Zheng Ni a , Jionggang Hua a , Weicheng Ye a a b
Institute of Animal Husbandry and Veterinary Sciences, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China College of Animal Science and Veterinary Medicine, Shandong Agricultural University, Tai’an 271018, China
7
a b s t r a c t
20 8 9 10 11 12 13
Article history: Received 14 January 2015 Received in revised form 7 April 2015 Accepted 10 April 2015 Available online xxx
14
19
Keywords: Novel duck reovirus (N-DRV) C protein Indirect ELISA Serological survey
21
1. Introduction
15 16 17 18
A novel duck reovirus (N-DRV) disease emerged in China in 2000 and it has become an epidemic genotype. A test for detection of virus-specific antibodies in serum samples would be useful for epidemiological investigations. Currently, Currently, serological assays for N-DRV diagnosis are not available. A test for detection of virus-specific antibodies in serum samples would be useful for epidemiological investigations. In this study, a highly sensitive and specific indirect enzyme-linked immunosorbent assay (ELISA) for the detection of antibodies to N-DRV was developed. The outer capsid (C) of N-DRV was cloned and expressed in Escherichia coli as a coating antigen. The antigen concentration and serum dilution were optimized using a checkerboard titration. Furthermore, the specificity of C-ELISA assay was confirmed by cross checking with other duck viral pathogens. In comparison with the western blot, the sensitivity and specificity of the C-ELISA was 92.6% and 88.9%, respectively, and agreement of two tests was excellent with value of 0.786 (p < 0.05). A serological survey was performed using the assay on serum samples from different age and species of duck flocks in the Zhejiang and Jiangsu Province, China. The seropositive rate of the 1209 serum samples was 57.7%. In conclusion, the developed C-ELISA assay is a very specific and sensitive test that will be useful for large-scale serological survey in N-DRV infection and monitoring antibodies titers against N-DRV. © 2015 Published by Elsevier B.V.
Muscovy duck reovirus (DRV), a member of the Orthoreovirus genus of the Reoviridae family, is an important aquatic bird 23 pathogen. The DRV contains 10 double-stranded RNA (dsRNA) 24 genome segments which can be separated into three size classes, 25 designated large segments (L1, L2, and L3), medium segments (M1, 26 M2, and M3) and small segments (S1, S2, S3, and S4), on the basis of 27 28Q2 their electrophoretic mobilities (Kuntz-Simon et al., 2002; Ma et al., 2012; Wang et al., 2012; Yun et al., 2013, 2014). The DRV genome 29 encodes for at least 12 primary proteins, including 10 structural 30 proteins and 4 nonstructural proteins. 31 Disease associated with classical Muscovy duck reovirus 32 (MDRV) was initially described in South Africa in 1950 (Kaschula, 33 1950) and the virus was isolated in France in 1972 (Gaudry 34 22
∗ Corresponding author at: Institute of Animal Husbandry and Veterinary Sciences, Zhejiang Academy of Agricultural Sciences, 145 Shiqiao Road, Hangzhou 310021, China. Tel.: +86 571 8640 4182; fax: +86 571 8640 0836. E-mail address: [email protected] (C. Zhang).
et al., 1972). Classical MDRV mainly affects Muscovy ducklings and goslings between 2 and 4 weeks of age with high morbidity and a mortality rate ranging from 10 to 50%. The disease is characterized by general weakness, diarrhea, growth retardation, pericarditis, swollen liver and spleen covered with small white necrotic foci, for which the disease was named Muscovy duck white spot disease/flower liver disease in China (Gaudry et al., 1972; Malkinson et al., 1981; Marius-Jestin et al., 1988; Yun et al., 2014). Since 2000, a novel duck reovirus (N-DRV) disease emerged in the Southeast provinces (the major duck-producing regions) of China, including Zhejiang, Fujian and Guangdong. It was reported that the disease could affect different duck breed (including Muscovy duckling, duckling, and domesticated wild duckling) and gosling, and the disease was characterized mainly by hemorrhagicnecrotic lesions in the liver and spleen (Chen et al., 2012; Wang et al., 2012; Yun et al., 2012, 2013, 2014). The complete sequences of the 10 genome segments of N-DRV have recently been completely determined, and the segment sequence analyses revealed that the S1 segment of N-DRV contains three sequential overlapping ORFs, encoding p10, p18 and C. The encoded N-DRV S1 segment is similar to avian reovirus (ARV), but completely different from classical
http://dx.doi.org/10.1016/j.jviromet.2015.04.012 0166-0934/© 2015 Published by Elsevier B.V.
Please cite this article in press as: Yun, T., et al., Development and application of an indirect ELISA for the detection of antibodies to novel duck reovirus. J. Virol. Methods (2015), http://dx.doi.org/10.1016/j.jviromet.2015.04.012
35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55
G Model VIRMET 12776 1–5
T. Yun et al. / Journal of Virological Methods xxx (2015) xxx–xxx
2 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88
MDRV, in which the p10 and C proteins are encoded by S4, the smallest genome segment, and there is no encoding for p18 (Ma et al., 2012; Wang et al., 2012; Yun et al., 2012, 2013, 2014). The pathogenicity of N-DRV differs from that of classical MDRV and ARV, and cross-neutralization tests demonstrated that N-DRV does not cross-react with classical MDRV and ARV (Chen et al., 2011). Several diagnostic methods have been developed for the detection of DRV antigen and antibody. A B-C ELISA method based on detection of antibodies to classical MDRV from Muscovy duck serum has been described (Zhang et al., 2007). One tube PCR method has been developed for the detection of DRV, ARV, and goose reovirus (GRV) infection (Zhang et al., 2006). These methods were however incapable of accurately detecting N-DRV antigen and antibody in ducks. The main reason is extensive sequence divergence of genome segments between classical MDRV and N-DRV, especially S-class genome segments which encode B, C proteins (Yun et al., 2013, 2014; Wang et al., 2012). Currently, there are no reports on serological methods for monitoring antibodies to NDRV infection in duck flocks. PCR is useful for identifying N-DRV infections (Ye et al., 2014), but a test for detecting virus-specific antibodies in serum would be a more convenient method for epidemiological investigation. In addition, the neutralization test is not suitable for large scale screening of N-DRV infection due to time and labor constraints. The aim of this study was to develop a rapid and simple method for massive screening N-DRV infection and the evaluation of vaccination level. To provide a suitable antigen for a diagnostic test, the expression and purification of the recombinant C protein of N-DRV (ZJ00M) in Escherichia coli are described. An indirect ELISA for detecting N-DRV-specific antibodies was developed using the purified recombinant C protein as a coating antigen. The specificity of this assay was validated, and the usefulness of the test was evaluated.
89
2. Materials and methods
90
2.1. Virus propagation
91 92 93 94 95 96 97 98 99 100 101
102
103 104 105 106 107 108 109 110 111 112 113 114
ARTICLE IN PRESS
Novel duck reovirus strain ZJ00M was isolated from the liver of muscovy duck with hemorrhagic-necrotic in 2000, as described previously (Yun et al., 2012, 2013). Briefly, the virus was inoculated into chicken embryo fibroblast (DF-1) monolayers or the chorioallantoic cavity of 10-day-old Pekin duck embryos. Embryonic viability was monitored daily for 5 days. The cell cultures were examined every other day for 3 days for viral cytopathic effect (CPE) with an inverted stereoscopic microscope. The cells were freezethawed three times, cellular debris was removed by low-speed centrifugation, and the supernatant fluid was stored at −80 ◦ C for the following experiments.
2.2. Virus purification Firstly, the virus suspension (crude extract) was centrifuged at 10,000 × g for 30 min at 4 ◦ C to remove the cellular debris. Secondly, the resultant supernatant was precipitated with 50% saturated ammonium sulfate at 4 ◦ C. The precipitate was collected by centrifugation at 10,000 × g for 20 min and suspended in the buffer consisting of 0.02 M Tris (pH 7.0), 0.001 M EDTA, and 0.15 M NaCl, this virus buffer was then ultracentrifuged for 3 hr at 130,000 × g in a Beckman SW70 rotor at 4 ◦ C on a 40% sucrose cushion (W/V, prepared with PBS). The virions were removed and pelleted for RNA extraction using Trizol reagent (Invitrogen, Life Technologies, Carlsbad, CA) followed by ethanol precipitation. Viral RNA was dissolved in DEPC H2 O and quantified by spectrophotometry at OD260 nm.
2.3. pET28-C construction, C fusion protein expression, and protein purification Primers to the C-encoding gene (N-DRV-SigC F 5 ACACCATGGATCGCAACGAGGTG ATACGCCTG-3 and N-DRV-SigC R 5 -ATACTCGAGGCCCGTGGCGACGGTGAAGCGTAA-3 ), respectively introducing NcoI and XhoI restrictions sites (shown underlined) were designed using Oligo 6.24 (Molecular Biology Insights, Inc.) based on conserved nucleotide sequence from previously reported N-DRV (Yun et al., 2013). The C gene was amplified by PrimeScript one step RT-PCR kit (TaKaRa Biotechnology (Dalian) Co. Ltd.), as described previously (Yun et al., 2012, 2013). Firstly, purified double-stranded RNA (2 l) was denatured in 95 ◦ C for 5 min in the presence of primer N-DRV-SigC F and N-DRV-SigC R, chilled on ice for 2 min, and then used as a template to generate cDNA. One-step RT-PCR was performed in accordance with the manufacture’s instructions. The amplified products were separated on a 1% agarose gel and a 963 bp size fragment was excised and purified with gel extraction kit (TaKaRa Biotechnology (Dalian) Co. Ltd). The 963 bp PCR product was cloned into the NcoI and XhoI sites of pET-28a (+) vector (Novagen, Madison, WI, USA). The correct orientation of the insert was confirmed by nucleotide sequencing. The plasmid was then transformed into E. coli BL21 (DE3) (Invitrogen, CA, USA). Positive clones were selected for large-scale production and purification. The expressed C protein was purified by using the Ni-NTA kit (Novagen, Madison, USA). The total amount of protein in the crude extract was quantified using the Quawell protein assay (Quawell Technology, CA, USA). 2.4. Duck serum N-DRV-antibody-positive sera were obtained from 10 SPF Muscovy ducks which were infected experimentally at 8 weeks of age by intramuscular injection with 106.5 TCID50 N-DRV ZJ00M particles. Negative sera (n = 90) were collected from SPF ducks. The duck studies were approved by the Animal Care and Use Committee of Institute of Animal Husbandry and Veterinary Sciences, Zhejiang Academy of Agricultural Sciences, and were carried out in accordance with the regulations and guidelines of the National Institutes of Health. Anti-serum against duck Tembusu Virus (DTMUV), classical MDRV, Muscovy Parovirus (DPV), H5N1 and H9N2 avian influenza virus (AIV), type I duck hepatitis virus (DHV-1) and Riemerella anatipestifer (RA) were acquired by the Institute of Animal Husbandry and Veterinary Sciences, Zhejiang Academy of Agricultural Sciences, and used to test the specificity of indirect ELISA. 2.5. SDS–PAGE and Western blotting assays Expression of the recombinant fusion protein was confirmed by 10% sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS–PAGE) and Western blot analysis according to the standard protocol (Sambrook and Russell, 2001). Briefly, the proteins were separated by SDS–PAGE and then the gels were stained with Coomassie brilliant blue. For immunoblotting, the separated proteins were electrotransferred to Ployvinglidene Fluoride (PVDF) membrane (BioRad, Hercules, CA, USA) by semi-dry electroblotting. The membrane was blocked with 5% non-fat dry milk in PBS for overnight at 4 ◦ C, and then was washed with PBS buffer containing 0.05% Tween-20 (PBST) three times, and incubated subsequently with duck hyperimmune sera against N-DRV (diluted 1:1000) in PBST for 1 h at 37 ◦ C. After several times of PBST buffer washing, the membrane was incubated with mice anti-duck immunoglobulin MoAb conjugated with horseradish peroxidase at a 1:5000 dilutions for 1 h at 37 ◦ C. Specify the buffer in which it was diluted. After washing, the membrane was incubated with the substrate
Please cite this article in press as: Yun, T., et al., Development and application of an indirect ELISA for the detection of antibodies to novel duck reovirus. J. Virol. Methods (2015), http://dx.doi.org/10.1016/j.jviromet.2015.04.012
115 116
117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141
142
143 144 145 146 147 148 149 150 151 152 153 154 155 156 157
158
159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175
G Model VIRMET 12776 1–5
ARTICLE IN PRESS T. Yun et al. / Journal of Virological Methods xxx (2015) xxx–xxx
176 177
178
179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212
3,3 -diaminobenzidine tetrahydrochloride (20 ml 0.1 M Ph 7.4 TrirHCL, 20 mg DAB, and 0.005% H2 O2 ).
2.6. Development of C-indirect ELISA assay The optimal dilution of antigen and serum were determined by a checker board titration with duck N-DRV-positive and -negative sera. The purified recombinant fusion proteins diluted in 0.05 M carbonate buffer (pH 9.6) were coated separately in 96-well plates ranging from 0.185 to 5 g/ml. The dilutions of chicken serum samples were ranged from 1:25 to 1:400. Both reference positive and negative sera were diluted serially 2-fold and tested in separate plates. The optimal antigen concentration and serum dilution were determined to be those when the greatest ratio of OD450 nm values between the positive and the negative serum (P/N) were obtained. These parameters were subsequently used in this study. Each well of the plates was coated with different concentrations of antigens in 100 l of coating buffer at 4 ◦ C for 18 h and then washed three times with PBST (0.01 M PBS, pH 7.2, 0.05% Tween 20). For blocking, 100 l 5% non-fat milk was added to each well at room temperature for 1 h, and then washed three times with PBST. 100 l of serum samples were diluted and added into each well and incubated for 1 h at 37 ◦ C. After washing three times with PBST, 100 l of mouse anti-duck immunoglobulin MoAb conjugated with horseradish peroxidase (HRP) diluted by 1:1000 in the blocking buffer were added for detection of the bound antibodies, incubated for 1 h at 37 ◦ C, and followed by three washes with PBST. The reactions were detected with 100 l substrate solution containing TMB (3,3 , 5,5 -tetramethylbenzidine) for 10 min at room temperature, and then reaction was stopped by adding 100 l of 2 M H2 SO4 . The OD values were measured at 450 nm using an ELISA microplate reader (Bio-Rad, CA, USA). The OD of each serum was expressed as the ratio of OD450 of a sample to that of a negative control (P/N) calculated based on the negative control serum in each microplate, in order to minimize variation between plates. The P/N was calculated according to the formula: P/N = OD test serum/OD negative control serum. The cut-off point was calculated based on the formula: the cut-off point = the mean of the negative serum OD value + 3 standard deviation (S.D.).
3
2.7. Comparison of C-ELISA with the Western blotting test To validate the developed C-ELISA assay as a clinical diagnostic tool, the correlation between Western blot and the C-ELISA was tested using 72 duck serum samples. Serum samples were obtained from different farms in 2013. Twenty-four samples were from one flock of 40-day-old Muscovy ducks, the duck flock had been naturally infected N-DRV, and the infection was confirmed by RT-PCR; thirty-two serum samples were from two flocks of Muscovy ducks aged between 40 and 60 weeks at 6-weeks’ post-N-DRV vaccination; the other 16 samples were from a flock in an epidemic region for N-DRV. 2.8. Field application of C-ELISA in clinical samples During 2013–2014, 1209 clinical serum samples of different duck breed and age, including Muscovy duck, Shaoxing duck, Cherry Valley duck, Pekin duck etc., were collected from duck farms in the Zhejiang and Jiangsu Province of China, and birds were not vaccinated with an inactivated N-DRV vaccine. Data on the disease history of these ducks were not available. 3. Results 3.1. Cloning, expression, and identification of the C-encoding gene The sequence of the C gene was amplified by RT-PCR, obtained an expected band in size of 981 bp, and was inserted into the plasmid were verified by DNA sequencing analysis pET-28a (+), confirmed by DNA sequencing and by double digestion with NcoI and XhoI (data not shown). The recombinant plasmid pET28-C was transformed into the E. coil strain BL21 (DE3), and the recombinant C protein was expressed successfully as an insoluble and His-tagged fusion protein. The fusion protein was purified using a Ni-NTA His Bind resin column and identified to be approximately 36 kDa by SDS–PAGE analysis (Fig. 1A), which was consistent with the expected size of the C protein. The antigenicity of the recombinant C protein was confirmed by measuring its interaction with duck serum samples which were positive for reactive antibodies to
Fig. 1. The expressed N-DRV C protein analysis by SDS–PAGE and Western blot. (A) 10% SDS–PAGE analysis of the His-tagged C fusion protein expressed by pET28-C/BL21 (DE3). Lane M, prestained protein molecular weight maker; lane 1 and 2, the total cell lysates of pET-28a (+)/BL21 (DE3) before and after IPTG-induction; lanes 3 and 4, the total cell lysates of pET28-C/BL21 (DE3) before and after IPTG-induction; lane 5, the purified His-tagged C fusion protein. (B) Western blot analysis of the His-tagged C fusion protein with a reovirus-specific Muscovy duck antiserum. Lane M, prestained protein molecular weight maker; lane 1, the purified His-tagged C fusion protein pET28-C; lane 2, the whole bacterium lysates of standard BL21 (DE3).
Please cite this article in press as: Yun, T., et al., Development and application of an indirect ELISA for the detection of antibodies to novel duck reovirus. J. Virol. Methods (2015), http://dx.doi.org/10.1016/j.jviromet.2015.04.012
213
214 215 216 217 218 219 220 221 222 223
224
225 226 227 228 229 230
231
232 233
234 235 236 237 238 239 240 241 242 243 244 245 246
G Model
ARTICLE IN PRESS
VIRMET 12776 1–5
T. Yun et al. / Journal of Virological Methods xxx (2015) xxx–xxx
4
Table 1 Presence of antibodies against N-DRV as determined by C-ELISA and Western blot assay on 72 duck serum samples from field. C-ELISAa
Positive (+) Negative (−) Total
Western blot Positive (+)
Negative (−)
Total
50 4 54
2 16 18
52 20 72
Relative sensitivity of C-ELISA vs Western blot = 50 of 54 or 92.6%; relative specificity of C-ELISA vs Western blot = 16 of 18 or 88.9%; value = 0.786. a
247 248 249 250 251
252
253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270
271
272 273 274 275 276 277 278 279 280
281
282 283 284 285 286 287 288 289 290
N-DRV (Fig. 1B). This result indicated that C was the antigenic protein. No N-DRV-specific proteins were detected in lysates derived from pET28a-transformed E. coli cells. This purified protein was dialyzed in renaturation buffer and used as the coating antigen in the indirect ELISA.
3.2. Development of the C-ELISA assay To determine the optimal dilution of coating antigen and working concentration of duck positive serum, a checkerboard titration was performed. The resulted indicated that the optimal dilution of the tested sera and the optimal coating concentration of C protein were found to be 1:100 and 0.078 g/ml, respectively. A good positive/negative (P/N) ratio was obtained by the positive OD value divided by the negative OD value (≥2.1). All experiments were performed in triplicates. Using the 90 negative serum samples from healthy ducks, the mean OD value was 0.161 with a standard deviation of 0.024. Accordingly, the cut-off point of the C-ELISA assay was 0.23 (mean + 3 S.D.). The ten Muscovy duck positive sera infected experimentally N-DRV produced higher OD values ranging from 0.473 to 0.866, the average OD value was 0.687 ± 0.142. No cross-reactions were detected by the C-ELISA using anti-sera against classical MDRV, DHAV-1, MDPV, AIV (H5N1 and H9N2) and RA, and the OD values were in the range of 0.097–0.17. The data indicated that the developed C-ELISA assay possessed high specificity for detection of N-DRV antibodies.
3.3. Comparison of Western blot and C-ELISA The total of 72 serum samples was tested by the C-ELISA in comparison with Western blot. The results showed that 50 samples were classified as positive and 16 samples were classified as negative by both assays, another eight samples presented discordant results between the assays, and the sensitivity and specificity of the C-ELISA was 92.6% and 88.9%, respectively. Agreement of both assays () was 0.786 (p < 0.05) (Table 1). According to the criteria by Landis and Koch (1977), this indicated an excellent agreement between C-ELISA and Western blot.
3.4. Detection of antibodies in field samples The C-ELISA method was applied to the detection of antibodies to N-DRV in additional 1209 clinical serum samples from different duck farms from Zhejiang and Jiangsu Province, China. For young ducks (5–16 weeks), the positive rate of N-DRV was 21.2% (72/339). For adult and breeder ducks (24–50 weeks), the positive rate of NDRV was 72% (626/870). Overall, the positive rate of N-DRV-specific antibodies is 57.7% (698/1209) in duck flocks, and these sera were found positive by ELISA with OD range 0.251–0.889 (mean 0.554; S.D. 0.136).
4. Discussion In China, DRVs have evolved into two different genotypes. One is classical MDRV (genotype I), the other is N-DRV (genotype II). The latter emerged in recent years, and is a currently popular genotype in China (Yun et al., 2013, 2014). There are several notable differences properties between classical MDRV and N-DRV, including different antigenicity by cross-neutralization tests, host species differences, pathogenic properties, protein profiles, electropherotypes, and genomic coding assignments (Yun et al., 2012, 2013, 2014; Wang et al., 2012; Ma et al., 2012; Chen et al., 2011). In genome segments homology, the S-class genome segments and their encoded proteins had the lowest sequence identity among L-, M- and S-class segments. This finding is consistent with previous reports for MRV and ARV species in which the S-class genome segments have been shown to evolve at a greater rate compared to the other segments (Dermody et al., 1991; Liu et al., 2003). This is Q3 likely due to the selective pressures exerted on the -class proteins, especially the cell attachment protein (C), which is located on the surface of the outer capsid. The protein determines tissue-tropism, induces neutralization antibodies, carries serotype specificity, and can agglutinate red blood cells in the case of MRV (Mertens, 2004). Hence, the C protein can be used as a reliable diagnostic antigen for serological diagnosis. In this study, recombinant C protein of N-DRV was first expressed with a 6× His tag at the C-terminal in a prokaryotic system, appeared in the formation of inclusion body. The expressed fusion protein was purified using a Ni-NTA affinity matrix under denaturizing conditions. The western blot analysis showed that the purified C protein possessed a high level of antigenicity and immunogenicity, and could be used as a candidate antigen for detection of anti-N-DRV antibodies raised in the infected ducks. The application of the purified recombinant C protein as a coating antigen to the serological test was validated by developing an indirect ELISA. In the earlier report, it is shown that false-negatives and falsepositives are two crucial factors in indirect ELISA test (Wu et al., 2007). To eliminate the two negative factors, an optimal cut-off value was artificially set. The most widely used method is the “mean + 3 S.D.” value of antibody levels for negatives (He et al., 2013; Pinto et al., 2000). Based on the cut-off value, the antibodies against N-DRV could be detected by using the C-ELISA assay when the positive serum dilution reached 1:800, which implied a high sensitivity for this assay. In the specificity assay, no cross-reactions were found in antisera against other duck viruses and pathogen by the C-ELISA. Furthermore, the inter-assay and intra-assay CVs were all less than 10% (data not shown), it could be concluded that the developed C-ELISA assay has highly repeatability and stability. Kappa statistics were applied to ascertain the concordance between the C-ELISA and Western blot assay, a kappa of 0.786 was obtained, indicating an excellent agreement between two assays. The results indicated that the developed C-ELISA assay in this study can be used to detect N-DRV antibodies instead of using Western blot which is time-consuming. Detection of clinical serum samples in the study showed that the positive rate of N-DRV antibodies was 57.7% in different age and species of ducks, the positive rate of Muscovy duck was significantly higher than that of other ducks (Shaoxing duck, Cherry Valley duck, Pekin duck etc.), and there were higher prevalence of N-DRV in long-term farmed farms, where ducks have been farmed for at least 6 years (data not shown). The results suggested that N-DRV infections are probably endemic in Zhejiang and Jiangsu Province, China. In conclusion, the C-ELISA assay was developed successfully for the detection of antibodies to N-DRV with high levels of sensitivity, specificity and reproducibility. The assay will be useful test for
Please cite this article in press as: Yun, T., et al., Development and application of an indirect ELISA for the detection of antibodies to novel duck reovirus. J. Virol. Methods (2015), http://dx.doi.org/10.1016/j.jviromet.2015.04.012
291
292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355
G Model VIRMET 12776 1–5
ARTICLE IN PRESS T. Yun et al. / Journal of Virological Methods xxx (2015) xxx–xxx
356 357
358 Q4
large-scale serological survey in N-DRV infection and monitoring antibodies titers against N-DRV. Uncited references
360
Giambrone (1980), Heffels-Redmann et al. (1992) and Reed and Muench (1938).
361
Acknowledgments
359
366
This work was supported by grants from the National Natural Science Foundation of China (31302121), the Zhejiang Natural Sciences Foundation (LY13C180002), the Special Fund for Agroscientific Research in the Public Interest (201003012), Ningbo Scientific Research Project (2014C10033).
367
References
362 Q5 363 364 365
368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388
Chen, S.Y., Chen, S.L., Lin, F.Q., Wang, S., Jiang, B., Chen, X.X., Zhu, X.L., Li, Z.L., 2012. The isolation and identification of novel duck reovirus. Chin. J. Virol. 28, 24–230. Chen, Z.Y., Zhu, Y.Q., Li, C.F., Liu, G.Q., 2011. Novel duck reovirus, DRV-TH11, caused Pekin ducks disease in 2011. Emerg. Infect. Dis. 18, 1209–1211. Dermody, T.S., Schiff, L.A., Nibert, M.L., Coombs, K.M., 1991. The S2 gene nucleotide sequence of prototype strain of the three reovirus serotypes: characterization of reovirus core protein 2. J. Virol. 65, 5721–5731. Gaudry, D., Charles, J., Tektoff, J., 1972. A new disease expressing itself by a viral pericarditis in Barbary ducks. C. R. Acad. Sci. 274, 2916–2919. Giambrone, J.J., 1980. Microculture neutralization test for serodiagnosis of three avian viral infections. Avian Dis. 24, 284–287. He, Q., Cheng, A.C., Wang, M.S., Zhu, D.K., Zhou, Y., Jia, R.Y., Chen, S., Chen, Z.L., Chen, X.Y., 2013. Recombinant UL16 antigen-based indirect ELISA for serodiagnosis of duck viral enteritis. J. Virol. Methods 189, 105–109. Heffels-Redmann, U., Müller, H., Kaleta, E.F., 1992. Structural and biological characteristics of reoviruses isolated from Muscovy ducks (Cairina moschata). Avian Pathol. 21, 481–491. Kaschula, V.R., 1950. A new virus disease of the muscovy duck (Cairina moschata (Linn)) present in Natal. J. S. Afr. Vet. Med. Assoc. 21, 18–26. Landis, J.R., Koch, G.G., 1977. An application of hierarchical kappa-type statistics in the assessment of majority agreement among multiple observers. Biometrics 33, 363–374.
5
Liu, H.J., Lee, L.H., Hsu, H.W., Kuo, L.C., Liao, M.H., 2003. Molecular evolution of avian reovirus: evidence for genetic diversity and reassortment of the S-class genome segments and multiple cocirculating lineages. Virology 314 (1), 336–349. Ma, G., Wang, D., Shi, J., Jiang, T., Yuan, Y., Zhang, D.B., 2012. Complete genomic sequence of a reovirus isolate from Pekin ducklings in China. J. Virol. 86, 13137. Malkinson, M., Perk, K., Weisman, Y., 1981. Reovirus infection of young muscovy ducks (Cairina moschata). Avian Pathol. 10, 433–440. Marius-Jestin, V., Lagadic, M., Le Menec, Y., Bennejean, G., 1988. Histological data associated with muscovy duck reovirus infection. Vet. Rec. 123, 32–33. Mertens, P., 2004. The dsRNA viruses. Virus Res. 101, 3–13. Pinto, P.S.A., Vaz, A.J., Germano, P.M.L., Nakamura, P.M., 2000. ELISA test for the diagnosis of cysticercosis in pigs using antigens of Taenia solium and Taenia crassiceps cysticerci. Rev. Inst. Med. Trop. Sao Paulo 42, 71–79. Reed, L.J., Muench, H., 1938. A simple method for estimating fifty percent endpoints. Am. J. Hyg. 27, 493–497. Sambrook, J., Russell, D.W., 2001. Molecular Cloning. A Laboratory Manual, third ed. Cold Spring Harbor Laboratory Press, New York. Wang, D., Xu, F., Ma, G., Zhang, C., Huang, Y., Li, H., Zhang, D.B., 2012. Complete genomic sequence of a new Muscovy duck-origin reovirus from China. J. Virol. 86, 12445. Wu, R., Hu, S., Xiao, Y., Li, Z., Shi, D., Bi, D., 2007. Development of indirect enzymelinked immunosorbent assay with nucleoprotein as antigen for detection and quantification of antibodies against avian influenza virus. Vet. Res. Commun. 31, 631–641. Ye, W.C., Yu, B., Liu, Y.S., Hua, J.G., Yun, T., Zhang, C., 2014. Establishment of universal RT-PCR for detection of Muscovy duck reovirus. Acta Agriculturae Zhejiangensis 23, 1453–1456. Yun, T., Ye, W.C., Ni, Z., Chen, L., Yu, B., Hua, J.G., Zhang, Y., Zhang, C., 2012. A complete genomic sequence of goose-origin reovirus from China. J. Virol. 86, 10257. Yun, T., Yu, B., Ni, Z., Ye, W.C., Chen, L., Hua, J.G., Zhang, C., 2014. Genomic characteristics of a novel reovirus from Muscovy duckling in China. Vet. Microbiol. 168, 261–271. Yun, T., Yu, B., Ni, Z., Ye, W.C., Chen, L., Hua, J.G., Zhang, C., 2013. Isolation and genomic characterization of a classical Muscovy duck reovirus isolated in Zhejiang, China. Infect. Genet. Evolut. 20, 444–453. Zhang, Y., Guo, D.C., Liu, M., Geng, H.W., Hu, Q.L., Liu, Y., Liu, N.H., 2007. Characterization of the (B-encoding genes of Muscovy duck reovirus: (C(B-ELISA for antibodies against duck reovirus in ducks. Vet. Microbiol. 121, 231–241. Zhang, Y., Liu, M., Shuidong, O., Hu, Q.L., Guo, D.C., Chen, H.Y., Han, Z., 2006. Detection and identification of avian, duck, and goose reoviruses by RT-PCR: goose and duck reoviruses are part of the same genogroup in the genus Orthoreovirus. Arch. Virol. 151, 1525–1538.
Please cite this article in press as: Yun, T., et al., Development and application of an indirect ELISA for the detection of antibodies to novel duck reovirus. J. Virol. Methods (2015), http://dx.doi.org/10.1016/j.jviromet.2015.04.012
389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432
ARTICLE IN PRESS
VIRMET 12776 1–5
Journal of Virological Methods xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Development and application of an indirect ELISA for the detection of antibodies to novel duck reovirus
1
2
3 4 5 6
Q1
Tao Yun a , Haipeng Chen b , Bin Yu a , Cun Zhang a,∗ , Liu Chen a , Zheng Ni a , Jionggang Hua a , Weicheng Ye a a b
Institute of Animal Husbandry and Veterinary Sciences, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China College of Animal Science and Veterinary Medicine, Shandong Agricultural University, Tai’an 271018, China
7
a b s t r a c t
20 8 9 10 11 12 13
Article history: Received 14 January 2015 Received in revised form 7 April 2015 Accepted 10 April 2015 Available online xxx
14
19
Keywords: Novel duck reovirus (N-DRV) C protein Indirect ELISA Serological survey
21
1. Introduction
15 16 17 18
A novel duck reovirus (N-DRV) disease emerged in China in 2000 and it has become an epidemic genotype. A test for detection of virus-specific antibodies in serum samples would be useful for epidemiological investigations. Currently, Currently, serological assays for N-DRV diagnosis are not available. A test for detection of virus-specific antibodies in serum samples would be useful for epidemiological investigations. In this study, a highly sensitive and specific indirect enzyme-linked immunosorbent assay (ELISA) for the detection of antibodies to N-DRV was developed. The outer capsid (C) of N-DRV was cloned and expressed in Escherichia coli as a coating antigen. The antigen concentration and serum dilution were optimized using a checkerboard titration. Furthermore, the specificity of C-ELISA assay was confirmed by cross checking with other duck viral pathogens. In comparison with the western blot, the sensitivity and specificity of the C-ELISA was 92.6% and 88.9%, respectively, and agreement of two tests was excellent with value of 0.786 (p < 0.05). A serological survey was performed using the assay on serum samples from different age and species of duck flocks in the Zhejiang and Jiangsu Province, China. The seropositive rate of the 1209 serum samples was 57.7%. In conclusion, the developed C-ELISA assay is a very specific and sensitive test that will be useful for large-scale serological survey in N-DRV infection and monitoring antibodies titers against N-DRV. © 2015 Published by Elsevier B.V.
Muscovy duck reovirus (DRV), a member of the Orthoreovirus genus of the Reoviridae family, is an important aquatic bird 23 pathogen. The DRV contains 10 double-stranded RNA (dsRNA) 24 genome segments which can be separated into three size classes, 25 designated large segments (L1, L2, and L3), medium segments (M1, 26 M2, and M3) and small segments (S1, S2, S3, and S4), on the basis of 27 28Q2 their electrophoretic mobilities (Kuntz-Simon et al., 2002; Ma et al., 2012; Wang et al., 2012; Yun et al., 2013, 2014). The DRV genome 29 encodes for at least 12 primary proteins, including 10 structural 30 proteins and 4 nonstructural proteins. 31 Disease associated with classical Muscovy duck reovirus 32 (MDRV) was initially described in South Africa in 1950 (Kaschula, 33 1950) and the virus was isolated in France in 1972 (Gaudry 34 22
∗ Corresponding author at: Institute of Animal Husbandry and Veterinary Sciences, Zhejiang Academy of Agricultural Sciences, 145 Shiqiao Road, Hangzhou 310021, China. Tel.: +86 571 8640 4182; fax: +86 571 8640 0836. E-mail address: [email protected] (C. Zhang).
et al., 1972). Classical MDRV mainly affects Muscovy ducklings and goslings between 2 and 4 weeks of age with high morbidity and a mortality rate ranging from 10 to 50%. The disease is characterized by general weakness, diarrhea, growth retardation, pericarditis, swollen liver and spleen covered with small white necrotic foci, for which the disease was named Muscovy duck white spot disease/flower liver disease in China (Gaudry et al., 1972; Malkinson et al., 1981; Marius-Jestin et al., 1988; Yun et al., 2014). Since 2000, a novel duck reovirus (N-DRV) disease emerged in the Southeast provinces (the major duck-producing regions) of China, including Zhejiang, Fujian and Guangdong. It was reported that the disease could affect different duck breed (including Muscovy duckling, duckling, and domesticated wild duckling) and gosling, and the disease was characterized mainly by hemorrhagicnecrotic lesions in the liver and spleen (Chen et al., 2012; Wang et al., 2012; Yun et al., 2012, 2013, 2014). The complete sequences of the 10 genome segments of N-DRV have recently been completely determined, and the segment sequence analyses revealed that the S1 segment of N-DRV contains three sequential overlapping ORFs, encoding p10, p18 and C. The encoded N-DRV S1 segment is similar to avian reovirus (ARV), but completely different from classical
http://dx.doi.org/10.1016/j.jviromet.2015.04.012 0166-0934/© 2015 Published by Elsevier B.V.
Please cite this article in press as: Yun, T., et al., Development and application of an indirect ELISA for the detection of antibodies to novel duck reovirus. J. Virol. Methods (2015), http://dx.doi.org/10.1016/j.jviromet.2015.04.012
35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55
G Model VIRMET 12776 1–5
T. Yun et al. / Journal of Virological Methods xxx (2015) xxx–xxx
2 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88
MDRV, in which the p10 and C proteins are encoded by S4, the smallest genome segment, and there is no encoding for p18 (Ma et al., 2012; Wang et al., 2012; Yun et al., 2012, 2013, 2014). The pathogenicity of N-DRV differs from that of classical MDRV and ARV, and cross-neutralization tests demonstrated that N-DRV does not cross-react with classical MDRV and ARV (Chen et al., 2011). Several diagnostic methods have been developed for the detection of DRV antigen and antibody. A B-C ELISA method based on detection of antibodies to classical MDRV from Muscovy duck serum has been described (Zhang et al., 2007). One tube PCR method has been developed for the detection of DRV, ARV, and goose reovirus (GRV) infection (Zhang et al., 2006). These methods were however incapable of accurately detecting N-DRV antigen and antibody in ducks. The main reason is extensive sequence divergence of genome segments between classical MDRV and N-DRV, especially S-class genome segments which encode B, C proteins (Yun et al., 2013, 2014; Wang et al., 2012). Currently, there are no reports on serological methods for monitoring antibodies to NDRV infection in duck flocks. PCR is useful for identifying N-DRV infections (Ye et al., 2014), but a test for detecting virus-specific antibodies in serum would be a more convenient method for epidemiological investigation. In addition, the neutralization test is not suitable for large scale screening of N-DRV infection due to time and labor constraints. The aim of this study was to develop a rapid and simple method for massive screening N-DRV infection and the evaluation of vaccination level. To provide a suitable antigen for a diagnostic test, the expression and purification of the recombinant C protein of N-DRV (ZJ00M) in Escherichia coli are described. An indirect ELISA for detecting N-DRV-specific antibodies was developed using the purified recombinant C protein as a coating antigen. The specificity of this assay was validated, and the usefulness of the test was evaluated.
89
2. Materials and methods
90
2.1. Virus propagation
91 92 93 94 95 96 97 98 99 100 101
102
103 104 105 106 107 108 109 110 111 112 113 114
ARTICLE IN PRESS
Novel duck reovirus strain ZJ00M was isolated from the liver of muscovy duck with hemorrhagic-necrotic in 2000, as described previously (Yun et al., 2012, 2013). Briefly, the virus was inoculated into chicken embryo fibroblast (DF-1) monolayers or the chorioallantoic cavity of 10-day-old Pekin duck embryos. Embryonic viability was monitored daily for 5 days. The cell cultures were examined every other day for 3 days for viral cytopathic effect (CPE) with an inverted stereoscopic microscope. The cells were freezethawed three times, cellular debris was removed by low-speed centrifugation, and the supernatant fluid was stored at −80 ◦ C for the following experiments.
2.2. Virus purification Firstly, the virus suspension (crude extract) was centrifuged at 10,000 × g for 30 min at 4 ◦ C to remove the cellular debris. Secondly, the resultant supernatant was precipitated with 50% saturated ammonium sulfate at 4 ◦ C. The precipitate was collected by centrifugation at 10,000 × g for 20 min and suspended in the buffer consisting of 0.02 M Tris (pH 7.0), 0.001 M EDTA, and 0.15 M NaCl, this virus buffer was then ultracentrifuged for 3 hr at 130,000 × g in a Beckman SW70 rotor at 4 ◦ C on a 40% sucrose cushion (W/V, prepared with PBS). The virions were removed and pelleted for RNA extraction using Trizol reagent (Invitrogen, Life Technologies, Carlsbad, CA) followed by ethanol precipitation. Viral RNA was dissolved in DEPC H2 O and quantified by spectrophotometry at OD260 nm.
2.3. pET28-C construction, C fusion protein expression, and protein purification Primers to the C-encoding gene (N-DRV-SigC F 5 ACACCATGGATCGCAACGAGGTG ATACGCCTG-3 and N-DRV-SigC R 5 -ATACTCGAGGCCCGTGGCGACGGTGAAGCGTAA-3 ), respectively introducing NcoI and XhoI restrictions sites (shown underlined) were designed using Oligo 6.24 (Molecular Biology Insights, Inc.) based on conserved nucleotide sequence from previously reported N-DRV (Yun et al., 2013). The C gene was amplified by PrimeScript one step RT-PCR kit (TaKaRa Biotechnology (Dalian) Co. Ltd.), as described previously (Yun et al., 2012, 2013). Firstly, purified double-stranded RNA (2 l) was denatured in 95 ◦ C for 5 min in the presence of primer N-DRV-SigC F and N-DRV-SigC R, chilled on ice for 2 min, and then used as a template to generate cDNA. One-step RT-PCR was performed in accordance with the manufacture’s instructions. The amplified products were separated on a 1% agarose gel and a 963 bp size fragment was excised and purified with gel extraction kit (TaKaRa Biotechnology (Dalian) Co. Ltd). The 963 bp PCR product was cloned into the NcoI and XhoI sites of pET-28a (+) vector (Novagen, Madison, WI, USA). The correct orientation of the insert was confirmed by nucleotide sequencing. The plasmid was then transformed into E. coli BL21 (DE3) (Invitrogen, CA, USA). Positive clones were selected for large-scale production and purification. The expressed C protein was purified by using the Ni-NTA kit (Novagen, Madison, USA). The total amount of protein in the crude extract was quantified using the Quawell protein assay (Quawell Technology, CA, USA). 2.4. Duck serum N-DRV-antibody-positive sera were obtained from 10 SPF Muscovy ducks which were infected experimentally at 8 weeks of age by intramuscular injection with 106.5 TCID50 N-DRV ZJ00M particles. Negative sera (n = 90) were collected from SPF ducks. The duck studies were approved by the Animal Care and Use Committee of Institute of Animal Husbandry and Veterinary Sciences, Zhejiang Academy of Agricultural Sciences, and were carried out in accordance with the regulations and guidelines of the National Institutes of Health. Anti-serum against duck Tembusu Virus (DTMUV), classical MDRV, Muscovy Parovirus (DPV), H5N1 and H9N2 avian influenza virus (AIV), type I duck hepatitis virus (DHV-1) and Riemerella anatipestifer (RA) were acquired by the Institute of Animal Husbandry and Veterinary Sciences, Zhejiang Academy of Agricultural Sciences, and used to test the specificity of indirect ELISA. 2.5. SDS–PAGE and Western blotting assays Expression of the recombinant fusion protein was confirmed by 10% sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS–PAGE) and Western blot analysis according to the standard protocol (Sambrook and Russell, 2001). Briefly, the proteins were separated by SDS–PAGE and then the gels were stained with Coomassie brilliant blue. For immunoblotting, the separated proteins were electrotransferred to Ployvinglidene Fluoride (PVDF) membrane (BioRad, Hercules, CA, USA) by semi-dry electroblotting. The membrane was blocked with 5% non-fat dry milk in PBS for overnight at 4 ◦ C, and then was washed with PBS buffer containing 0.05% Tween-20 (PBST) three times, and incubated subsequently with duck hyperimmune sera against N-DRV (diluted 1:1000) in PBST for 1 h at 37 ◦ C. After several times of PBST buffer washing, the membrane was incubated with mice anti-duck immunoglobulin MoAb conjugated with horseradish peroxidase at a 1:5000 dilutions for 1 h at 37 ◦ C. Specify the buffer in which it was diluted. After washing, the membrane was incubated with the substrate
Please cite this article in press as: Yun, T., et al., Development and application of an indirect ELISA for the detection of antibodies to novel duck reovirus. J. Virol. Methods (2015), http://dx.doi.org/10.1016/j.jviromet.2015.04.012
115 116
117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141
142
143 144 145 146 147 148 149 150 151 152 153 154 155 156 157
158
159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175
G Model VIRMET 12776 1–5
ARTICLE IN PRESS T. Yun et al. / Journal of Virological Methods xxx (2015) xxx–xxx
176 177
178
179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212
3,3 -diaminobenzidine tetrahydrochloride (20 ml 0.1 M Ph 7.4 TrirHCL, 20 mg DAB, and 0.005% H2 O2 ).
2.6. Development of C-indirect ELISA assay The optimal dilution of antigen and serum were determined by a checker board titration with duck N-DRV-positive and -negative sera. The purified recombinant fusion proteins diluted in 0.05 M carbonate buffer (pH 9.6) were coated separately in 96-well plates ranging from 0.185 to 5 g/ml. The dilutions of chicken serum samples were ranged from 1:25 to 1:400. Both reference positive and negative sera were diluted serially 2-fold and tested in separate plates. The optimal antigen concentration and serum dilution were determined to be those when the greatest ratio of OD450 nm values between the positive and the negative serum (P/N) were obtained. These parameters were subsequently used in this study. Each well of the plates was coated with different concentrations of antigens in 100 l of coating buffer at 4 ◦ C for 18 h and then washed three times with PBST (0.01 M PBS, pH 7.2, 0.05% Tween 20). For blocking, 100 l 5% non-fat milk was added to each well at room temperature for 1 h, and then washed three times with PBST. 100 l of serum samples were diluted and added into each well and incubated for 1 h at 37 ◦ C. After washing three times with PBST, 100 l of mouse anti-duck immunoglobulin MoAb conjugated with horseradish peroxidase (HRP) diluted by 1:1000 in the blocking buffer were added for detection of the bound antibodies, incubated for 1 h at 37 ◦ C, and followed by three washes with PBST. The reactions were detected with 100 l substrate solution containing TMB (3,3 , 5,5 -tetramethylbenzidine) for 10 min at room temperature, and then reaction was stopped by adding 100 l of 2 M H2 SO4 . The OD values were measured at 450 nm using an ELISA microplate reader (Bio-Rad, CA, USA). The OD of each serum was expressed as the ratio of OD450 of a sample to that of a negative control (P/N) calculated based on the negative control serum in each microplate, in order to minimize variation between plates. The P/N was calculated according to the formula: P/N = OD test serum/OD negative control serum. The cut-off point was calculated based on the formula: the cut-off point = the mean of the negative serum OD value + 3 standard deviation (S.D.).
3
2.7. Comparison of C-ELISA with the Western blotting test To validate the developed C-ELISA assay as a clinical diagnostic tool, the correlation between Western blot and the C-ELISA was tested using 72 duck serum samples. Serum samples were obtained from different farms in 2013. Twenty-four samples were from one flock of 40-day-old Muscovy ducks, the duck flock had been naturally infected N-DRV, and the infection was confirmed by RT-PCR; thirty-two serum samples were from two flocks of Muscovy ducks aged between 40 and 60 weeks at 6-weeks’ post-N-DRV vaccination; the other 16 samples were from a flock in an epidemic region for N-DRV. 2.8. Field application of C-ELISA in clinical samples During 2013–2014, 1209 clinical serum samples of different duck breed and age, including Muscovy duck, Shaoxing duck, Cherry Valley duck, Pekin duck etc., were collected from duck farms in the Zhejiang and Jiangsu Province of China, and birds were not vaccinated with an inactivated N-DRV vaccine. Data on the disease history of these ducks were not available. 3. Results 3.1. Cloning, expression, and identification of the C-encoding gene The sequence of the C gene was amplified by RT-PCR, obtained an expected band in size of 981 bp, and was inserted into the plasmid were verified by DNA sequencing analysis pET-28a (+), confirmed by DNA sequencing and by double digestion with NcoI and XhoI (data not shown). The recombinant plasmid pET28-C was transformed into the E. coil strain BL21 (DE3), and the recombinant C protein was expressed successfully as an insoluble and His-tagged fusion protein. The fusion protein was purified using a Ni-NTA His Bind resin column and identified to be approximately 36 kDa by SDS–PAGE analysis (Fig. 1A), which was consistent with the expected size of the C protein. The antigenicity of the recombinant C protein was confirmed by measuring its interaction with duck serum samples which were positive for reactive antibodies to
Fig. 1. The expressed N-DRV C protein analysis by SDS–PAGE and Western blot. (A) 10% SDS–PAGE analysis of the His-tagged C fusion protein expressed by pET28-C/BL21 (DE3). Lane M, prestained protein molecular weight maker; lane 1 and 2, the total cell lysates of pET-28a (+)/BL21 (DE3) before and after IPTG-induction; lanes 3 and 4, the total cell lysates of pET28-C/BL21 (DE3) before and after IPTG-induction; lane 5, the purified His-tagged C fusion protein. (B) Western blot analysis of the His-tagged C fusion protein with a reovirus-specific Muscovy duck antiserum. Lane M, prestained protein molecular weight maker; lane 1, the purified His-tagged C fusion protein pET28-C; lane 2, the whole bacterium lysates of standard BL21 (DE3).
Please cite this article in press as: Yun, T., et al., Development and application of an indirect ELISA for the detection of antibodies to novel duck reovirus. J. Virol. Methods (2015), http://dx.doi.org/10.1016/j.jviromet.2015.04.012
213
214 215 216 217 218 219 220 221 222 223
224
225 226 227 228 229 230
231
232 233
234 235 236 237 238 239 240 241 242 243 244 245 246
G Model
ARTICLE IN PRESS
VIRMET 12776 1–5
T. Yun et al. / Journal of Virological Methods xxx (2015) xxx–xxx
4
Table 1 Presence of antibodies against N-DRV as determined by C-ELISA and Western blot assay on 72 duck serum samples from field. C-ELISAa
Positive (+) Negative (−) Total
Western blot Positive (+)
Negative (−)
Total
50 4 54
2 16 18
52 20 72
Relative sensitivity of C-ELISA vs Western blot = 50 of 54 or 92.6%; relative specificity of C-ELISA vs Western blot = 16 of 18 or 88.9%; value = 0.786. a
247 248 249 250 251
252
253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270
271
272 273 274 275 276 277 278 279 280
281
282 283 284 285 286 287 288 289 290
N-DRV (Fig. 1B). This result indicated that C was the antigenic protein. No N-DRV-specific proteins were detected in lysates derived from pET28a-transformed E. coli cells. This purified protein was dialyzed in renaturation buffer and used as the coating antigen in the indirect ELISA.
3.2. Development of the C-ELISA assay To determine the optimal dilution of coating antigen and working concentration of duck positive serum, a checkerboard titration was performed. The resulted indicated that the optimal dilution of the tested sera and the optimal coating concentration of C protein were found to be 1:100 and 0.078 g/ml, respectively. A good positive/negative (P/N) ratio was obtained by the positive OD value divided by the negative OD value (≥2.1). All experiments were performed in triplicates. Using the 90 negative serum samples from healthy ducks, the mean OD value was 0.161 with a standard deviation of 0.024. Accordingly, the cut-off point of the C-ELISA assay was 0.23 (mean + 3 S.D.). The ten Muscovy duck positive sera infected experimentally N-DRV produced higher OD values ranging from 0.473 to 0.866, the average OD value was 0.687 ± 0.142. No cross-reactions were detected by the C-ELISA using anti-sera against classical MDRV, DHAV-1, MDPV, AIV (H5N1 and H9N2) and RA, and the OD values were in the range of 0.097–0.17. The data indicated that the developed C-ELISA assay possessed high specificity for detection of N-DRV antibodies.
3.3. Comparison of Western blot and C-ELISA The total of 72 serum samples was tested by the C-ELISA in comparison with Western blot. The results showed that 50 samples were classified as positive and 16 samples were classified as negative by both assays, another eight samples presented discordant results between the assays, and the sensitivity and specificity of the C-ELISA was 92.6% and 88.9%, respectively. Agreement of both assays () was 0.786 (p < 0.05) (Table 1). According to the criteria by Landis and Koch (1977), this indicated an excellent agreement between C-ELISA and Western blot.
3.4. Detection of antibodies in field samples The C-ELISA method was applied to the detection of antibodies to N-DRV in additional 1209 clinical serum samples from different duck farms from Zhejiang and Jiangsu Province, China. For young ducks (5–16 weeks), the positive rate of N-DRV was 21.2% (72/339). For adult and breeder ducks (24–50 weeks), the positive rate of NDRV was 72% (626/870). Overall, the positive rate of N-DRV-specific antibodies is 57.7% (698/1209) in duck flocks, and these sera were found positive by ELISA with OD range 0.251–0.889 (mean 0.554; S.D. 0.136).
4. Discussion In China, DRVs have evolved into two different genotypes. One is classical MDRV (genotype I), the other is N-DRV (genotype II). The latter emerged in recent years, and is a currently popular genotype in China (Yun et al., 2013, 2014). There are several notable differences properties between classical MDRV and N-DRV, including different antigenicity by cross-neutralization tests, host species differences, pathogenic properties, protein profiles, electropherotypes, and genomic coding assignments (Yun et al., 2012, 2013, 2014; Wang et al., 2012; Ma et al., 2012; Chen et al., 2011). In genome segments homology, the S-class genome segments and their encoded proteins had the lowest sequence identity among L-, M- and S-class segments. This finding is consistent with previous reports for MRV and ARV species in which the S-class genome segments have been shown to evolve at a greater rate compared to the other segments (Dermody et al., 1991; Liu et al., 2003). This is Q3 likely due to the selective pressures exerted on the -class proteins, especially the cell attachment protein (C), which is located on the surface of the outer capsid. The protein determines tissue-tropism, induces neutralization antibodies, carries serotype specificity, and can agglutinate red blood cells in the case of MRV (Mertens, 2004). Hence, the C protein can be used as a reliable diagnostic antigen for serological diagnosis. In this study, recombinant C protein of N-DRV was first expressed with a 6× His tag at the C-terminal in a prokaryotic system, appeared in the formation of inclusion body. The expressed fusion protein was purified using a Ni-NTA affinity matrix under denaturizing conditions. The western blot analysis showed that the purified C protein possessed a high level of antigenicity and immunogenicity, and could be used as a candidate antigen for detection of anti-N-DRV antibodies raised in the infected ducks. The application of the purified recombinant C protein as a coating antigen to the serological test was validated by developing an indirect ELISA. In the earlier report, it is shown that false-negatives and falsepositives are two crucial factors in indirect ELISA test (Wu et al., 2007). To eliminate the two negative factors, an optimal cut-off value was artificially set. The most widely used method is the “mean + 3 S.D.” value of antibody levels for negatives (He et al., 2013; Pinto et al., 2000). Based on the cut-off value, the antibodies against N-DRV could be detected by using the C-ELISA assay when the positive serum dilution reached 1:800, which implied a high sensitivity for this assay. In the specificity assay, no cross-reactions were found in antisera against other duck viruses and pathogen by the C-ELISA. Furthermore, the inter-assay and intra-assay CVs were all less than 10% (data not shown), it could be concluded that the developed C-ELISA assay has highly repeatability and stability. Kappa statistics were applied to ascertain the concordance between the C-ELISA and Western blot assay, a kappa of 0.786 was obtained, indicating an excellent agreement between two assays. The results indicated that the developed C-ELISA assay in this study can be used to detect N-DRV antibodies instead of using Western blot which is time-consuming. Detection of clinical serum samples in the study showed that the positive rate of N-DRV antibodies was 57.7% in different age and species of ducks, the positive rate of Muscovy duck was significantly higher than that of other ducks (Shaoxing duck, Cherry Valley duck, Pekin duck etc.), and there were higher prevalence of N-DRV in long-term farmed farms, where ducks have been farmed for at least 6 years (data not shown). The results suggested that N-DRV infections are probably endemic in Zhejiang and Jiangsu Province, China. In conclusion, the C-ELISA assay was developed successfully for the detection of antibodies to N-DRV with high levels of sensitivity, specificity and reproducibility. The assay will be useful test for
Please cite this article in press as: Yun, T., et al., Development and application of an indirect ELISA for the detection of antibodies to novel duck reovirus. J. Virol. Methods (2015), http://dx.doi.org/10.1016/j.jviromet.2015.04.012
291
292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355
G Model VIRMET 12776 1–5
ARTICLE IN PRESS T. Yun et al. / Journal of Virological Methods xxx (2015) xxx–xxx
356 357
358 Q4
large-scale serological survey in N-DRV infection and monitoring antibodies titers against N-DRV. Uncited references
360
Giambrone (1980), Heffels-Redmann et al. (1992) and Reed and Muench (1938).
361
Acknowledgments
359
366
This work was supported by grants from the National Natural Science Foundation of China (31302121), the Zhejiang Natural Sciences Foundation (LY13C180002), the Special Fund for Agroscientific Research in the Public Interest (201003012), Ningbo Scientific Research Project (2014C10033).
367
References
362 Q5 363 364 365
368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388
Chen, S.Y., Chen, S.L., Lin, F.Q., Wang, S., Jiang, B., Chen, X.X., Zhu, X.L., Li, Z.L., 2012. The isolation and identification of novel duck reovirus. Chin. J. Virol. 28, 24–230. Chen, Z.Y., Zhu, Y.Q., Li, C.F., Liu, G.Q., 2011. Novel duck reovirus, DRV-TH11, caused Pekin ducks disease in 2011. Emerg. Infect. Dis. 18, 1209–1211. Dermody, T.S., Schiff, L.A., Nibert, M.L., Coombs, K.M., 1991. The S2 gene nucleotide sequence of prototype strain of the three reovirus serotypes: characterization of reovirus core protein 2. J. Virol. 65, 5721–5731. Gaudry, D., Charles, J., Tektoff, J., 1972. A new disease expressing itself by a viral pericarditis in Barbary ducks. C. R. Acad. Sci. 274, 2916–2919. Giambrone, J.J., 1980. Microculture neutralization test for serodiagnosis of three avian viral infections. Avian Dis. 24, 284–287. He, Q., Cheng, A.C., Wang, M.S., Zhu, D.K., Zhou, Y., Jia, R.Y., Chen, S., Chen, Z.L., Chen, X.Y., 2013. Recombinant UL16 antigen-based indirect ELISA for serodiagnosis of duck viral enteritis. J. Virol. Methods 189, 105–109. Heffels-Redmann, U., Müller, H., Kaleta, E.F., 1992. Structural and biological characteristics of reoviruses isolated from Muscovy ducks (Cairina moschata). Avian Pathol. 21, 481–491. Kaschula, V.R., 1950. A new virus disease of the muscovy duck (Cairina moschata (Linn)) present in Natal. J. S. Afr. Vet. Med. Assoc. 21, 18–26. Landis, J.R., Koch, G.G., 1977. An application of hierarchical kappa-type statistics in the assessment of majority agreement among multiple observers. Biometrics 33, 363–374.
5
Liu, H.J., Lee, L.H., Hsu, H.W., Kuo, L.C., Liao, M.H., 2003. Molecular evolution of avian reovirus: evidence for genetic diversity and reassortment of the S-class genome segments and multiple cocirculating lineages. Virology 314 (1), 336–349. Ma, G., Wang, D., Shi, J., Jiang, T., Yuan, Y., Zhang, D.B., 2012. Complete genomic sequence of a reovirus isolate from Pekin ducklings in China. J. Virol. 86, 13137. Malkinson, M., Perk, K., Weisman, Y., 1981. Reovirus infection of young muscovy ducks (Cairina moschata). Avian Pathol. 10, 433–440. Marius-Jestin, V., Lagadic, M., Le Menec, Y., Bennejean, G., 1988. Histological data associated with muscovy duck reovirus infection. Vet. Rec. 123, 32–33. Mertens, P., 2004. The dsRNA viruses. Virus Res. 101, 3–13. Pinto, P.S.A., Vaz, A.J., Germano, P.M.L., Nakamura, P.M., 2000. ELISA test for the diagnosis of cysticercosis in pigs using antigens of Taenia solium and Taenia crassiceps cysticerci. Rev. Inst. Med. Trop. Sao Paulo 42, 71–79. Reed, L.J., Muench, H., 1938. A simple method for estimating fifty percent endpoints. Am. J. Hyg. 27, 493–497. Sambrook, J., Russell, D.W., 2001. Molecular Cloning. A Laboratory Manual, third ed. Cold Spring Harbor Laboratory Press, New York. Wang, D., Xu, F., Ma, G., Zhang, C., Huang, Y., Li, H., Zhang, D.B., 2012. Complete genomic sequence of a new Muscovy duck-origin reovirus from China. J. Virol. 86, 12445. Wu, R., Hu, S., Xiao, Y., Li, Z., Shi, D., Bi, D., 2007. Development of indirect enzymelinked immunosorbent assay with nucleoprotein as antigen for detection and quantification of antibodies against avian influenza virus. Vet. Res. Commun. 31, 631–641. Ye, W.C., Yu, B., Liu, Y.S., Hua, J.G., Yun, T., Zhang, C., 2014. Establishment of universal RT-PCR for detection of Muscovy duck reovirus. Acta Agriculturae Zhejiangensis 23, 1453–1456. Yun, T., Ye, W.C., Ni, Z., Chen, L., Yu, B., Hua, J.G., Zhang, Y., Zhang, C., 2012. A complete genomic sequence of goose-origin reovirus from China. J. Virol. 86, 10257. Yun, T., Yu, B., Ni, Z., Ye, W.C., Chen, L., Hua, J.G., Zhang, C., 2014. Genomic characteristics of a novel reovirus from Muscovy duckling in China. Vet. Microbiol. 168, 261–271. Yun, T., Yu, B., Ni, Z., Ye, W.C., Chen, L., Hua, J.G., Zhang, C., 2013. Isolation and genomic characterization of a classical Muscovy duck reovirus isolated in Zhejiang, China. Infect. Genet. Evolut. 20, 444–453. Zhang, Y., Guo, D.C., Liu, M., Geng, H.W., Hu, Q.L., Liu, Y., Liu, N.H., 2007. Characterization of the (B-encoding genes of Muscovy duck reovirus: (C(B-ELISA for antibodies against duck reovirus in ducks. Vet. Microbiol. 121, 231–241. Zhang, Y., Liu, M., Shuidong, O., Hu, Q.L., Guo, D.C., Chen, H.Y., Han, Z., 2006. Detection and identification of avian, duck, and goose reoviruses by RT-PCR: goose and duck reoviruses are part of the same genogroup in the genus Orthoreovirus. Arch. Virol. 151, 1525–1538.
Please cite this article in press as: Yun, T., et al., Development and application of an indirect ELISA for the detection of antibodies to novel duck reovirus. J. Virol. Methods (2015), http://dx.doi.org/10.1016/j.jviromet.2015.04.012
389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432