Development and characterization of a skin cell line (SGA) from the mosquitofish Gambusia affinis and its susceptibility to fish Betanodavirus

Journal Pre-proof Development and characterization of a skin cell line (SGA) from the mosquitofish Gambusia affinis and its susceptibility to fish Betanodavirus

Jyotsna, Parameswaran Vijayakumar, M. Ravi, Raja Sudhakaran, Tohru Mekata, T. Rajaswaminathan PII:

S0044-8486(19)31451-6

DOI:

https://doi.org/10.1016/j.aquaculture.2019.734778

Reference:

AQUA 734778

To appear in:

aquaculture

Received date:

7 June 2019

Revised date:

16 November 2019

Accepted date:

23 November 2019

Please cite this article as: Jyotsna, P. Vijayakumar, M. Ravi, et al., Development and characterization of a skin cell line (SGA) from the mosquitofish Gambusia affinis and its susceptibility to fish Betanodavirus, aquaculture (2019), https://doi.org/10.1016/ j.aquaculture.2019.734778

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Published by Elsevier.

Journal Pre-proof Development and characterization of a skin cell line (SGA) from the Mosquitofish Gambusia affinis and its susceptibility to fish Betanodavirus

Jyotsna1, Parameswaran Vijayakumar1*, M. Ravi1, Raja Sudhakaran2, Tohru Mekata3, T. Rajaswaminathan4

1

Centre for Ocean Research, Col. Dr Jeppiaar Research Park, Sathyabama Institute of Science and

oo

Aquaculture Biotechnology Laboratory, School of BioSciences and Technology, Vellore Institute of

pr

2

f

Technology, Chennai 600 119, Tamil Nadu, India

3

Pr

e-

Technology, Vellore – 632 014, Tamil Nadu, India

Nansei Main station, National Research Institute of Aquaculture, Japan Fisheries Research and

Peninsular and Marine Fish Genetic Resources Centre, ICAR-NBFGR, CMFRI Campus,

Jo u

4

rn

al

Education Agency, Mie 519-0193, Japan

Kochi - 682 018, Kerala, India

*Corresponding author

Parameswaran Vijayakumar Centre for Ocean Research, Col. Dr Jeppiaar Research Park, Sathyabama Institute of Science and Technology, Chennai- 600 119, Tamil Nadu, India. Email- [email protected]

1

Journal Pre-proof Abstract A new continuous cell line designated as SGA has been developed from the skin tissue of the freshwater mosquitofish Gambusia affinis. The cell line grew well in Leibovitz’s L-15 medium supplemented with 15 % fetal bovine serum at 28 °C. Immunophenotyping of the cell line showed the epithelial nature of the cells. Chromosome number analysis showed that SGA cells have a modal diploid chromosome number of 48. Replication of the two different strains of betanodavirus (RGNNV and SJNNV) in SGA cell line showed the maximum virus titre of 108.82 TCID50 mL-1 for

oo

f

RGNNV and 107.2 TCID50 mL-1 for SJNNV. The cytopathic effect in the cell line was observed at 3 days post-infection (dpi) and multiple vacuolations were observed at 7 dpi. Further, DsRed2 plasmid

pr

was efficiently delivered into SGA cell line and was found that these cells were transfectable and can

e-

be used for assessing gene promoter activity. In vivo challenge experiments using the RGNNV

Pr

infected cell culture supernatant showed signs of the disease in healthy mosquitofish with mortality commencing from 15 dpi. The above results suggest that the cell line is permissive for propagating

Jo u

rn

betanodavirus infection.

al

betanodavirus and also could be an essential tool for studying the molecular pathogenesis of

Keywords: Fish cell line; Gambusia affinis; Betanodavirus; RGNNV; SJNNV

2

Journal Pre-proof 1. Introduction Mosquitofish Gambusia affinis (Baird and Girard, 1853) is a small freshwater fish introduced into waterways around the world to control mosquitos and thereby the viruses they carry (Seale, 1917; Pyke, 2008). The species is being used widely in ecotoxicological studies (Hou et al., 2011; Huang et al., 2012; Rawson et al., 2008). However, relatively little is known about the viruses those infect mosquitofish (Praveen et al., 2018). Knowledge of mosquitofish virology is important because the migration of these fish might inadvertently introduce viral diseases into new areas and thus will have

oo

f

an impact on aquaculture. One family of viruses that is of interest is the nodaviridae, of which genus betanodavirus is of particular interest for fish biology (Hameed et al., 2019). Because betanodavirus

pr

infection has a severe impact on the aquaculture industry causing heavy economic loss (Munday et

e-

al., 2002; Maltese et al., 2007; Doan et al., 2017; Chean et al., 2017). It infects both the marine and

Pr

freshwater fishes such as european eel Anguilla anguilla L (Chi et al., 2003), yellow-wax pompano Trachinotus falcatus (Xu et al., 2010), cobia Rachycentron canadum (Chu et al., 2013), guppies

al

Poecilia reticulata (Nazari et al., 2014), goldfish Carassius auratus (Binesh, 2013), zebrafish Danio

rn

rerio (Binesh, 2013), kelp grouper Epinephelus moara (Liu et al., 2016), asian sea bass Lates

Jo u

calcarifer (Paramewaran et al., 2007), european sea bass Dicentrarchus labrax (Pascoli et al., 2016), and gilthead seabream Sparus aurata (Toffan et al., 2017). An important tool in the virology and ecotoxicology of fish is the cell line (Lai et al., 2003; Bols et al., 2005; Cheng et al., 2010; Yang et al., 2010; Wang et al., 2014). Cell lines from the species are important because they could best reflect the sensitivity or susceptibility of the species to a specific eco toxicant or a particular virus. Currently, the Cellosaurus lists 594 cell lines which have been mentioned in the literature as being derived from fish (Barioch, 2018) and these constitute the fish invitrome (Bols et al., 2017). To the best of our knowledge, so far no cell lines have been developed from the mosquitofish. In this study, a cell line from mosquitofish (G. affinis) has been successfully established and characterized. Susceptibility of this new cell line (SGA) to betanodavirus has been

3

Journal Pre-proof confirmed by cytopathic effects (CPE) observation, viral titre determination, and reverse transcriptase PCR studies. This is the first successful establishment of a cell line from G. affinis to be reported and thus becomes the first of the mosquitofish invitrome.

2. Materials and Methods 2.1. Fish maintenance Mosquitofishes G. affinis (n = 100) each weighing 1.5-2 g and with a length of 3.2 ± 0.56 cm reared

oo

f

at 28 °C were procured from a private fish farm at Tambaram (Chennai, Tamil Nadu) and transported to our aquaculture laboratory. The fishes were maintained in rectangular glass tanks (120 L capacity)

pr

filled with filtered and aerated freshwater (pH 7.3) having salinity less than 0.05 %, hardness 140 ±

e-

2.7 mg L-1(CaCO3) and photoperiod of 14h:10h light/dark and temperature of 28 °C. The fishes were

Pr

fed twice daily with commercially available fish feed pellets (Optimum micro pellet, Thailand) purchased from local aquarium shop Chennai, Tamilnadu, India. Half of the water was renewed daily

rn

2.2. Virus

al

throughout the experimental period.

Jo u

Two different betanodavirus isolates were used in this study (i) SJNag93 (SJNNV genotype) (ii) SGWaK97 (RGNNV genotype) provided by co-author Dr Raja Sudhakaran. All the experimental procedures were approved by the institutional animal care committee as per the guidelines of CPCSEA (Committee for the Purpose of Control and Supervision of Experiments on Animals). 2.3. Initiation of primary cell culture and routine maintenance Healthy juvenile mosquitofish (1.5-2 g in weight) was anaesthetized by immersing them in ice-cold water and were surface cleaned with 70 % ethanol. The brain, skin, vertebra and eyes were dissected with sterile scissors. Tissues were then washed four times in Leibovitz’s L-15 medium containing antibiotics (10000 IU mL−1 penicillin, 400 µgmL−1 streptomycin; HiMedia). Thereafter, the tissues were cut into small pieces (1 mm3) and 15 explants were transferred to a tissue culture flask (Bio-

4

Journal Pre-proof Rad) containing 2 mL of Leibovitz’s L-15 medium supplemented with 20 % fetal bovine serum (FBS, HiMedia) and antibiotics. The flasks were incubated at 28 °C. When the cells formed a monolayer, the cells were subcultured using trypsin-EDTA (0.25 %) (HiMedia) in 1:3 ratio. After 25th subculture, the concentration of FBS in the medium was reduced to 10 %. 2.4. Cell Growth To study the effect of different FBS concentrations on cell growth, the SGA cells at 20th passage were seeded at 2 X 103 cells/well in 96 well microplates (HiMedia). After 24 h, different FBS

oo

f

concentrations (2 %, 5 %, 10 %, 15 % and 20 %) were added to the cells and the plates were incubated at 28 °C. Cell proliferation activity was measured at 1, 3, 5, and 7 days post-seeding,

pr

according to manufacturer’s protocol (XTT kit, HiMedia).

e-

2.5. Cryopreservation

Pr

SGA cells were subcultured and grown to sub-confluence. The cells were trypsinised and centrifuged at 1000 g for 4 min at 4 °C. The pelleted cells were counted and re-suspended in freshly prepared

al

cryopreserving medium (60 % L-15 medium, 30 % FBS, 10 % DMSO). From this, 2.4 X 105 cells

rn

were transferred to each cryovial and stored at -80 °C overnight and then transferred to -196 °C in

Jo u

liquid nitrogen. Frozen cells were then recovered in 9 mL of the culture medium and placed in a flask at 28 °C. The medium was renewed after 8 h and the cell viability was determined using trypan blue (HiMedia) dye exclusion method. 2.6. Chromosomal analysis

SGA cells at 30th passage were used for chromosome analysis. Colchicine (1 µg mL-1) (HiMedia) was added to the 70 % confluent cells and incubated for 3 h. Cells were trypsinized and centrifuged at 1000 g for 5 min at 4 °C. The cell pellet was gently suspended in 0.04 M KCl and incubated at 28 °C for 30 min. The tubes were centrifuged again at 1000 g for 5 min and then the cells were fixed in freshly prepared ice-cold methanol–acetic acid (3:1) for 15 min. Finally, the cell pellet was dissolved in fixative and dropped onto the chilled glass slides. The slides were air-dried and stained with 5 %

5

Journal Pre-proof Giemsa stain solution (HiMedia) (pH 6.8) for 15-20 min. The slides were washed, air-dried and chromosome numbers in 50 cells at the metaphase stage were counted. 2.7. Cell transfection To evaluate transfection efficiency and gene expression in SGA cells, the vector DsRed2 expressing red fluorescent protein was used (Clontech Laboratories, USA). Briefly, the cells were seeded in 24well plates (HiMedia) at a density of 2 × 104 cells per well. After 24 h, the cell monolayer was washed once with serum-free medium. Subsequently, 1µg of the plasmid was delivered into the cells

oo

f

using TransFectin Lipid Reagent according to the manufacturer’s instructions (Bio-Rad). After 36 h, the red fluorescence signal was observed under a fluorescent microscope with an excitation

pr

wavelength of 563 nm and an emission wavelength of 582 nm.

e-

2.8. Immunocytochemistry

Pr

SGA cells were grown on glass coverslips in a six-well tissue-culture plate for 24 h at 28 °C and washed thrice in PBS (Phosphate Buffered Saline). The cells were fixed in methanol for 30 min at -20

al

°C. The cells were then washed again with PBS and incubated with 1 % BSA (Bovine Serum

rn

Albumin) (HiMedia) in PBS and 0.1 % Triton-X (HiMedia) in PBS for 1 h at 37 °C. Mouse anti-

Jo u

cytokeratin AE1/AE3 antibody (Life Technologies, catalogue number- IHCR2025-6) and mouse antifibronectin antibody (Life Technologies, catalogue number- F0791-100 UL) diluted 1:2000 were added to the cells and incubated overnight at 4 °C. A quantity of 1 % BSA in PBS was used in place of primary antibodies as control. After 24 h, the cells were washed with PBS and incubated for 1 h with secondary antibody i.e. rabbit anti-mouse immunoglobulin (IgG) fluorescein isothiocyanate conjugate (Life Technologies, catalogue number- 31824) diluted 1:50 in PBS containing 1 % BSA. The cells were washed in PBS, mounted in VECTASHIELD mounting medium and observed under the fluorescence microscope.

6

Journal Pre-proof 2.9. Confirmation of the origin of the cell line To confirm the origin of the cell line, DNA was extracted from SGA cells at 25th passage and skin tissue of G. affinis by the following method with minor modifications (Jeffrey et al., 1991). In brief, the cell pellet and tissue were lysed with lysis buffer (10 mM Tris-HCl, 10 mM EDTA pH 8, 0.5 % SDS and 50 μgmL-1 proteinase K) incubated at 65 °C for 1 h and then 5 M NaCl was added to the tubes. An equal volume of phenol-chloroform-isoamyl alcohol (25:24:1) (pH 8) was added and the tubes were centrifuged at 11000 g for 10 min. The upper aqueous phase was collected in another

oo

f

sterile tube. Two volumes of 100 % isopropanol were added to the supernatant and centrifuged at 11000 g for 10 min. Finally, the DNA pellet was washed with 70 % cold ethanol and centrifuged at

pr

11000 g for 10 min. The pellet was air-dried and dissolved in 0.05 mL of nuclease-free water. To

e-

confirm the origin of the cell line, the fragment of mitochondrial cytochrome oxidase subunit-I (coi-I)

Pr

gene of G. affinis was amplified. The coi-I gene was amplified using the primer sequence designed from the coi-I gene sequence available in the GenBank database (Table 1). The thermal cycle

al

consisted of an initial step at 95 °C for 5 min followed by 30 cycles of 95 °C for 30 s, 55 °C for 30 s

rn

and 72 °C for 1 min with a final extension phase at 72 °C for 10 min and a holding temperature of 4

Jo u

°C. PCR products were separated by electrophoresis on a 1.2 % agarose gel, stained with ethidium bromide, visualized using ultraviolet light and sequenced. 2.10. Virus susceptibility and TCID50 assay SGA cell line was subcultured and seeded in 96 well plates at a density of 3X103 cells/ well. The virus inoculum was serially diluted by 1/10 from 10-1 to 10-9 in L-15 medium and 100 µL of each serial dilution was added to eight wells of a 96-well plate containing SGA cells. The cells were then incubated for 7 days at 28 °C in medium containing 2 % FBS and cytopathic effects (CPEs) were observed under an inverted light microscope (Leica). The viral titres were subsequently determined by calculating the 50 % tissue culture infectious dose (TCID50) based on the number of wells displaying positive CPE (Reed et al., 1938).

7

Journal Pre-proof 2.11. Viral replication efficiency and RT-PCR confirmation To determine the replication efficiency of betanodavirus in SGA cells, the cell monolayer was infected with RGNNV and SJNNV strain of the virus in two separate flasks. To determine the viral replication efficiency, the supernatant was collected on 1, 3, 5 and 7 days post-infection (dpi) and the virus titre was determined respectively. Uninfected SGA cells were used as controls. Total RNA was extracted and reverse-transcribed into cDNA. The capsid protein gene for RGNNV strain and coat protein gene for SJNNV strain were amplified using gene-specific primers (5 pmol µL-1) designed

oo

f

from the sequence present in the GenBank database (Table 1). The PCR reaction conditions were as follows: 5 min at 95 °C, followed by 35 cycles of 95 °C for 30 s, 62 °C for 30 s, and 72 °C for 30 s,

pr

and then final extension at 72 °C for 10 min and hold at 4 °C. PCR products were separated by

e-

electrophoresis on a 1.2 % agarose gel, stained with ethidium bromide, visualized using UV

Pr

transilluminator and sequenced. 2.12. Experimental infection

al

For the experimental challenge, two groups of 10 fishes each were individualized in glass tanks. In

rn

group 1, fishes were intramuscularly injected with 10 μL of viral inoculum with a dose of 103.37

Jo u

TCID50 mL-1 for RGNNV using insulin syringe. Group 2 served as the negative control. In this group, fishes were intramuscularly injected with 10 μL sterile PBS. The fishes were monitored for 30 days for the development of clinical signs, morbidity and mortality. The experiments were performed in triplicates.

2.13. Collection of samples Fishes with characteristic signs of VNN (virus nervous necrosis) were removed from the tank and the fishes were collected from each of the infected and control groups at an interval of 5, 10, 15, 20, 25 and 30 dpi or during the morbid state of the fish in each of the experimental groups. On each sampling, fish was subjected to RT-PCR analysis and virus titre estimation and stored at -80 °C until use.

8

Journal Pre-proof 2.14. Confirmation of virus replication in experimentally challenged fish RT-PCR analysis of the target organ was carried out to confirm the betanodavirus infection in fish samples collected at different time intervals by following the standard protocol. Total RNA was extracted using Trizol reagent (Invitrogen, USA) as per manufacturer’s instruction from the brain and eye of the fish. The RNA quality and purity (A260/A280 ratio) were estimated using a NanoDrop spectrophotometer (Thermofisher Scientific) and RNA integrity was assessed by agarose gel electrophoresis. cDNA synthesis was carried out and quantified using a NanoDrop spectrophotometer

oo

f

at 260 nm. For PCR amplification, a single step 10 μL reaction mix, containing 1 μL of cDNA product, 5 μL master mix (Taq DNA polymerase, 2.0 X master mix red, MgCl2 2.0 mM), 1 μL of

pr

each primer (5 pmol µL-1) and 2 μL distilled water was used. Viral genes were amplified using

e-

primers designed specifically for RGNNV as shown in table 1 by following reaction conditions at 95

Pr

°C for 2 min, 35 cycles of denaturation at 95 °C for 40 s, annealing at 62 °C for 30 s, and elongation at 72 °C for 40 s, and a final extension at 72 °C for 10 min. The PCR products were separated by

rn

transilluminator and sequenced.

al

electrophoresis on a 1.2 % agarose gel, stained using ethidium bromide, visualized using UV

Jo u

2.15. Sample processing for virus estimation For virus estimation in the infected group of fishes, the brain and eye were collected aseptically from the control and as well from infected groups at 5, 10, 15, 20, 25 and 30 dpi. The tissues were homogenized in PBS using sterile mortar and pestle and then centrifuged at 7500 g for 15 min at 4 °C. The supernatant was filtered using syringe filter (0.45 µM pore size) and then stored at -80 °C for later use. Survivor fishes were sacrificed at 30 dpi by immersing the fishes in 5 % lignocaine hydrochloride (Neon) in water. 2.16. Infective viral particle quantification Viral titrations were performed following the TCID50 method. Briefly, the supernatant was diluted to ten-fold serial dilutions from (10-1 to 10-9) and was inoculated in SGA cells seeded in 96 well plates 9

Journal Pre-proof (HiMedia) at a density of 3 X 103 cells/well and incubated for 1 h at 28 °C. After the incubation period, the viral suspensions were removed and the cell monolayer was washed with PBS. The cell monolayer was then supplemented with L-15 medium containing 2 % FBS. Cells were then incubated at 28 °C for 7 days to observe the CPE and virus titre was estimated.

3. Results 3.1. Primary culture and subculture

oo

f

Primary cell cultures of G. affinis were initiated in March 2018 using tissues from brain, skin, eye and vertebra. The cells began to migrate from these tissue fragments and formed a monolayer during the

pr

first month. The cells from other tissues i.e. brain, eye and vertebra could not grow for a longer

e-

period due to contamination in cells and showed a slow growth rate. However, only the cells from the

Pr

skin of mosquitofish grew continuously and showed uniform morphology (Figure. 1 A) at 28 °C. The skin cells attached to the culture flask at day 5 formed a monolayer after 25 days. The cells grew

al

continuously and subcultured successfully for more than 50 passages and we named it as SGA (Skin

rn

Gambusia affinis) cell line (Figure. 1 B-D).

Jo u

3.2. Chromosome analysis

The chromosome number of SGA cell line was determined at 30th passage. As shown in Figure. 1 E, the chromosome number of SGA cells ranged from 40 to 55 with a modal number of 48. 3.3. Cell Growth

The effect of FBS concentration on SGA cell growth was evaluated at the 20th passage. The growth rate of SGA cells increased with the FBS concentration from 5 to 15 %. After 3 days, the cells reached their maximum growth in 15 and 20 % FBS compared to other concentrations. The SGA cells showed a lower growth rate in 5 % and no growth in 2 % FBS concentration. (Figure. 1 F).

10

Journal Pre-proof 3.4. Cryopreservation The cryopreserved cells at 5th, 15th, 30th and 50th passages after 1 month showed the average viability of 70-90 %. The cells became confluent within 3-5 days after cryopreservation and the cell morphology remained the same. 3.5. Immunophenotyping To identify the epithelial and the fibroblastic nature of the SGA cell line, anti-cytokeratin and antifibronectin antibodies were used. The strong fluorescent signal was observed in the cells treated with

oo

f

anti-cytokeratin (Figure. 1 G), suggesting that the cells are epithelial in nature. No signal was observed in the control cells incubated with BSA and also with anti-fibronectin antibody (Data not

pr

shown).

e-

3.6. Transfection efficiency

Pr

To determine the suitability of using the SGA cell line for genetic applications, cells were transfected with DsRed2 plasmid. At 36 h post-transfection, the bright red fluorescent signal was detected in

al

SGA cells (Figure. 1 H). The transfection efficiency of SGA cell line was found to be 15 %, which

rn

showed the ability of SGA cell line for in vitro genetic studies.

Jo u

3.7. Confirmation of origin of the cell line The origin of the SGA cell line was examined by the amplification and sequencing of a fragment of the coi-I gene using gene-specific primers. The PCR products of SGA cells and skin tissue showed similar base pair size of 214 bp (Figure. 1 I) and the nucleotide sequence of the SGA cells showed maximum identity (96 %) with the sequences of G. affinis coi-I gene available in NCBI Genbank (Supplementary Figure. 1A). This data suggested that the SGA cell line originated from G. affinis. 3.8. Virus susceptibility and RT PCR confirmation The susceptibility of the SGA cell line to betanodavirus was evaluated based on the morphological changes and cytopathic effects. Viral infections were detected in SGA cells within 3 days. Initially, the specific CPE developed rounded cells and multiple vacuoles were observed in the cells within 3-4

11

Journal Pre-proof days. The cells completely disintegrated within 5 days post-infection (dpi) in the RGNNV infected cells. In contrast, the CPE in the SJNNV infected cells appeared slower than those observed in RGNNV infected cells (Figure. 2 A-F). Over 7 days of observation, the virus titre in SGA cells reached 107.2 TCID50 mL-1 for SJNNV and 108.82 TCID50 mL-1 for RGNNV respectively (Figure. 2 G). The RT-PCR analysis of the viral capsid protein and coat protein genes showed a PCR product size of 212 bp for SJNNV and 222 bp for RGNNV at 5 and 7 dpi (Figure. 2 H). The sequencing of the PCR products was found to be 100 % identical to the viral gene sequences present in the GenBank

oo

f

database (Supplementary Figure. 1B and 1C). 3.9. Clinical signs of the virus-infected fish

pr

Clinical signs in the virus-infected group started from as early as 2 dpi in Group 1. The main clinical

e-

signs included darkening of the body, reduced feed intake, isolation, and descaling within 3 dpi. After

Pr

10 dpi, redness in the head region and loss of coordination were observed. Fishes in Group 2 (Control group) did not show any clinical signs of the disease (Figure.3 A-C). The mortality in the infected

al

group started at 15 dpi with the highest mortality reaching 24 % at 25 dpi in group 1 (Figure. 3 D).

rn

3.10. Determination of infective viral particles in the challenged fish

Jo u

A significant increase in virus titre was observed with the increase in days of infection. Highest viral titre (6 X 106 TCID50 g-1) was obtained at day 25 for the RGNNV challenged fish i.e. group 1 (Figure. 3 E). The control group i.e. group 2 did not show any viral titre. The viral titre in the survivor fish at 30 dpi was found to be 6.2 X 106 TCID50 g-1. The PCR results confirmed the presence of virus particles inside the fish in group 1, whereas group 2 showed a negative result (Figure. 3 F).

4. Discussion In the present study, we have successfully developed and characterized the first cell line from the skin of mosquitofish (Gambusia affinis). The cell line designated as SGA (Skin Gambusia affinis) was used to propagate fish betanodavirus. The SGA cell line showed stable growth for 50 passages over a

12

Journal Pre-proof period of one year. In the present study, the SGA cells grew well in L-15 medium supplemented with 15 % FBS. Leibovitz’s L-15 cell culture medium is a suitable medium for the fish cell lines. It has been reported that more than 80 % of fish cell lines have been successfully established in L-15 medium (Lakra et al., 2011; Chen et al., 2019) since it also reduced the need of CO2 incubator and provided stability and convenience for cell culture (Leibovitz, 1963 and 1977). Even though we have tried 2-20 % FBS concentrations, the optimum growth of the cells was observed only in 15 % FBS concentration which was similar to the results obtained in other fish cell lines (Rathore et al., 2007;

oo

f

Cheng et al., 2010). It was observed that in 2 % FBS the cells stopped proliferating. Although 5 % and 10 % of serum will not bring optimal culture conditions, it will sustain cell proliferation and will

pr

help to perform most of the in vitro experimentation. Cryopreservation of cell lines is an important

e-

technique to maintain a backup of the original stock. The SGA cell line showed cell viability of 70-90

Pr

% after 1 month of cryopreservation, which is similar to the viabilities of other reported cell lines such as GK-7 with 70-90 % (Huang et al., 2016), CF cell line with 80 % (Cheng et al., 2010) and

al

HK-7 cell line with 75 % (Ryu et al., 2018). 50 chromosome spreads of SGA cells at metaphase

rn

showed a range from 40 to 55 chromosomes with a clear peak at 48. The diploid number of

Jo u

chromosomes (2n=48) observed for SGA cell line, is identical to the chromosome number of mosquitofish (Krishnaja et al., 1983). It indicates that the SGA cells are maintaining their ploidy nature. Cell line authentication using amplification and sequencing of mitochondrial genes are essential to confirm the origin of the cell line (Rougee et al., 2007). Various cell lines have been authenticated using the amplification of a fragment of the mitochondrial coi-I gene (Cooper et al., 2007; Lakra et al., 2010). In the present study, amplification of the fragment of the coi-I gene of SGA cells showed 96 % identity to the sequences of G. affinis available in the NCBI GenBank. Furthermore, immunocytochemistry showed strong positivity to cytokeratin antibodies, which are a specific marker for epithelial cells and a negative reaction to the fibroblastic marker. These results suggest that SGA cells are of epithelial nature. These markers have been employed previously for

13

Journal Pre-proof confirming the nature of cells in fish cell lines (Chaudhary et al., 2014; Swaminathan et al., 2015). We found that transfection efficiency using the lipofection method in SGA cell line showed low transfection efficiency i.e. 15 %, which is similar to the transfection efficiency of other fish epithelial cells such as MPK cell line 10 % (Xue et al., 2017) and PHF cell line 15-20 % (Soni et al., 2018). One possible reason for low transfection efficiency in fish cell line may be that fish cells were grown in lower optimal temperatures compared to mammalian cells. Commercially available transfection reagents based on liposomes were developed for mammalian cells and are not optimal for fish cells

oo

f

(Lopez et al., 2001). Transfection methods such as Nucleofection, PEI (polyethyleneimine) or Fugene showed high transfection efficiency (> 50 % to 70 %) in other fish cell lines such as ZFB1

pr

(Parameswaran et al., 2013), EPC (Falco et al., 2009) and RTG-2 (Lopez et al., 2001) cell lines.

Pr

employed in future experiments.

e-

Hence, in order to improve the transfection efficiency of SGA cell line, these methods will be

One of the major applications of a fish cell line is to isolate and propagate fish viruses. In the present

al

study, the susceptibility of SGA cell line towards two different strains of betanodavirus was

rn

determined and the results showed that this cell line was susceptible to the betanodavirus. The results

Jo u

of CPE, increasing virus titre and RT-PCR indicated the potential of SGA cell line for isolating and propagating fish betanodavirus. Previous attempts made to isolate betanodavirus in a variety of cell lines did not give successful results (Breuil et al., 1991; Munday et al., 2002). However, successful isolation of the betanodavirus in other cell lines has been reported previously, namely the SB cell line (Chua et al., 1995), the SSN-1 snakehead fish cell line (Frerichs et al., 1996), the BB cell line from asian sea bass (Chi et al., 2005), SISS and SISE cell lines from asian sea bass (Parameswaran et al., 2006 a,b). The present study showed that SGA cell line could be a useful tool for the isolation of betanodavirus from diseased fish in India. The infected SGA cells showed apparent CPE, mainly rounding of cells with increasing viral titre at 7 dpi, which is similar to the CPE of previously reported cell lines (Hasoon et al., 2011; Lai et al., 2003). In the experimental infection, the RT-PCR

14

Journal Pre-proof performed on moribund fish using the gene-specific primers confirmed the NNV presence at 5, 15 and 25 dpi. However, the control group did not show the presence of a virus. During the experimental challenge, early detection of viral nervous necrosis (VNN) was possible on day 5 with similar clinical signs as reported by Praveen et al., 2018 during the experimental infection of betanodavirus in G. affinis. However, the clinical signs observed in this study were not similar to those reported for other VNN infected marine fishes (Yoshikoshi et al., 1990; Munday et al., 1994). The significant increase in virus titre at different days of infection (Figure. 3 E) also confirmed the replication of the virus

oo

f

inside the fishes. These results were similar to the results obtained from other VNN infected fishes such as atlantic halibut (Hippoglossus hippoglossus) (Grove et al., 2003), atlantic cod (Gadus

pr

morhua) (Korsnes et al., 2009) and gilthead seabream (Sparus aurata) (Castric et al., 2001). The

e-

infected group of fishes showed mortality after 15 dpi. The analysis of the cumulative mortality curve

Pr

(Figure. 3 D) showed that virus infection caused the highest mortality of 24 % on day 25. These results are similar to the results of experimental infection of betanodavirus in marine fishes (Souto et

al

al., 2015; Kim et al., 2018). The results in the study were similar to that of other fish species such as

rn

tilapia and brown meager which showed no signs of virus nervous necrosis disease but showed the

Jo u

presence of virus following their RT-PCR analysis (Skliris et al., 1999; Dalla et al., 2000) with increasing virus titre. Therefore, it appears that Gambusia affinis carries the NNV without clinically distinct virus nervous necrosis disease. Further, this finding has extended the list of the susceptible host to betanodavirus infection in freshwater species. It has been reported that experimental infections of betanodavirus need not necessarily show the typical characteristic features in freshwater model species (Furusawa et al., 2007; Binesh, 2013) and hence, how the virus particles in freshwater fish species are transmitted requires further validation. In conclusion, a new cell line viz. SGA (Skin Gambusia affinis) has been established and characterized in this study. The SGA cell line showed susceptibility to different strains of fish betanodavirus producing high titre value. This newly established cell line could be a useful tool for

15

Journal Pre-proof virus isolation and to study virus-host pathogenesis in vitro and also to develop better strategies for the control of VNN by developing vaccines that will be helpful to reduce the losses due to this emerging disease.

Acknowledgement The authors are thankful to the management of Sathyabama Institute of Science and Technology for their support. The authors are also thankful to DST-SERB (Ref. YSS/2014/000821) for providing

oo

f

financial support to carry out the research work.

e-

pr

References

1. Bairoch, A., 2018. The Cellosaurus, a cell line knowledge resource. J. Biomol. Tech 29, 25-

Pr

38.

2. Binesh, C.P., 2013. Mortality due to viral nervous necrosis in zebrafish Danio rerio and

al

goldfish Carassius auratus. Dis Aquat Org. 104, 257- 260.

rn

3. Bols, N. C., Pham, P. H., Dayeh, V. R., Lee, L. E. J., 2017. Invitromatics, invitrome, and

Jo u

invitroomics: Introduction of three new terms for in vitro biology and illustration of their use with the cell lines from rainbow trout. In Vitro Cellular & Developmental Biology-Animal. 53, 383-405.

4. Bols, N.C., Dayeh, V.R., Lee, L.E.J., Schirmer, K., 2005. Use of fish cell lines in toxicology of fish, in: Biochemistry and Molecular Biology of Fishes-Environmental Toxicology.Vol. 6. edited by T.W. Moon and T. P. Mommsen. Amsterdam: Elsevier Science. pp. 43-84. 5. Breuil, G., Bonami, J.R., Pepin, J.F., Pichot, Y., 1991. Viral infection (picorna-like virus) associated with mass mortalities in hatchery-reared sea bass (Dicentrarchus labrax) larvae and juveniles. Aquaculture. 97, 109-116.

16

Journal Pre-proof 6. Castric, J., Thiery, R., Jeffroy, J., Kinkelin, P., Raymond, J.C., 2001. Seabream Sparus aurata, an asymptomatic contagious fish host for nodavirus. Dis. Aquat. Organ. 47, 33- 38. 7. Chaudhary, D.K., Sood, N., Rathore, G., Pradhan, P.K., Punia, P., Agarwal, N.K., Jena, J.K., 2014. Establishment and characterization of macrophage cell line from the thymus of Catla catla (Hamilton, 1822). Aquacult. Res. 45, 299- 311. 8. Chean, Y.Y., Swee, K.Y., Abdul, R.O., Wen S.T., 2017. Advances in the study of nodavirus. Peer J. 5, e3841. https://peerj.com/articles/3841.

oo

f

9. Chen, B., Zheng, Z., Yang, J., Chi, H., Huang, H., Gong, H., 2019. Development and characterization of a new cell line derived from European eel Anguilla anguilla kidney.

pr

Biology Open. 8, bio037507.

e-

10. Cheng, T.C., Lai, Y.S., Lin, I.Y., Wu, C.P., Chang, S.L., 2010. Establishment,

Pr

characterization, virus susceptibility and transfection of cell lines from cobia, Rachycentron canadum (L), brain and fin. J. Fish Dis. 33, 161-169.

al

11. Chi, S.C., Shieh, J.R., Lin, S. J., 2003. Genetic and antigenic analysis of betanodaviruses

rn

isolated from aquatic organisms in Taiwan diseases of aquatic organisms. Dis. Aquat. Org. 55,

Jo u

221-228.

12. Chi, S.C., Wu, Y.C., Cheng, T.M., 2005. Persistent infection of betanodavirus in a novel cell line derived from the brain tissue of barramundi Lates calcarifer. Dis. Aquat. Org. 65, 91-98. 13. Chu, K.B., Abdulah, A., Abdullah, S.Z., Bakar, R.A., 2013. A Case Study on the Mortality of Cobia (Rachycentron canadum) cultured in traditional cages. Tropical Life Sciences Research. 24, 77–84. 14. Chua, F.H.C., Loo, J.J., Wee, J.Y., 1995. Mass mortality in juvenile greasy grouper (Epinephelus tauvina) associated with vacuolating encephalopathy and retinopathy. Dis Asian Aquacult. 11, 235-241.

17

Journal Pre-proof 15. Cooper, J.K., Sykes, G., King, S., 2007. Species identification in cell culture: a two-pronged molecular approach. In Vitro Cell. Dev. Biol. Anim. 43, 344-351. 16. Dalla, V.L, Zanella, L., Patarnello, P., Paolucci, L., Belvedere, P., Colombo, L., 2000. Development of a sensitive diagnostic assay for fish nervous necrosis virus based on RT-PCR plus nested PCR. J. Fish Dis. 23, 321-327. 17. Doan, Q.K., Vandeputte, M., Chatain, B., Morin, T., Allal, F., 2017. Viral encephalopathy and retinopathy in aquaculture: A review. J. Fish Dis. 40,717-742.

oo

f

18. Falco, A., Encinas, P., Carbajosa, S., Cuesta, A., Chaves, P. E., Tafalla, C., Estepa. A., Coll.J.M., 2009. Transfection improvements of fish cell lines by using deacylated

pr

polyethyleneimine of selected molecular weights. Fish and Shellfish Immunology. 26, 559-

e-

566.

Pr

19. Frerichs, G.N., Rodger, H.D., Peric, Z., 1996 Cell culture isolation of piscine neuropathy nodavirus from juvenile sea bass Dicentrarchus labrax. J Gen Virol. 77, 2067-2071.

al

20. Furusawa, R., Okinaka, Y., Uematsu, K., Nakai T., 2007. Screening of freshwater fish species

rn

for their susceptibility to a betanodavirus. Dis Aquat Org. 77, 119- 125.

Jo u

21. Grove, S., Johansen, R., Dannevig, B.H., Reitan, L.J., Ranheim, T., 2003. Experimental infection of Atlantic halibut Hippoglossus hippoglossus with nodavirus: tissue distribution and immune response. Dis. Aquat. Organ. 53, 211-221. 22. Hameed, A.S.S., Ninawe, A.S., Nakai, T., Chi, S.C., Johnson, K.L., 2019. ICTV virus taxonomy profile: Nodaviridae. J. General. Virol. 100, 3-4. 23. Hasoon, M.F., Daud, H.M., Arshad, S.S., Bejo, M.H., 2011. Betanodavirus experimental infection in freshwater ornamental guppies: diagnostic histopathology and RT-PCR. J. Adv. Med. Res.1, 45-54.

18

Journal Pre-proof 24. Hou, L., Xie, Y., Ying, G., Fang, Z., 2011. Developmental and reproductive characteristics of western mosquitofish (Gambusia affinis) exposed to paper mill effluent in the Dengcun River Sihui, South China. Aquat. Toxicol. 103, 140-149. 25. Huang, G.Y., Ying, G.G., Liu, S., Fang, Y.X., 2012. Regulation of reproduction and biomarker related gene expression by sex steroids in the livers and ovaries of adult female western mosquitofish (Gambusia affinis). Comp. Biochem. Physiol. A Mol. Integr. Physiol. 162, 36-43.

oo

f

26. Huang, S. M., Tu, C., Kuo, S. T., Kuo, H. C., Chou, C. C., Chang, S.K., 2016. Establishment and Characterization of a novel kidney-cell line from orange-spotted grouper, Epinephelus

pr

coioides, and its susceptibility to grouper iridovirus. Journal of Marine Science: Research &

e-

Development. 6, 192.

Pr

27. Jeffrey, A.R., Garret, B.N., Katrina, L. H., 1991. DNA Isolation from small tissue samples using salt and Spermine. Nucleic Acids Research. 19, 6053.

al

28. Kim, O. J., Kim, S. J., Kim, J. O., Kim, W. S., Oh, M. J., 2018. Distribution of nervous

rn

necrosis virus (NNV) in infected seven-band grouper, Hyporthodus septemfasciatus by

Jo u

intramuscular injection or immersion challenge. Aquaculture. 489, 1-8. 29. Korsnes, K., Karlsbakk, E., Devold, M., Nerland, A. H., Nylund, A., 2009. Tissue tropism of nervous necrosis virus (NNV) in Atlantic cod, Gadus morhua L., after intraperitoneal challenge with a virus isolated from diseased Atlantic halibut Hippoglossus hippoglossus (L). J. Fish Dis. 32, 655-665. 30. Krishnaja, A.P., Rege, M. S., 1983. A Cytogenetic Study on the Gambusia affinis Population from India. Cytologia 48, 47- 49. 31. Lai, Y.S., John, J.A., Lin, C.H., Guo, I.C., Chen, S.C., 2003. Establishment of cell lines from a tropical grouper, Epinephelus awoara (Temminck & Schlegel) and their susceptibility to grouper irido and nodaviruses. J. Fish Dis. 26, 31- 42.

19

Journal Pre-proof 32. Lakra, W. S., Swaminathan, T. R., Joy, K.P., 2011. Development, characterization, conservation and storage of fish cell lines: a review. Fish Physiol. Biochem. 37, 1-20. 33. Lakra, W.S., Goswami, M., Rajaswaminathan, T., Rathore, G., 2010. Development and characterization of two new cell lines from common carp, Cyprinus carpio (Linn).Biol. Res. 43, 385-392. 34. Lakra, W.S., Swaminathan, T.R., Joy, K.P., 2011. Development, characterization, conservation and storage of fish cell lines: a review. Fish Physiol. Biochem. 37, 1–20.

oo

f

35. Leibovitz, A., 1963. The growth and maintenance of tissue-cell cultures in free gas exchange with the atmosphere. Am. J. Hyg. 78, 173-180.

pr

36. Leibovitz, A., 1977. Preparation of medium L-15. Tca Manual. 3, 557-559.

e-

37. Liu, K.F., Wu, Y.H., Wei, S.N., Wang, N., Li, P.F., Li, Y.Z., Zhang, N.W., Qin, Q.W., Chen,

Pr

S.L., 2016. Establishment and characterization of a kidney cell line from kelp grouper Epinephelus moara. Fish Physiol Biochem. 44, 87-93.

al

38. Lopez, A., Fernandez, A.M., Rocha, A., Estepa, A., Coll, J.M., 2001.Transfection of

rn

Epithelioma papulosum cyprini (EPC) carp cells. Biotechnology Letters. 45, 481-487.

Jo u

39. Maltese, C., Bovo, G., 2007. Viral encephalopathy and retinopathy. Ittiopatologia. 4, 93-146. 40. Munday, B.L., Kwang, J., Moody, N., 2002. Betanodavirus infections of teleost fish: A review. J. Fish Dis. 25, 27-142. 41. Munday, B.L., Nakai, T., Nguyen, H.D., 1994. Antigenic relationship of the picorna-like virus of larval barramundi, Lates calcarifer (Bloch) to the nodavirus of larval striped jack nervous necrosis (SJNNV) from brood stocks of striped jack, Pseudocaranx dentex (Bloch and Schneider). Australian Vet J. 71, 384. 42. Nazari, A., Hassan, M. D., Bovo, G., Zorriehzahra, M. J., Azmi, T. I., Arshad, S.S., 2012. Pathogenicity of viral nervous necrosis virus for Guppy fish, Poecilia reticulata. Iranian Journal of Fisheries Sciences. 13, 168-177.

20

Journal Pre-proof 43. Parameswaran, V., Ahmed Ishaq, V.P., Shukla, R., Bhonde, R.R., Sahul Hameed, A.S., 2007. Development and characterization of two new cell lines from milk fish (Chanos chanos) and grouper (Epinephelus coioides) for virus isolation. Mar. Biotechnol. 9, 281-29. 44. Parameswaran, V., Laize´, V., Cardeira, J. O., Trindade, M., Cancela, M.L., 2013. Development of an In Vitro Cell System from Zebrafish suitable to study bone cell differentiation and extracellular matrix mineralization. Zebrafish. 10, 500-509. 45. Parameswaran, V., Ravi Shukla., Bhonde, R.R., Sahul Hameed, A.S., 2006 b. Splenic cell line

oo

f

from sea bass, Lates calcarifer: establishment and characterization. Aquaculture. 261, 43-53. 46. Parameswaran, V., Ravi, S., Bhonde, R.R., Sahul Hameed, A.S., 2006 a. Establishment of

pr

embryonic cell line from sea bass (Lates calcarifer) for virus isolation. J. Virol. Methods. 137,

e-

309-316.

Pr

47. Pascoli, F., Serra, M., Toson, M., Pretto, T., Toffan, A., 2016. Betanodavirus ability to infect

1061-1068.

al

juvenile European sea bass, Dicentrarchus labrax, at different water salinity. J. Fish Dis. 39,

rn

48. Praveen Raj, J., Ezhil Praveena, P., Bhuvaneswari, T., Navaneeth Krishnan, A., Jithendran,

Jo u

K.P., 2018. Experimental infection of Betanodavirus in freshwater fish Gambusia affinis (Baird and Girard, 1853) - a potential infection model for viral encephalopathy and retinopathy. Aquacult Int. 26, 617-627. 49. Pyke, G.H., 2008. Plague minnow or mosquitofish? A review of the biology and impacts of introduced Gambusia species. Annual Rev Ecology Evolution Systematics. 39, 171-191. 50. Rathore, G., Kumar, G., Swaminathan, T.R., Sood, N., Singh, V., Abidi, R., Lakra, W.S., 2007. Primary cell culture from fin explants of Labeo rohita (Ham.). Indian J. Fish. 54, 93-97. 51. Rawson, C.A., Lim, R.P., Warne, M.S., 2008. Skeletal morphology and maturation of male Gambusia holbrooki exposed to sewage treatment plant effluent. Ecotoxicol. Environ. Saf. 70, 453-461.

21

Journal Pre-proof 52. Reed, L.J., Muench, H., 1938. A simple method of estimating fifty per cent endpoints. Am. J. Epidemiol. 27, 493-497. 53. Rougee, G.K.L., Ostrander, R.H., Richmond, Y.L., 2007. Establishment, characterization and viral susceptibility of two cell lines derived from goldfish Carassius auratus muscle and swim bladder. Dis. Aquat. Org. 77, 127- 135. 54. Ryu, J.H., Kim M.S., Kang, J.H., Kim, D.H., Nam, Y.K., Gong, S.P., 2018. Derivation of the clonal-cell lines from Siberian sturgeon (Acipenser baerii) head-kidney cell lines and its

oo

f

applicability to foreign gene expression and virus culture. J. Fish Biol. 92, 1273-1289. 55. Seale, A., 1917. The mosquitofish Gambusia affinis in the Philippines. Philipp. J. Sci. 12,

pr

177-87.

e-

56. Skliris, G. P, Richards, R.H., 1999. Nodavirus isolated from experimentally infected tilapia,

Pr

Oreochromis mossambicus (Peters). J. Fish Dis. 22, 315-318. 57. Soni, P., Pravata, K.P., Swaminathan, T.R., Neeraj, S., 2018. Development, characterization

al

and application of a new epithelial cell line from caudal fin of Pangasianodon hypophthalmus

rn

(Sauvage 1878). Acta Tropica. 182, 215-222.

Jo u

58. Souto, S., Jimena, B.L., Alonso, M.C., Rosado, E.G., Bandın, I., 2015. Experimental susceptibility of European sea bass and Senegalese sole to different betanodavirus isolates. Veterinary Microbiology. 15, 53- 61. 59. Swaminathan, T.R., Basheer, V.S., Kumar, R., Kathirvelpandian, A, Sood, N, Jena, J.K., 2015. Establishment and characterization of fin-derived cell line from ornamental carp, Cyprinus carpio koi, for virus isolation in India. In Vitro Cell. Dev. Biol. Anim. 51, 705-13. 60. Toffan, A., Pascoli, F., Pretto, T., Panzarin, V., Abbadi, M., Buratin, A., Quartesan, R., Gijon, D., Padros, F., 2017. Viral nervous necrosis in gilthead seabream (Sparus aurata) caused by reassortant betanodavirus RGNNV/SJNNV: an emerging threat for Mediterranean aquaculture. Sci. Rep. 7, 46755.

22

Journal Pre-proof 61. Wang, X., Wang, K., Nie, P., Chen, X., Ao, J.Q., 2014. Establishment and characterization of a head kidney cell line from large yellow croaker Pseudosciaena crocea. J. Fish Biol. 84, 1551-1561. 62. Xu, H., Feng, J., Guo, Z., Ou, Y., Wang, J., 2010. Detection of red-spotted grouper nervous necrosis virus by loop-mediated isothermal amplification. J. Vir. Methods. 163, 123-128. 63. Xue, T., Wang, Y. Z., Pan, Q.H., Wang, Q., Yuan, J.F., Chen, T. S., 2017. Establishment of a cell line from the kidney of black carp and its susceptibility to spring viremia of carp virus. J.

oo

f

Fish Dis. ;41, 365-374.

64. Yang, O.Z.L., Huang, X.H., Huang, E.Y., Huang, Y.H., Gong, J., 2010. Establishment and

e-

akaara. J. Fish Biol. 77, 1083-1095.

pr

characterization of a new marine fish cell line derived from red-spotted grouper Epinephelus

Pr

65. Yoshikoshi, K., Inoue, K., 1990. Viral nervous necrosis in hatchery-reared larvae and

rn Jo u

269-277.

al

juveniles of Japanese parrotfish, Oplegnathus fascatus Temmink and Schlegel. J. Fish Dis. 13,

23

Journal Pre-proof Figure Legends Figure. 1. Morphology and characterization of SGA cell line. (A) Cells from the primary culture leaving the skin fragments and colonize the surface of the flask. (B) Cells at Passage 5. (C) Passage 15. (D) Passage 38. (E) Distribution of chromosome numbers in SGA cells at 30th passage showing modal number 48 and figure insert shows karyotype of SGA cells showing 24 pairs of chromosomes. (F) Cell proliferation in different FBS concentration at 20 th passage. (G) Expression of an epithelial

f

marker in SGA cells labelled with anti-cytokeratin and FITC conjugated secondary antibody. (H)

oo

Expression of enhanced red fluorescent protein in SGA cells transfected with Ds-Red2 plasmid. (I)

pr

PCR amplification of the coi-I gene fragment from SGA cells and tissue, Lane 1- 100 bp marker; 2-

e-

negative control (without DNA); 3- SGA cells; 4- skin tissue of G. affinis. The average size of the single-cell was 5 to 7 µM. P in figure B-D refers to passage. Scale bar is 50 µM in A-D, 3 µM in E

al

Pr

and 10 µM in G and H.

Figure. 2. Virus susceptibility of SGA cell line infected by two strains of betanodavirus (SJNNV and

rn

RGNNV). A and D show uninfected control cells. B and C show CPE in SJNNV infected SGA cells

Jo u

at 3 dpi and 7 dpi respectively. E and F show CPE in RGNNV infected cells at 3 dpi and 7 dpi respectively. Arrows in figure C and F show multiple vacuolations in the cells. Insert in figures C and F shows multiple vacuolations inside the cells at higher magnification (40X). (G) Replication efficiency of SJNNV and RGNNV in SGA cell line showing virus titre. (H) RT-PCR detection of viral gene (222 bp and 212 bp) in SGA cell line at 5 and 7 dpi (Lane 1- 100 bp marker; 2 and 3RGNNV infected cells at 5 and 7 dpi respectively; 4 and 5- SJNNV infected cells at 5 and 7 dpi respectively; 6- control cells; 7- negative control (no template (cDNA)). Scale bar is 50 µM in A, B, D, E and 20 µM in C and F. Scale bar is 10 µM in figure inserts.

24

Journal Pre-proof Figure. 3. Experimental challenge of RGNNV isolates in G. affinis. Figure A-C shows morphological observation during the challenge experiment, A- Control group showing no clinical signs. BDescaling in fish and redness in the head region. C- Skin darkening at 10 dpi in challenged fish. (D) Cumulative mortality in the challenged group and control group. (E) Virus titre in RGNNV challenged fishes. (F) RT-PCR confirmation of RGNNV isolate in the infected group of fishes postchallenge (Lane 1- negative control (no template (cDNA)); 2- control group; 3- survivor fish at 30 dpi; 4- 100 bp marker; 5, 6 and 7- RGNNV infected group at 5, 15 and 25 dpi showing product of 222

Jo u

rn

al

Pr

e-

pr

oo

f

bp. Scale bar in figure A-C is 1 cm.

25

Journal Pre-proof

Table.1. Primer sequences used in the study Gene Name

Primer Sequence

GenBank Accession Number

Product Size

Annealing Temperature

RGNNV

F - CACGCAGTTGGACATTGCTC

KX575831.1

222 bp

62 °C

D30814.1

212 bp

62 °C

214 bp

55 °C

R - TGCGCGTCAGAGTAGTAAGC SJNNV

F - AGAACTCCTGCCACGGCT

oo

F - TGCCATTTTCGCAGGGTTTG

AP004422.1

rn

al

Pr

e-

pr

R - TGAGCCGATTGAGGACACTG

Jo u

coi-I

f

R - TCCTTCCCGGTTGAGGTC

26

Journal Pre-proof Highlights: 

A novel epithelial cell line was developed from the skin of Mosquito fish (Gambuisa affinis) and designated as SGA.



SGA cell line was used to isolate and propagate fish betanodavirus.



SGA will be a useful tool for the isolation of viruses and preparation of viral vaccines against

Jo u

rn

al

Pr

e-

pr

oo

f

fish betanodavirus.

27

Journal Pre-proof Declaration of interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

The authors declare that they have no competing interests.

Jo u

rn

al

Pr

e-

pr

oo

f

Supplementary Figure 1. Sequence alignment of A) Gambusia affinis (coi-I gene) (Identity index96%) B) SJNNV coat protein (Identity index- 100%) C) RGNNV capsid protein (Identity index99.9%). SGA– Skin Gambusia affinis; GB- GenBank; RGNNV- Red spotted grouper nervous necrosis virus; SJNNV- Striped-jack nervous necrosis virus.

28

Figure 1

Figure 2

Figure 3