- Email: [email protected]
Development of a high-throughput human rhinovirus infectivity cell-based assay for identifying antiviral compounds
Journal of Virological Methods 173 (2011) 182–188
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Development of a high-throughput human rhinovirus infectivity cell-based assay for identifying antiviral compounds Tim Phillips a,∗ , Lesley Jenkinson a,1 , Christopher McCrae b,2 , Bob Thong a , John Unitt a a b
Bioscience, AstraZeneca R&D Charnwood, Loughborough, Bakewell Road, Leicestershire LE11 5RH, United Kingdom AstraZeneca R&D Mölndal, Pepparedsleden 1, SE-431 83 Mölndal, Sweden
a b s t r a c t Article history: Received 29 October 2010 Received in revised form 25 January 2011 Accepted 1 February 2011 Available online 15 February 2011 Keywords: Human rhinovirus HRV serotypes High-throughput screen HTS HeLa OHIO Cytopathic effect CellTiter-Glo Antiviral agents
Asthma and chronic obstructive pulmonary disease exacerbations are associated with human rhinovirus (HRV) lung infections for which there are no current effective antiviral therapies. To date, HRV infectivity of cells in vitro has been measured by a variety of biochemical and immunological methods. This paper describes the development of a high-throughput HRV infectivity assay using HeLa OHIO cells and a chemiluminescent-based ATP cell viability system, CellTiter-Glo from Promega, to measure HRVinduced cytopathic effect (CPE). This CellTiter-Glo assay was validated with standard antiviral agents and employed to screen AstraZeneca compounds for potential antiviral activity. Compound potency values in this assay correlated well with the quantitative RT-PCR assay measuring HRV infectivity and replication in human primary airway epithelial cells. In order to improve pan-HRV screening capability, compound potency was also measured in the CellTiter-Glo assay with a combination of 3 different HRV serotypes. This HRV serotype combination assay could be used to identify quickly compounds with desirable broad spectrum antiviral activity. © 2011 Elsevier B.V. All rights reserved.
1. Introduction HRV is a member of the picornavirus family and an important causative agent of the common cold. Although HRV infections are mostly mild and self-limiting they represent a significant economic burden, especially in loss of working hours to society and commerce (Rohde, 2009). This global financial burden is increased further by recent findings that HRV is a common pathogen associated with acute exacerbations in asthma and chronic obstructive pulmonary disease (van Rijt et al., 2005; Seemungal et al., 2000; Gern, 2009; Leung et al., 2010; Jackson and Johnston, 2010). Therefore the economic and commercial benefit of an effective antiviral therapy to treat these clinical conditions is enormous. Although there are many current therapies for relieving the symptoms of the common cold (Simasek and Blandino, 2007), there are no approved anti-HRV agents on the market.
∗ Corresponding author. Tel.: +44 01509 645926; fax: +44 01509 645506. E-mail addresses: [email protected] (T. Phillips), [email protected] (L. Jenkinson), [email protected] (C. McCrae), [email protected] (B. Thong), [email protected] (J. Unitt). 1 Present address: MedImmune, Milstein Building, Granta Park, Cambridge CB21 6GH, United Kingdom. 2 Present address: AstraZeneca R&D Mölndal, Pepparedsleden 1, SE-431 83 Mölndal, Sweden. 0166-0934/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2011.02.002
In a recent publication by De Palma et al. (2008), they reviewed potential mechanisms for inhibiting HRV infectivity and replication. These mechanisms include (i) blocking viral attachment, entry and uncoating (e.g. viral capsid proteins, intercellular cell adhesion molecule-1 receptor (ICAM-1R) and low density lipoprotein receptors (LDL-R)), (ii) protein processing and replication (e.g. 3C and 2A proteases, and polymerases), and (iii) assembly and release (e.g. RNA encapsidation). There are known compounds that inhibit selectively each of these processes in the virus lifecycle. Of interest are several structurally related small molecule compounds that inhibit HRV attachment to host cells. These compounds include pirodavir, pleconaril and BTA-798 (Hayden et al., 2003; Barnard et al., 2004; De Palma et al., 2008; Rohde, 2009) that work by binding to the hydrophobic pocket within the virus protein 1 (VP-1), part of the virus capsid. Integration of the small molecule inhibitor into the hydrophobic pocket prevents HRV attachment and entry into the host cell either via the host cell proteins ICAM1R or LDL-R. It has now been recognised that the major group HRV serotypes employ ICAM-1R and the minor group use LDL-R for entry into the host cells. Although these anti-HRV compounds show promising preclinical and/or preliminary clinical results by reducing lung viral load following infection, they face further challenges (e.g. DMPK, broad spectrum activity, resistance) to achieve the acceptable clinical efficacy required by the regulatory bodies. There are dedicated efforts by some pharmaceutical companies (e.g. Merck, Janssen, Biota) to find novel anti-HRV agents and this paper
T. Phillips et al. / Journal of Virological Methods 173 (2011) 182–188
describes the undertakings here at AstraZeneca. The key objective is to identify novel compounds with better oral DMPK properties that inhibit the entry and replication of HRV in the host cell, and so alleviate viral-driven exacerbations in asthma and chronic obstructive pulmonary disease, leading to an improved quality of life for patients. There are many biochemical and immunological methods employed to screen compounds for antiviral activity (Last-Barney et al., 1991; Andries et al., 1992; Smee et al., 2002; Barnard et al., 2004; Campbell et al., 2007; Noah et al., 2007; Chu and Yang, 2007; Severson et al., 2008; Mondal et al., 2009; Li et al., 2009; Yu et al., 2009; Iro et al., 2009). A common method relies on prevention of virus mediated cell death and is quantified by the measurement of cell viability/cell death post-viral infection. Usually assays for cell viability or death may involve a variety of colorimetric, fluorometric or other detection systems. A 384-well high-throughput assay using HeLa OHIO cells, which are known to be susceptible to cell death following exposure to HRV has been developed and reported in this manuscript. This measures HeLa OHIO cell viability post-infection with HRV and the ability of test compounds to inhibit HRV mediated cell death. Cell viability is assessed at the end of the assay using CellTiter-Glo. CellTiter-Glo determines the number of viable cells by measuring ATP, a marker for metabolically active cells, using a luciferase based reaction which produces a chemiluminescent readout. The CellTiter-Glo cell assay has been validated with standard antiviral agents and then used to screen a selection of AstraZeneca compounds. Results from the CellTiter-Glo assay agreed with data generated from a physiologically relevant system, i.e. measuring HRV infectivity and replication in human airway epithelial cells by quantitative RT-PCR. To date, there are over 101 HRV serotypes (Uncapher et al., 1991; Ledford et al., 2004; Piralla et al., 2009) grouped into major (ICAM1R) and minor (LDL-R) subtypes. It is important to identify agents with the broadest possible anti-HRV serotype inhibition, as no single HRV serotype is uniquely associated with asthma or chronic obstructive pulmonary disease exacerbations. However, to test all these HRV serotypes individually in the CellTiter-Glo assay would be laborious and costly on a routine basis. Initially, a selection of three HRV serotypes (representing two major and one minor subtypes) was used in combination in the assay. Preliminary findings suggest that broad spectrum antiviral activity could be identified efficiently by this combination method. 2. Materials and methods 2.1. Chemicals and buffers All reagents were purchased from Sigma, UK, unless otherwise stated. CellTiter-Glo was purchased from Promega, UK. AstraZeneca compounds and standard antiviral agents were synthesized by the Chemistry Department, AstraZeneca R&D Charnwood, UK. 2.2. Cell culture HeLa OHIO cells (Flow Laboratories, Irvine, Scotland) were cultured in Eagle’s MEM supplemented with 10% (v/v) foetal calf serum (FCS), 1% (v/v) non-essential amino acids and l-glutamine (2 mM). When infecting HeLa OHIO cells with HRV to generate serotype stocks (see Section 2.3), cells were cultured in pH indicator free Eagles’s MEM (Gibco 51200) supplemented with 1% (v/v) nonessential amino acids and l-glutamine (2 mM) only. Cryopreserved HeLa OHIO cells were routinely used in the CellTiter-Glo assay. Cells (5 × 106 cells/ml) were slowly frozen (1 ◦ C/min) to −80 ◦ C in a freezing container (Nalgene 5100 Cryo 1 ◦ C freezing container) and stored for up to 12 months at −80 ◦ C, or for
183
Table 1 Properties of HRV serotypes used in the CellTitre-Glo assay. Human rhinovirus
Source
HRV-receptor
HRV-1b HRV-2 HRV-4 HRV-7 HRV-9 HRV-10 HRV-14 HRV-16 HRV-22 HRV-24 HRV-29 HRV-41 HRV-70 HRV-74 HRV-86 HRV-92
ATCC VR-481 ATCC VR-482 ATCC VR-484 ATCC VR-1117 ATCC VR-489 ATCC VR-490 ATCC VR-284 ATCC VR-283 ATCC VR-1132 ATCC VR-1134 ATCC VR-1139 ATCC VR-339 ATCC VR-1180 ATCC VR-1184 ATCC VR-1196 ATCC VR-1293
Minor (LDL-R) Minor (LDL-R) Major (ICAM-1R) Major (ICAM-1R) Major (ICAM-1R) Major (ICAM-1R) Major (ICAM-1R) Major (ICAM-1R) Major (ICAM-1R) Major (ICAM-1R) Minor (LDL-R) Major (ICAM-1R) Major (ICAM-1R) Major (ICAM-1R) Major (ICAM-1R) Major (ICAM-1R)
up to 2 years in a liquid nitrogen cryovessel. Cell freezing medium contained 80% (v/v) FCS, 10% (v/v) cell culture sterile filtered DMSO and 10% (v/v) Eagle’s MEM. Human primary airway epithelial cells were isolated from two human lung donors and cultured in cell growth medium (Lonza bronchial epithelial basal medium [BEBM, Lonza CC-3171]) and supplement kit (BEGM Singlequots, Lonza CC-4175). 2.3. Generating HRV serotype stocks In these experiments, the following major and minor HRV serotypes were used (see Table 1). Viral stocks were generated by infecting monolayer cultures of HeLa OHIO cells until cytopathic effects were fully developed (usually 72 h–1 week). Cells and supernatants were then harvested. Cells were disrupted by freezing and thawing (−20 ◦ C overnight), cell debris was pelleted by centrifugation and the resulting viruscontaining supernatants were stored at −80 ◦ C. These unpurified supernatants were used directly in the CellTiter-Glo assay for all serotypes apart from HRV-16, which underwent further purification before use. HRV-16 was purified from the cell culture supernatant by polyethyleneglycol (PEG) precipitation (7% (w/v) PEG 6000, 0.5 M NaCl). HRV-16 virus was resuspended from the PEG pellet in PBS and centrifuged to remove insoluble matter. The HRV-16 preparation was passed through a 0.2 m syringe filter and then buffer-exchanged into PBS using an Amicon Ultra (100.000 NMCO) centrifugal filtration device. The resulting purified HRV-16 preparation was dispensed into aliquots and stored at −80 ◦ C. CPE of the viral stocks was assessed by measuring HeLa OHIO cell viability using CellTiter-Glo. A dilution of virus stock that caused 90% CPE (the titre used was serotype and batch dependent, with the multiplicity of infection (MOI) ranging from 0.23 to 10) was selected for use in the screening assay. Further details of the CellTiter-Glo assay are included below. 2.4. CellTiter-Glo assay using a single HRV serotype The CellTiter-Glo assay measures the ability of test compounds to inhibit HRV-induced CPE in HeLa OHIO cells. Cryopreserved HeLa OHIO cells were rapidly thawed in a 37 ◦ C water bath, transferred into 35 ml warmed assay medium (Eagle’s MEM supplemented with 1% (v/v) FCS and l-glutamine (2 mM)), and centrifuged at 300 × g for 5 min. The resulting cell pellet was suspended in assay medium. Then 5000 cells per well in a volume of 30 l were dispensed into a Greiner Bio-one 384-well white, solid bottom micro-titre assay plate.
184
T. Phillips et al. / Journal of Virological Methods 173 (2011) 182–188
Test compounds were dissolved in dimethyl sulphoxide (DMSO) and were serially diluted in DMSO using half log dilutions to generate 10-point concentration response curves. These were further diluted in assay medium and then 5 l transferred to the assay plate containing HeLa OHIO cells, such that the top concentration of each compound was usually 30 M and the final DMSO concentration was 0.3% (v/v). For each HRV serotype test, a virus concentration that caused 90% CPE in HeLa OHIO cell death was used. Each HRV serotype was diluted to a 90% CPE concentration and 5 l was added to the assay plate. Assay plates were incubated at 33 ◦ C at in 95%/5% (v/v) air/CO2 and 95% relative humidity for 48 h. Thereafter, the plates were removed from the incubator and allowed to equilibrate to room temperature for 30 min. CellTiter-Glo reagents were prepared according to the manufacturer’s instructions and 5 l were added to each well. Assay plates were agitated in a plate mixer and the chemiluminescence reaction allowed to progress for 10 min in the dark. Assay plates were read for chemiluminescence using an Envision plate reader. For all HRV serotypes the known anti-viral agent pirodavir was used as the positive control compound to protect HeLa OHIO cells from HRV induced CPE. Compound induced HeLa OHIO cell toxicity (at 48 h) was measured using an identical format to the CellTiter-Glo assay (as above) with the exception that HeLa cells were not infected with HRV serotypes. Compound toxicity was further confirmed in a human monocytic leukaemia cell line THP-1 (ATC TIB202.F-11838) assay also in the absence of virus. The THP-1 cell toxicity assay was performed in a Corning 96-well plate containing 90 l THP-1 cells (40,000 cells/well) and 10 l compound or vehicle (1% v:v DMSO final assay concentration). After 24 h at 37 ◦ C, 11 l resazurin (45 M final assay concentration) was added to all wells and the conversion of resazurin to resorufin in the live cells was measured fluorometrically at Ex560 nm and Em590 nm.
• • • • • • • •
2.5. CellTiter-Glo assay using multiple HRV serotypes
3. Results
A combination of serotypes HRV-1b, HRV-16 and HRV-70 was used in the CellTiter-Glo assay. In this assay format, individual virus serotypes were mixed together in assay medium, such that the final concentration of the virus used was the same as that used in Section 2.4. All other assay conditions were identical.
3.1. Characteristics of HRV serotypes in the CellTiter-Glo assay
2.6. RT-PCR assay for HRV-1b, HRV-14 and HRV-16 infectivity and replication Human airway epithelial cells were cultured as indicated above (see Section 2.2). Cells at passage 4 were used in the infection assay. Approximately 30,000 cells per well (in 100 l culture medium) were plated out in a Corning flat bottomed 96-well polystyrene plate and incubated overnight at 37 ◦ C/5% (v/v) CO2 in a humidified incubator. Compounds were added to give a final concentration range of 10 nM to 30 M, as previously described. Virus stocks of HRV-1b, HRV-14 and HRV-16 were diluted in culture medium to give a MOI of 0.04. The plates were then incubated for 24 h at 33 ◦ C 95%/5% (v/v) air/CO2 in a humidified incubator. Supernatants were aspirated from the wells. Aliquots of 100 l of RLT lysis buffer (Qiagen) were added to the cells (including T = 2 h controls). RNA preparation was then performed using the RNeasy 96 kit (Qiagen), according to the manufacturer’s protocol. Taqman was performed using a one-step RT-PCR kit (Qiagen Quantitect Probe One step RT-PCR kit), according to the manufacturer’s protocol. Primers and probe sequences: • HRV-1b Forward: GCAACTCTCCAGGTTGTCTAAG
HRV-1b Reverse: TGCGGGTAACGATATCAGTTGT HRV-1b Probe: AGCACTTCTGTTTCCCCGGTTGACGT HRV-14 Forward: TTCCCTCCACTAGTTTGGTCGAT HRV-14 Reverse: AAGGGCGTCCCAGCATAAG HRV-14 Probe: CCTAGCCTGCGTGGCGGCC HRV-16 Forward: AGGATGTGTTGGAGAAAGGCATAC HRV-16 Reverse: GTTATGGTTGAGTCGCCTCTTGTAAT HRV-16 Probe: AAGTGTAGAAGCTTGTGGATACTCTGATAGA
The RT-PCR was carried out on a Stratagene MX3000P thermocycler, using the following conditions: 1 cycle of 30 min/50 ◦ C and 15 min/95 ◦ C; 40 cycles of 15 s/94 ◦ C and 60 s/60 ◦ C, fluorescence reading taken at end of each cycle. The standard curve was plotted using the MX3000P software, and the software performed RNA quantity calculations. Viral RNA measurements taken at 2 h post-infection were subtracted from all other viral RNA data, to control for viral RNA present in the initial inoculum. Viral RNA measurements were then normalised to total RNA levels measured in each well. This was carried out using the Ribogreen assay (Invitrogen R11490 Quant-iT Ribogreen Assay kit), according to the manufacturer’s protocol. A cell toxicity assay from Roche (cat no. 05015944001) was used to assess compound induced toxicity in the human airway epithelial cells. 2.7. Data analysis The pIC50 value (equivalent to −log10 [compound IC50 value] M) of each test compound was determined using a 4-parameter logistic equation in a non-linear curve fitting routine (Baud, 1993). The Z is defined as 1 − (3 × STDEV Pos controls + 3 × STDEV Neg controls)/[mean Pos controls − Mean Neg controls], where 1 is the optimal condition (Zhang et al., 1999).
In the CellTiter-Glo assay, a range of different major and minor HRV serotypes were shown to be effective in killing HeLa OHIO cells. This HRV-induced CPE could be prevented by the use of antiviral agents. Some examples of assay characteristics are shown in Table 2. The assay typically produces a signal-to-noise ratio of 3fold or greater and exhibits more than acceptable %CV values (<10) and Z factors (>0.5) for screening.
Table 2 Typical assay characteristics for HRV serotypes 1b, 2, 4, 16, 22, 29, 41, 70, 74 and 92 in the CellTitre-Glo assay. Assay type
Positive controla (%CV)
Negative controlb (%CV)
Z -factor
N
HRV-1b CPE HRV-2 CPE HRV-4 CPE HRV-16 CPE HRV-22 CPE HRV-29 CPE HRV-41 CPE HRV-70 CPE HRV-74 CPE HRV-92 CPE
10.0 11.4 8.1 5.6 5.5 7.1 8.7 4.8 3.9 5.5
8.8 6.4 5.7 8.2 5.0 3.1 5.8 9.7 5.9 5.0
0.6 0.7 0.7 0.6 0.7 0.8 0.6 0.7 0.8 0.7
16 16 16 16 16 16 16 16 16 16
Z -factor is described in Section 2.7. a Positive control (5 M pirodavir), with the number of replicates per experiment (N). b Negative control (0.3% DMSO in assay buffer), with the number of replicates per experiment (N).
T. Phillips et al. / Journal of Virological Methods 173 (2011) 182–188
Compound 1
120 N
N
Compound 2
N
Compound 3
100 80
% Inhibition
O
O
185
O
60 40 20
Pirodavir
0 -20
F
F
N F
N
1E-9
O N
O
Pleconaril
N
N O
BTA-798
Fig. 1. Structures of standard anti-HRV agents.
3.2. HRV serotypes CellTiter-Glo assay profiles of standard antiviral agents and AstraZeneca compounds The CellTiter-Glo assay was used to profile three standard antiviral agents, pirodavir, pleconaril and BTA-798 (see Fig. 1 for structures). In sixteen different HRV serotypes (1b, 2, 4, 7, 9, 10, 14, 16, 22, 24, 29, 41, 70, 74, 86 and 92), all three antiviral agents were able to fully protect HeLa Ohio cells from virusinduced cell death in a concentration-dependent manner. Fig. 2 illustrates the potency and concentration inhibition curves of the three standard antiviral agents for HRV-16. The potency order in this assay is pirodavir (pIC50 7.2 ± 0.4, n = 94) > BTA-798 (pIC50 6.8 ± 0.2, n = 10) > pleconaril (pIC50 6.0 ± 0.2, n = 34). 120 Pleconaril Pirodavir
100
BTA-798
% Inhibition
80
60
40
20
0
-20 1E-9
1E-8
1E-7
1E-6
1E-6
1E-5
1E-4
1E-5
Fig. 3. Typical concentration inhibition curves of three AstraZeneca compounds in the HRV-16 CellTiter-Glo assay (note: the highest concentration of Compound 3 (red triangle) has been excluded from the curve fit) (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.).
A selection of AstraZeneca molecules was screened in the CellTiter-Glo assay and the profiles of 3 interesting compounds (Compound 1 pIC50 7.1 ± 0.2, n = 5; Compound 2 pIC50 6.7 ± 0.2, n = 4; Compound 3 pIC50 7.0, n = 2) versus HRV-16 are shown in Fig. 3. Interestingly, both pleconaril and Compound 3 displayed a bellshaped inhibition profile, with <100% inhibition seen with the maximal concentration of antiviral agent used. In addition to compounds 1–3, other AstraZeneca molecules were identified with equivalent activity to the standards used.
O
O
1E-7
[Compound] (M)
O N
N
1E-8
1E-4
[Compound] (M) Fig. 2. Typical concentration inhibition curves of standard antiviral agents in the HRV-16 CellTiter-Glo assay (note: the highest concentration of pleconaril (red square) has been excluded from the curve fit) (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.).
3.3. Determination of broad spectrum antiviral activity in the CellTiter-Glo assay using a combination of 3 HRV serotypes As an extension to the individual HRV CellTiter-Glo assay, an alternative assay format was investigated that used multiple serotypes in combination (up to 3 serotypes in one well) to infect HeLa OHIO cells. This assay would allow the identification of compounds capable of inhibiting multiple serotypes in a single assay and mimic more the disease situation in multiple HRV serotypes infecting the same cells. For a compound to demonstrate an inhibitory effect under such conditions it would be required to show activity against all serotypes. However, a compound with lack of inhibition against a single serotype would potentially allow the uninhibited serotype to cause HeLa OHIO cell death and thus appear inactive in the assay. Using these experimental conditions, three standard antiviral agents and four AstraZeneca small molecules were examined against a combination of 3 HRV serotypes (i.e. HRV1b, HRV-16 and HRV-70). As shown in Fig. 4, pleconaril has a similar potency against HRV-1b (pIC50 6.6 ± 0.4, n = 34), HRV-16 (pIC50 6.0 ± 0.2, n = 34) and HRV-70 (pIC50 6.2 ± 0.2, n = 10), when tested individually or in combination (pIC50 6.0 ± 0.2, n = 3). This finding suggests that viral serotype–serotype interaction is minimal and that the serotypes behave the same when tested alone or in combination. This profile was also observed for pirodavir and BTA-798. Interestingly, similar compound inhibition profiles were seen with 5 combined HRV serotypes in the assay (1b, 2, 4, 16 and 70) (data not shown). Four AstraZeneca molecules were selected for testing in the HRV serotype combination assay. One compound (Compound 5) was inactive against all three individual serotypes, two compounds (Compounds 4 and 6) had equal potency against 2 out of 3 serotypes (i.e. inactive at HRV-1b or HRV-70, respectively), and the final
186
T. Phillips et al. / Journal of Virological Methods 173 (2011) 182–188 140
AstraZeneca compound that was inactive against HRV-70 (Compound 6, data not shown). As expected, the compound that was either active (Compound 1) or inactive (Compound 5) against all three individual HRV serotypes was also equally active or inactive respectively, when tested against a combination of serotypes (data not shown).
Pleconaril vs HRV-1b Pleconaril vs HRV-16
120
Pleconaril vs HRV-70 Pleconaril vs all 3 HRVs
100
% Inhibition
80 60
3.4. HRV profiles of AstraZeneca compounds in the RT-PCR assay using primary airway epithelial cells
40 20 0 -20 1E-9
1E-8
1E-7
1E-6
1E-5
1E-4
[Compound] (M) Fig. 4. The effect of pleconaril against single and combined HRV serotypes in the CellTiter-Glo assay. This is a representative plot from at least three independent experiments (note: the highest concentrations of pleconaril have been excluded from the curve fit). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.) Table 3 Compound potencies (pIC50 ) versus HRV-1b, 16 and 70 in the CellTiter-Glo assay. Compound
HRV-1b
HRV-16
HRV-70
Compound 1 Compound 4 Compound 5 Compound 6
7.1 ± 0.2 (5) NAa (3) NAa (3) 6.0 ± 0.1 (3)
7.0 ± 0.3 (5) 6.9 ± 0.2 (3) NAa (3) 6.3 ± 0.1(3)
5.9 ± 0.2 (3) 6.4 ± 0.2 (3) NAa (3) NAa (3)
a NA, not active (at 10 M). Arithmetic mean pIC50 value ± SD from the number of separate determinations in parenthesis.
compound (Compound 1) had similar potency against all three individual serotypes (Table 3). Compound 4 was inactive against HRV-1b and active against HRV-16 and 70 in individual serotype assays. When tested against these three serotypes in combination, Compound 4 remained inactive (see Fig. 5) despite the fact it had good inhibitory activity against HRV-16 and HRV-70. It is likely that HeLa OHIO cell death under these conditions was caused entirely by the uninhibited HRV-1b serotype. This observation was also seen for the other 120
Compound 4 vs HRV-1b Compound 4 vs HRV-16
100
Compound 4 vs HRV-70 Compound 4 vs all 3 HRVs
% Inhibition
80
60
40
20
0
-20 1E-9
1E-8
1E-7
1E-6
1E-5
[Compound] (M) Fig. 5. The effects of Compound 4 against single and combined HRV serotypes in the CellTiter-Glo assay. This is a representative plot from three independent experiments for a single serotype and one independent experiment for the combined serotypes. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
The ability of HRV to infect human primary airway epithelial cells was demonstrated with quantitative RT-PCR which measures viral RNA production. Compounds 1–3 were tested against HRV-1b, HRV-14 and HRV-16 infection of human primary airway epithelial cells using two different donors’ cells (Table 4). The potency of these three AstraZeneca compounds agreed well with the values obtained from the CellTiter-Glo assay. Under these conditions, there was no obvious toxicity of the three compounds (WST-1 kit assay by Roche). 4. Discussion The principal events involved in any viral infection of host cells are attachment, absorption, uncoating, nucleic acid/protein synthesis, assembly and release. Degenerative changes in host cell viability due to viral infection are known collectively as the cytopathic effect (CPE), which can be observed after 24–48 h post-infection. The extent and nature of these cellular changes depend on the virus serotype, type of host cells and multiplicity of infection (MOI) used. It is well recognized that for HRVs, there are two main evolutionary groups that have evolved to use either the ICAM-1R (major) or LDL-R (minor) for host cell entry (Uncapher et al., 1991; Hofer et al., 1994; Neumann et al., 2003). Normally cell-based assays for HRV infectivity are lowthroughput (e.g. 96-well or lower well format densities) that require virus plaque determination or a crystal violet readout needing multiple cell fixative steps and handling of corrosive chemicals (Smee et al., 2002; Noah et al., 2007; Campbell et al., 2007; Li et al., 2009). Four different commercial kits were evaluated (Toxilight [Lonza]; Tox-8 [Sigma]; MultitoxFluor [Promega]; CellTiter-Glo [Promega]) for measuring cell toxicity/viability using Pirodavir and BTA-798, and compared to crystal violet (data not shown). Crystal violet was not the preferred method because it was inefficient and laborious, involving many serial steps (i.e. fixative and wash steps) before the assay plate was read. The aim was to develop a simpler and quicker method with the same fidelity, but ideally with only a single addition step for the detection system and measuring live HeLa OHIO cells rather than dead cells. Based on these assay requirements, the CellTiter-Glo assay was chosen as the most suitable to develop for high-throughput screening. The CellTiter-Glo assay described here is a 384-well highthroughput homogeneous assay using cryopreserved HeLa OHIO cells, a cell line that is highly susceptible to HRV infection, resulting in cell death. One advantage of this assay is that the readout is very stable with a half-life generally >5 h, allowing greater time and flexibility for batch processing of multiple assay plates. The homogeneous format also reduces the number of plate handling steps and has higher sensitivity compared with other colorimetric and fluorometric assays tested. However, any compound that interferes directly with chemiluminescence or cell toxicity would result in a false positive. Such compounds were filtered-out during the screening process with an appropriate counter-screen assay. This assay was identical to the CellTiter-Glo assay with the exception that HeLa OHIO cells were not infected with HRV serotypes.
T. Phillips et al. / Journal of Virological Methods 173 (2011) 182–188
187
Table 4 Comparison of compound pIC50 values in the human airway epithelial cells and CellTiter-Glo assays. HRV-serotype
Compound
AEC donor 1 (pIC50 )
AEC donor 2 (pIC50 )
RT-PCR pIC50
CellTiter-Glo pIC50
HRV-14
Compound 1 Compound 2 Compound 3
6.6 NDa 6.6
6.2 6.1 6.6
6.4 6.1 6.6
6.3 6.1 6.9
HRV-16
Compound 1 Compound 2 Compound 3
7.0 NDa 7.0
6.6 7.1 7.3
6.8 7.1 7.2
7.1 6.7 7.0
HRV-1b
Compound 1 Compound 2
6.6 6.0
6.9 5.9
6.8 6.0
7.1 6.1
a
ND, not determined. Arithmetic mean pIC50 value from two separate determinations. AEC – human airway epithelial cells.
The CellTiter-Glo assay was robust, reproducible and suitable for screening of both major and minor HRV serotypes. Pleconaril was the only agent that showed activity against all the 17 serotypes suggesting that the CellTiter-Glo assay will identify broad spectrum antiviral agents. The HRV CPE potency data for the three standard antiviral agents were similar to that reported in the literature, in spite of the differences in CPE detection methods and host cell phenotype (Andries et al., 1992; Barnard et al., 2004; Ledford et al., 2004; Ryan et al., 2005). The bell-shaped inhibition curve obtained for pleconaril (see Figs. 2 and 4) is unlikely to be a result of cell toxicity, as the compound was inactive up to 30 M in HeLa OHIO (48 h) and THP-1 (24 h) cell toxicity assays. Similarly, AstraZeneca compounds that showed a bell-shaped inhibition curve were also inactive in the THP-1 or HeLa OHIO toxicity assay. The results support the use of CellTiter-Glo for measuring HRVinduced cell death of HeLa OHIO cells and potencies of antiviral compounds. This is the first report of the use of CellTiter-Glo to measure specifically HRV-induced cell death following HRV infection in HeLa OHIO cell. Previously, this chemiluminescent detection system has been used in influenza virus H3N2 infection of Madin Darby canine kidney cells (Noah et al., 2007) and in blue tongue virus infection of a BSR cell line (Li et al., 2009). HRV CPE inhibition profiles for AstraZeneca compounds and the standard antiviral agents were similar, in that all displayed full protection of HeLa OHIO cells from virus-induced CPE. The assay has successfully identified novel AstraZeneca compounds that have similar pIC50 values and HRV serotype activities to the standard antiviral agents. This data also suggests that the CellTiter-Glo assay is capable of identifying potent anti-HRV compounds. Furthermore, results from the CellTiter-Glo assay correlated well with an ICAM-1 binding FRET assay to live HRV-16 (Newton, in preparation). HeLa OHIO cells are useful model cells to measure viral infectivity, but are far removed from the human diseased target cell, i.e. lung epithelial cells. Therefore it was prudent to confirm compound potency in human primary airway epithelial cells. RT-PCR detection was used to measure HRV infection and replication within these primary lung epithelial cells. All of the three AstraZeneca compounds tested had potencies similar to the CellTiter-Glo assay (see Table 4), providing further confidence that the assay will identify active compounds in the CellTiter-Glo assay as well as in the human primary host cells. The presence of multiple HRV serotypes in the infected host is typically seen in exacerbations of chronic obstructive pulmonary disease or asthma. To simulate more closely this clinical condition and improve screening capability, a combination of multiple HRV serotypes was used in the CellTiter-Glo assay. Interestingly, the experiments consistently identified compounds with broad spectrum antiviral activity. This method was very cost effective as it reduced the total use of HRV virus, compounds and reagents, and shortened the time for iterative screening. Although only up to five different serotypes were used, it will be interesting to test the
maximal serotype capacity that can be used in the combination assay. Lastly, this high-throughput CellTiter-Glo assay for measuring HRV infectivity in HeLa OHIO cells has proved useful for identifying and progressing novel anti-HRV agents in early drug discovery. Acknowledgements Thanks to Professor Paul Corris, Freeman Hospital, Newcastle upon Tyne, for supply of human chronic obstructive pulmonary disease transplant tissue. We are grateful to Paul Willis, Sarah King, James Crawford, Philip Newton, Paul Sharpe, Derek Ogg, Audrey Soars, Gary Allenby, Paul Harper and Andy Walkland for their useful discussions and constant support. References Andries, K., Dewindt, B., Snoeks, J., Willebrords, R., Van Eemeren, K., Stokbroekx, R., Janssen, P.A.J., 1992. In vitro activity of pirodavir (R77975), a substituted phenoxy-pyridazinamide with broad-spectrum antipicornaviral activity. Antimicrob. Agents Chemother. 36, 100–107. Barnard, D.L., Hubbard, V.D., Smee, D.F., Sidwell, R.W., Watson, K.G.W., Tucker, S.P.T., Reece, P.A.R., 2004. In vitro activity of expanded-spectrum pyridazinyl oxime ethers related to Pirodavir: novel caspid-binding inhibitors with potent antipicornavirus activity. Antimicrob. Agents Chemother. 48, 1766–1772. Baud, M., 1993. Data analysis, mathematical modeling. In: Masseheff, R.F., et al. (Eds.), Methods of Immunological Analysis, vol. 1: Fundamentals. VCH Publishers Inc., New York. Campbell, C.E., Laane, M.M., Haugarvoll, E., Giaever, I., 2007. Monitoring viralinduced cell death using electric cell-substrate impedance sensing. Biosens. Bioelectron. 23, 536–542. Chu, J.J.H., Yang, P.L., 2007. C-Src protein kinase inhibitors block assembly and maturation of dengue virus. Proc. Natl. Acad. Sci. USA 104, 3520–3525. De Palma, A.M., Vliegen, I., De Clercq, E., Neyts, J., 2008. Selective inhibitors of piconarvirus replication. Med. Res. Rev. 28, 823–884. Gern, J.E., 2009. Rhinovirus and the initiation of asthma. Curr. Opin. Allergy Clin. Immunol. 9, 73–78. Hayden, F.G., Herrington, D.T., Coats, T.L., Kim, K., Cooper, E.C., Villano, S.A., Liu, S., Hudson, S., Pevear, D.C., Collett, M., McKinlay, M., 2003. Efficacy and safety of oral pleconaril for treatment of colds due to picornaviruses in adults: results of 2 double-blind, randomized, placebo-controlled trials. Clin. Infect. Dis. 36, 1523–1532. Hofer, F., Gruenberger, M., Kowalski, H., Machat, H., Huettinger, M., Kuechler, E., Blaas, D., 1994. Members of the low density lipoprotein receptor family mediate cell entry of a minor-group common cold virus. Proc. Natl. Acad. Sci. USA 91, 1839–1842. Iro, M., Witteveldt, J., Augus, A.G.N., Woerz, I., Kaul, A., Bartenschlager, R., Patel, A.H., 2009. A reporter cell line for rapid and sensitive evaluation of hepatitis C virus infectivity and replication. Antiviral Res. 83, 148–155. Jackson, D.J., Johnston, S.L., 2010. The role of viruses in acute exacerbations of asthma. J. Allergy Clin. Immunol. 125, 1178–1187. Last-Barney, K., Marlin, S.D., McNally, E.J., Cahill, C., Jeanfavre, D., Faanes, R.B., Merluzzi, V.J., 1991. Detection of major group rhinoviruses by soluble intercellular adhesion molecule-1 (sICAM-1). J. Virol. Methods 35, 255–264. Ledford, R.M., Patel, N.R., Demenczuk, T.M., Watanyar, A., Herbertz, T., Collet, M.S., Pevear, D.C., 2004. VP1 sequencing of all human rhinovirus serotypes: insight into genus phylogeny and susceptibility to antiviral capsid-binding compounds. J. Virol. 78, 3663–3674. Leung, T.F., To, M.Y., Yeung, A.C.M., Wong, Y.S., Wong, G.W.K., Chan, P.K.S., 2010. Multiplex molecular detection of respiratory pathogens in children with asthma exacerbation. Chest 137, 348–354.
188
T. Phillips et al. / Journal of Virological Methods 173 (2011) 182–188
Li, Q., Maddox, C., Rasmussen, L., Hobrath, J.V., White, L.E., 2009. Assay development and high-throughput anti-viral drug screening against Bluetongue virus. Antiviral Res. 83, 267–273. Mondal, R., Koev, G., Pilot-Matias, T., He, Y., Ng, T., Kati, W., Molla, A., 2009. Development of a cell-based assay for high-throughput screening of inhibitors against HCV genotypes 1a and 1b in a single well. Antiviral Res. 82, 82–88. Neumann, E., Moser, R., Snyers, L., Blaas, D., Hewat, E.A., 2003. A cellular receptor of human rhyinovirus Type 2, the very low density lipoprotein receptor, binds to two neighboring proteins of viral capsid. J. Virol. 77, 8504–8511. Noah, J.W., Severson, W., Noah, D.L., Rasmussen, L., White, E.L., Jonsson, C.B., 2007. A cell-based luminescence assay is effective for high-throughput screening of potential influenza antivirals. Antiviral Res. 73, 50–59. Piralla, A., Rovida, F., Campanini, G., Rognoni, V., Marchi, A., Locatelli, F., Gerna, G., 2009. Clinical severity and molecular typing of human rhinovirus C strains during a fall outbreak affecting hospitalized patients. J. Clin. Virol. 45, 311–317. Rohde, G., 2009. Drug targets in rhinoviral infections. Infect. Disord.-Drug Targets 9, 126–132. Ryan, J., Tucker, S.P., Luttick, A., Hamilton, S., Nearn, R.H., 2005. A new oral rhinovirus inhibitor BTA798. In: 18th Int. Conf. Antivir. Res. , Barcelona, April 11–14, Abstract LB-11. Seemungal, T.A.R., Harper-Owen, R., Bhowmik, A., Jeffries, D.L., Wedzicha, J.A., 2000. Detection of rhinovirus in induced sputum at exacerbation of chronic obstructive pulmonary disease. Eur. Respir. J. 16, 677–683.
Severson, W., Mcdowell, M., Ananthan, S., Chung, D.-H., Rasmussen, L., Sosa, M.I., White, E.L., Noah, J., Jonssson, C.B., 2008. High-throughput screening of a 100,000-compound library for inhibitors of influenza A virus (H3N2). J. Biomol. Screen. 13, 879–887. Simasek, M., Blandino, D.A., 2007. Treatment of the common cold. Am. Fam. Physician 75, 515–522. Smee, D.F., Morrison, A.C., Barnard, D.L., Sidwell, R.W., 2002. Comparison of colorimetric, fluorimetric and visual methods for determining anti-influenza (H1N1 and H3N2) virus activities and toxicities of compounds. J. Virol. Methods 106, 71–79. Uncapher, C.R., Dewitt, C.M., Colonno, R.J., 1991. The major and minor group receptor families contain all but one human rhinovirus serotype. Virology 180, 814–817. van Rijt, L.S., van Kessel, C.H.G., Boogaard, I., Lambrecht, B.N., 2005. Respiratory viral infections and asthma pathogenesis: a critical role for dendritic cells. J. Clin. Virol. 34, 161–169. Yu, X., Sainz Jr., B., Uprichard, S.L., 2009. Development of a cell-based Hepatitis C virus infection fluorescent resonance energy transfer assay for highthroughput antiviral compound screening. Antimicrob. Agents Chemother. 53, 4311–4319. Zhang, J.-H., Chung, T.D.Y., Oldenburg, K.R., 1999. A simple statistical parameter for use in evaluation and validation of high throughput screening assays. J. Biomol. Screen. 4, 67–73.
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Development of a high-throughput human rhinovirus infectivity cell-based assay for identifying antiviral compounds Tim Phillips a,∗ , Lesley Jenkinson a,1 , Christopher McCrae b,2 , Bob Thong a , John Unitt a a b
Bioscience, AstraZeneca R&D Charnwood, Loughborough, Bakewell Road, Leicestershire LE11 5RH, United Kingdom AstraZeneca R&D Mölndal, Pepparedsleden 1, SE-431 83 Mölndal, Sweden
a b s t r a c t Article history: Received 29 October 2010 Received in revised form 25 January 2011 Accepted 1 February 2011 Available online 15 February 2011 Keywords: Human rhinovirus HRV serotypes High-throughput screen HTS HeLa OHIO Cytopathic effect CellTiter-Glo Antiviral agents
Asthma and chronic obstructive pulmonary disease exacerbations are associated with human rhinovirus (HRV) lung infections for which there are no current effective antiviral therapies. To date, HRV infectivity of cells in vitro has been measured by a variety of biochemical and immunological methods. This paper describes the development of a high-throughput HRV infectivity assay using HeLa OHIO cells and a chemiluminescent-based ATP cell viability system, CellTiter-Glo from Promega, to measure HRVinduced cytopathic effect (CPE). This CellTiter-Glo assay was validated with standard antiviral agents and employed to screen AstraZeneca compounds for potential antiviral activity. Compound potency values in this assay correlated well with the quantitative RT-PCR assay measuring HRV infectivity and replication in human primary airway epithelial cells. In order to improve pan-HRV screening capability, compound potency was also measured in the CellTiter-Glo assay with a combination of 3 different HRV serotypes. This HRV serotype combination assay could be used to identify quickly compounds with desirable broad spectrum antiviral activity. © 2011 Elsevier B.V. All rights reserved.
1. Introduction HRV is a member of the picornavirus family and an important causative agent of the common cold. Although HRV infections are mostly mild and self-limiting they represent a significant economic burden, especially in loss of working hours to society and commerce (Rohde, 2009). This global financial burden is increased further by recent findings that HRV is a common pathogen associated with acute exacerbations in asthma and chronic obstructive pulmonary disease (van Rijt et al., 2005; Seemungal et al., 2000; Gern, 2009; Leung et al., 2010; Jackson and Johnston, 2010). Therefore the economic and commercial benefit of an effective antiviral therapy to treat these clinical conditions is enormous. Although there are many current therapies for relieving the symptoms of the common cold (Simasek and Blandino, 2007), there are no approved anti-HRV agents on the market.
∗ Corresponding author. Tel.: +44 01509 645926; fax: +44 01509 645506. E-mail addresses: [email protected] (T. Phillips), [email protected] (L. Jenkinson), [email protected] (C. McCrae), [email protected] (B. Thong), [email protected] (J. Unitt). 1 Present address: MedImmune, Milstein Building, Granta Park, Cambridge CB21 6GH, United Kingdom. 2 Present address: AstraZeneca R&D Mölndal, Pepparedsleden 1, SE-431 83 Mölndal, Sweden. 0166-0934/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2011.02.002
In a recent publication by De Palma et al. (2008), they reviewed potential mechanisms for inhibiting HRV infectivity and replication. These mechanisms include (i) blocking viral attachment, entry and uncoating (e.g. viral capsid proteins, intercellular cell adhesion molecule-1 receptor (ICAM-1R) and low density lipoprotein receptors (LDL-R)), (ii) protein processing and replication (e.g. 3C and 2A proteases, and polymerases), and (iii) assembly and release (e.g. RNA encapsidation). There are known compounds that inhibit selectively each of these processes in the virus lifecycle. Of interest are several structurally related small molecule compounds that inhibit HRV attachment to host cells. These compounds include pirodavir, pleconaril and BTA-798 (Hayden et al., 2003; Barnard et al., 2004; De Palma et al., 2008; Rohde, 2009) that work by binding to the hydrophobic pocket within the virus protein 1 (VP-1), part of the virus capsid. Integration of the small molecule inhibitor into the hydrophobic pocket prevents HRV attachment and entry into the host cell either via the host cell proteins ICAM1R or LDL-R. It has now been recognised that the major group HRV serotypes employ ICAM-1R and the minor group use LDL-R for entry into the host cells. Although these anti-HRV compounds show promising preclinical and/or preliminary clinical results by reducing lung viral load following infection, they face further challenges (e.g. DMPK, broad spectrum activity, resistance) to achieve the acceptable clinical efficacy required by the regulatory bodies. There are dedicated efforts by some pharmaceutical companies (e.g. Merck, Janssen, Biota) to find novel anti-HRV agents and this paper
T. Phillips et al. / Journal of Virological Methods 173 (2011) 182–188
describes the undertakings here at AstraZeneca. The key objective is to identify novel compounds with better oral DMPK properties that inhibit the entry and replication of HRV in the host cell, and so alleviate viral-driven exacerbations in asthma and chronic obstructive pulmonary disease, leading to an improved quality of life for patients. There are many biochemical and immunological methods employed to screen compounds for antiviral activity (Last-Barney et al., 1991; Andries et al., 1992; Smee et al., 2002; Barnard et al., 2004; Campbell et al., 2007; Noah et al., 2007; Chu and Yang, 2007; Severson et al., 2008; Mondal et al., 2009; Li et al., 2009; Yu et al., 2009; Iro et al., 2009). A common method relies on prevention of virus mediated cell death and is quantified by the measurement of cell viability/cell death post-viral infection. Usually assays for cell viability or death may involve a variety of colorimetric, fluorometric or other detection systems. A 384-well high-throughput assay using HeLa OHIO cells, which are known to be susceptible to cell death following exposure to HRV has been developed and reported in this manuscript. This measures HeLa OHIO cell viability post-infection with HRV and the ability of test compounds to inhibit HRV mediated cell death. Cell viability is assessed at the end of the assay using CellTiter-Glo. CellTiter-Glo determines the number of viable cells by measuring ATP, a marker for metabolically active cells, using a luciferase based reaction which produces a chemiluminescent readout. The CellTiter-Glo cell assay has been validated with standard antiviral agents and then used to screen a selection of AstraZeneca compounds. Results from the CellTiter-Glo assay agreed with data generated from a physiologically relevant system, i.e. measuring HRV infectivity and replication in human airway epithelial cells by quantitative RT-PCR. To date, there are over 101 HRV serotypes (Uncapher et al., 1991; Ledford et al., 2004; Piralla et al., 2009) grouped into major (ICAM1R) and minor (LDL-R) subtypes. It is important to identify agents with the broadest possible anti-HRV serotype inhibition, as no single HRV serotype is uniquely associated with asthma or chronic obstructive pulmonary disease exacerbations. However, to test all these HRV serotypes individually in the CellTiter-Glo assay would be laborious and costly on a routine basis. Initially, a selection of three HRV serotypes (representing two major and one minor subtypes) was used in combination in the assay. Preliminary findings suggest that broad spectrum antiviral activity could be identified efficiently by this combination method. 2. Materials and methods 2.1. Chemicals and buffers All reagents were purchased from Sigma, UK, unless otherwise stated. CellTiter-Glo was purchased from Promega, UK. AstraZeneca compounds and standard antiviral agents were synthesized by the Chemistry Department, AstraZeneca R&D Charnwood, UK. 2.2. Cell culture HeLa OHIO cells (Flow Laboratories, Irvine, Scotland) were cultured in Eagle’s MEM supplemented with 10% (v/v) foetal calf serum (FCS), 1% (v/v) non-essential amino acids and l-glutamine (2 mM). When infecting HeLa OHIO cells with HRV to generate serotype stocks (see Section 2.3), cells were cultured in pH indicator free Eagles’s MEM (Gibco 51200) supplemented with 1% (v/v) nonessential amino acids and l-glutamine (2 mM) only. Cryopreserved HeLa OHIO cells were routinely used in the CellTiter-Glo assay. Cells (5 × 106 cells/ml) were slowly frozen (1 ◦ C/min) to −80 ◦ C in a freezing container (Nalgene 5100 Cryo 1 ◦ C freezing container) and stored for up to 12 months at −80 ◦ C, or for
183
Table 1 Properties of HRV serotypes used in the CellTitre-Glo assay. Human rhinovirus
Source
HRV-receptor
HRV-1b HRV-2 HRV-4 HRV-7 HRV-9 HRV-10 HRV-14 HRV-16 HRV-22 HRV-24 HRV-29 HRV-41 HRV-70 HRV-74 HRV-86 HRV-92
ATCC VR-481 ATCC VR-482 ATCC VR-484 ATCC VR-1117 ATCC VR-489 ATCC VR-490 ATCC VR-284 ATCC VR-283 ATCC VR-1132 ATCC VR-1134 ATCC VR-1139 ATCC VR-339 ATCC VR-1180 ATCC VR-1184 ATCC VR-1196 ATCC VR-1293
Minor (LDL-R) Minor (LDL-R) Major (ICAM-1R) Major (ICAM-1R) Major (ICAM-1R) Major (ICAM-1R) Major (ICAM-1R) Major (ICAM-1R) Major (ICAM-1R) Major (ICAM-1R) Minor (LDL-R) Major (ICAM-1R) Major (ICAM-1R) Major (ICAM-1R) Major (ICAM-1R) Major (ICAM-1R)
up to 2 years in a liquid nitrogen cryovessel. Cell freezing medium contained 80% (v/v) FCS, 10% (v/v) cell culture sterile filtered DMSO and 10% (v/v) Eagle’s MEM. Human primary airway epithelial cells were isolated from two human lung donors and cultured in cell growth medium (Lonza bronchial epithelial basal medium [BEBM, Lonza CC-3171]) and supplement kit (BEGM Singlequots, Lonza CC-4175). 2.3. Generating HRV serotype stocks In these experiments, the following major and minor HRV serotypes were used (see Table 1). Viral stocks were generated by infecting monolayer cultures of HeLa OHIO cells until cytopathic effects were fully developed (usually 72 h–1 week). Cells and supernatants were then harvested. Cells were disrupted by freezing and thawing (−20 ◦ C overnight), cell debris was pelleted by centrifugation and the resulting viruscontaining supernatants were stored at −80 ◦ C. These unpurified supernatants were used directly in the CellTiter-Glo assay for all serotypes apart from HRV-16, which underwent further purification before use. HRV-16 was purified from the cell culture supernatant by polyethyleneglycol (PEG) precipitation (7% (w/v) PEG 6000, 0.5 M NaCl). HRV-16 virus was resuspended from the PEG pellet in PBS and centrifuged to remove insoluble matter. The HRV-16 preparation was passed through a 0.2 m syringe filter and then buffer-exchanged into PBS using an Amicon Ultra (100.000 NMCO) centrifugal filtration device. The resulting purified HRV-16 preparation was dispensed into aliquots and stored at −80 ◦ C. CPE of the viral stocks was assessed by measuring HeLa OHIO cell viability using CellTiter-Glo. A dilution of virus stock that caused 90% CPE (the titre used was serotype and batch dependent, with the multiplicity of infection (MOI) ranging from 0.23 to 10) was selected for use in the screening assay. Further details of the CellTiter-Glo assay are included below. 2.4. CellTiter-Glo assay using a single HRV serotype The CellTiter-Glo assay measures the ability of test compounds to inhibit HRV-induced CPE in HeLa OHIO cells. Cryopreserved HeLa OHIO cells were rapidly thawed in a 37 ◦ C water bath, transferred into 35 ml warmed assay medium (Eagle’s MEM supplemented with 1% (v/v) FCS and l-glutamine (2 mM)), and centrifuged at 300 × g for 5 min. The resulting cell pellet was suspended in assay medium. Then 5000 cells per well in a volume of 30 l were dispensed into a Greiner Bio-one 384-well white, solid bottom micro-titre assay plate.
184
T. Phillips et al. / Journal of Virological Methods 173 (2011) 182–188
Test compounds were dissolved in dimethyl sulphoxide (DMSO) and were serially diluted in DMSO using half log dilutions to generate 10-point concentration response curves. These were further diluted in assay medium and then 5 l transferred to the assay plate containing HeLa OHIO cells, such that the top concentration of each compound was usually 30 M and the final DMSO concentration was 0.3% (v/v). For each HRV serotype test, a virus concentration that caused 90% CPE in HeLa OHIO cell death was used. Each HRV serotype was diluted to a 90% CPE concentration and 5 l was added to the assay plate. Assay plates were incubated at 33 ◦ C at in 95%/5% (v/v) air/CO2 and 95% relative humidity for 48 h. Thereafter, the plates were removed from the incubator and allowed to equilibrate to room temperature for 30 min. CellTiter-Glo reagents were prepared according to the manufacturer’s instructions and 5 l were added to each well. Assay plates were agitated in a plate mixer and the chemiluminescence reaction allowed to progress for 10 min in the dark. Assay plates were read for chemiluminescence using an Envision plate reader. For all HRV serotypes the known anti-viral agent pirodavir was used as the positive control compound to protect HeLa OHIO cells from HRV induced CPE. Compound induced HeLa OHIO cell toxicity (at 48 h) was measured using an identical format to the CellTiter-Glo assay (as above) with the exception that HeLa cells were not infected with HRV serotypes. Compound toxicity was further confirmed in a human monocytic leukaemia cell line THP-1 (ATC TIB202.F-11838) assay also in the absence of virus. The THP-1 cell toxicity assay was performed in a Corning 96-well plate containing 90 l THP-1 cells (40,000 cells/well) and 10 l compound or vehicle (1% v:v DMSO final assay concentration). After 24 h at 37 ◦ C, 11 l resazurin (45 M final assay concentration) was added to all wells and the conversion of resazurin to resorufin in the live cells was measured fluorometrically at Ex560 nm and Em590 nm.
• • • • • • • •
2.5. CellTiter-Glo assay using multiple HRV serotypes
3. Results
A combination of serotypes HRV-1b, HRV-16 and HRV-70 was used in the CellTiter-Glo assay. In this assay format, individual virus serotypes were mixed together in assay medium, such that the final concentration of the virus used was the same as that used in Section 2.4. All other assay conditions were identical.
3.1. Characteristics of HRV serotypes in the CellTiter-Glo assay
2.6. RT-PCR assay for HRV-1b, HRV-14 and HRV-16 infectivity and replication Human airway epithelial cells were cultured as indicated above (see Section 2.2). Cells at passage 4 were used in the infection assay. Approximately 30,000 cells per well (in 100 l culture medium) were plated out in a Corning flat bottomed 96-well polystyrene plate and incubated overnight at 37 ◦ C/5% (v/v) CO2 in a humidified incubator. Compounds were added to give a final concentration range of 10 nM to 30 M, as previously described. Virus stocks of HRV-1b, HRV-14 and HRV-16 were diluted in culture medium to give a MOI of 0.04. The plates were then incubated for 24 h at 33 ◦ C 95%/5% (v/v) air/CO2 in a humidified incubator. Supernatants were aspirated from the wells. Aliquots of 100 l of RLT lysis buffer (Qiagen) were added to the cells (including T = 2 h controls). RNA preparation was then performed using the RNeasy 96 kit (Qiagen), according to the manufacturer’s protocol. Taqman was performed using a one-step RT-PCR kit (Qiagen Quantitect Probe One step RT-PCR kit), according to the manufacturer’s protocol. Primers and probe sequences: • HRV-1b Forward: GCAACTCTCCAGGTTGTCTAAG
HRV-1b Reverse: TGCGGGTAACGATATCAGTTGT HRV-1b Probe: AGCACTTCTGTTTCCCCGGTTGACGT HRV-14 Forward: TTCCCTCCACTAGTTTGGTCGAT HRV-14 Reverse: AAGGGCGTCCCAGCATAAG HRV-14 Probe: CCTAGCCTGCGTGGCGGCC HRV-16 Forward: AGGATGTGTTGGAGAAAGGCATAC HRV-16 Reverse: GTTATGGTTGAGTCGCCTCTTGTAAT HRV-16 Probe: AAGTGTAGAAGCTTGTGGATACTCTGATAGA
The RT-PCR was carried out on a Stratagene MX3000P thermocycler, using the following conditions: 1 cycle of 30 min/50 ◦ C and 15 min/95 ◦ C; 40 cycles of 15 s/94 ◦ C and 60 s/60 ◦ C, fluorescence reading taken at end of each cycle. The standard curve was plotted using the MX3000P software, and the software performed RNA quantity calculations. Viral RNA measurements taken at 2 h post-infection were subtracted from all other viral RNA data, to control for viral RNA present in the initial inoculum. Viral RNA measurements were then normalised to total RNA levels measured in each well. This was carried out using the Ribogreen assay (Invitrogen R11490 Quant-iT Ribogreen Assay kit), according to the manufacturer’s protocol. A cell toxicity assay from Roche (cat no. 05015944001) was used to assess compound induced toxicity in the human airway epithelial cells. 2.7. Data analysis The pIC50 value (equivalent to −log10 [compound IC50 value] M) of each test compound was determined using a 4-parameter logistic equation in a non-linear curve fitting routine (Baud, 1993). The Z is defined as 1 − (3 × STDEV Pos controls + 3 × STDEV Neg controls)/[mean Pos controls − Mean Neg controls], where 1 is the optimal condition (Zhang et al., 1999).
In the CellTiter-Glo assay, a range of different major and minor HRV serotypes were shown to be effective in killing HeLa OHIO cells. This HRV-induced CPE could be prevented by the use of antiviral agents. Some examples of assay characteristics are shown in Table 2. The assay typically produces a signal-to-noise ratio of 3fold or greater and exhibits more than acceptable %CV values (<10) and Z factors (>0.5) for screening.
Table 2 Typical assay characteristics for HRV serotypes 1b, 2, 4, 16, 22, 29, 41, 70, 74 and 92 in the CellTitre-Glo assay. Assay type
Positive controla (%CV)
Negative controlb (%CV)
Z -factor
N
HRV-1b CPE HRV-2 CPE HRV-4 CPE HRV-16 CPE HRV-22 CPE HRV-29 CPE HRV-41 CPE HRV-70 CPE HRV-74 CPE HRV-92 CPE
10.0 11.4 8.1 5.6 5.5 7.1 8.7 4.8 3.9 5.5
8.8 6.4 5.7 8.2 5.0 3.1 5.8 9.7 5.9 5.0
0.6 0.7 0.7 0.6 0.7 0.8 0.6 0.7 0.8 0.7
16 16 16 16 16 16 16 16 16 16
Z -factor is described in Section 2.7. a Positive control (5 M pirodavir), with the number of replicates per experiment (N). b Negative control (0.3% DMSO in assay buffer), with the number of replicates per experiment (N).
T. Phillips et al. / Journal of Virological Methods 173 (2011) 182–188
Compound 1
120 N
N
Compound 2
N
Compound 3
100 80
% Inhibition
O
O
185
O
60 40 20
Pirodavir
0 -20
F
F
N F
N
1E-9
O N
O
Pleconaril
N
N O
BTA-798
Fig. 1. Structures of standard anti-HRV agents.
3.2. HRV serotypes CellTiter-Glo assay profiles of standard antiviral agents and AstraZeneca compounds The CellTiter-Glo assay was used to profile three standard antiviral agents, pirodavir, pleconaril and BTA-798 (see Fig. 1 for structures). In sixteen different HRV serotypes (1b, 2, 4, 7, 9, 10, 14, 16, 22, 24, 29, 41, 70, 74, 86 and 92), all three antiviral agents were able to fully protect HeLa Ohio cells from virusinduced cell death in a concentration-dependent manner. Fig. 2 illustrates the potency and concentration inhibition curves of the three standard antiviral agents for HRV-16. The potency order in this assay is pirodavir (pIC50 7.2 ± 0.4, n = 94) > BTA-798 (pIC50 6.8 ± 0.2, n = 10) > pleconaril (pIC50 6.0 ± 0.2, n = 34). 120 Pleconaril Pirodavir
100
BTA-798
% Inhibition
80
60
40
20
0
-20 1E-9
1E-8
1E-7
1E-6
1E-6
1E-5
1E-4
1E-5
Fig. 3. Typical concentration inhibition curves of three AstraZeneca compounds in the HRV-16 CellTiter-Glo assay (note: the highest concentration of Compound 3 (red triangle) has been excluded from the curve fit) (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.).
A selection of AstraZeneca molecules was screened in the CellTiter-Glo assay and the profiles of 3 interesting compounds (Compound 1 pIC50 7.1 ± 0.2, n = 5; Compound 2 pIC50 6.7 ± 0.2, n = 4; Compound 3 pIC50 7.0, n = 2) versus HRV-16 are shown in Fig. 3. Interestingly, both pleconaril and Compound 3 displayed a bellshaped inhibition profile, with <100% inhibition seen with the maximal concentration of antiviral agent used. In addition to compounds 1–3, other AstraZeneca molecules were identified with equivalent activity to the standards used.
O
O
1E-7
[Compound] (M)
O N
N
1E-8
1E-4
[Compound] (M) Fig. 2. Typical concentration inhibition curves of standard antiviral agents in the HRV-16 CellTiter-Glo assay (note: the highest concentration of pleconaril (red square) has been excluded from the curve fit) (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.).
3.3. Determination of broad spectrum antiviral activity in the CellTiter-Glo assay using a combination of 3 HRV serotypes As an extension to the individual HRV CellTiter-Glo assay, an alternative assay format was investigated that used multiple serotypes in combination (up to 3 serotypes in one well) to infect HeLa OHIO cells. This assay would allow the identification of compounds capable of inhibiting multiple serotypes in a single assay and mimic more the disease situation in multiple HRV serotypes infecting the same cells. For a compound to demonstrate an inhibitory effect under such conditions it would be required to show activity against all serotypes. However, a compound with lack of inhibition against a single serotype would potentially allow the uninhibited serotype to cause HeLa OHIO cell death and thus appear inactive in the assay. Using these experimental conditions, three standard antiviral agents and four AstraZeneca small molecules were examined against a combination of 3 HRV serotypes (i.e. HRV1b, HRV-16 and HRV-70). As shown in Fig. 4, pleconaril has a similar potency against HRV-1b (pIC50 6.6 ± 0.4, n = 34), HRV-16 (pIC50 6.0 ± 0.2, n = 34) and HRV-70 (pIC50 6.2 ± 0.2, n = 10), when tested individually or in combination (pIC50 6.0 ± 0.2, n = 3). This finding suggests that viral serotype–serotype interaction is minimal and that the serotypes behave the same when tested alone or in combination. This profile was also observed for pirodavir and BTA-798. Interestingly, similar compound inhibition profiles were seen with 5 combined HRV serotypes in the assay (1b, 2, 4, 16 and 70) (data not shown). Four AstraZeneca molecules were selected for testing in the HRV serotype combination assay. One compound (Compound 5) was inactive against all three individual serotypes, two compounds (Compounds 4 and 6) had equal potency against 2 out of 3 serotypes (i.e. inactive at HRV-1b or HRV-70, respectively), and the final
186
T. Phillips et al. / Journal of Virological Methods 173 (2011) 182–188 140
AstraZeneca compound that was inactive against HRV-70 (Compound 6, data not shown). As expected, the compound that was either active (Compound 1) or inactive (Compound 5) against all three individual HRV serotypes was also equally active or inactive respectively, when tested against a combination of serotypes (data not shown).
Pleconaril vs HRV-1b Pleconaril vs HRV-16
120
Pleconaril vs HRV-70 Pleconaril vs all 3 HRVs
100
% Inhibition
80 60
3.4. HRV profiles of AstraZeneca compounds in the RT-PCR assay using primary airway epithelial cells
40 20 0 -20 1E-9
1E-8
1E-7
1E-6
1E-5
1E-4
[Compound] (M) Fig. 4. The effect of pleconaril against single and combined HRV serotypes in the CellTiter-Glo assay. This is a representative plot from at least three independent experiments (note: the highest concentrations of pleconaril have been excluded from the curve fit). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.) Table 3 Compound potencies (pIC50 ) versus HRV-1b, 16 and 70 in the CellTiter-Glo assay. Compound
HRV-1b
HRV-16
HRV-70
Compound 1 Compound 4 Compound 5 Compound 6
7.1 ± 0.2 (5) NAa (3) NAa (3) 6.0 ± 0.1 (3)
7.0 ± 0.3 (5) 6.9 ± 0.2 (3) NAa (3) 6.3 ± 0.1(3)
5.9 ± 0.2 (3) 6.4 ± 0.2 (3) NAa (3) NAa (3)
a NA, not active (at 10 M). Arithmetic mean pIC50 value ± SD from the number of separate determinations in parenthesis.
compound (Compound 1) had similar potency against all three individual serotypes (Table 3). Compound 4 was inactive against HRV-1b and active against HRV-16 and 70 in individual serotype assays. When tested against these three serotypes in combination, Compound 4 remained inactive (see Fig. 5) despite the fact it had good inhibitory activity against HRV-16 and HRV-70. It is likely that HeLa OHIO cell death under these conditions was caused entirely by the uninhibited HRV-1b serotype. This observation was also seen for the other 120
Compound 4 vs HRV-1b Compound 4 vs HRV-16
100
Compound 4 vs HRV-70 Compound 4 vs all 3 HRVs
% Inhibition
80
60
40
20
0
-20 1E-9
1E-8
1E-7
1E-6
1E-5
[Compound] (M) Fig. 5. The effects of Compound 4 against single and combined HRV serotypes in the CellTiter-Glo assay. This is a representative plot from three independent experiments for a single serotype and one independent experiment for the combined serotypes. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
The ability of HRV to infect human primary airway epithelial cells was demonstrated with quantitative RT-PCR which measures viral RNA production. Compounds 1–3 were tested against HRV-1b, HRV-14 and HRV-16 infection of human primary airway epithelial cells using two different donors’ cells (Table 4). The potency of these three AstraZeneca compounds agreed well with the values obtained from the CellTiter-Glo assay. Under these conditions, there was no obvious toxicity of the three compounds (WST-1 kit assay by Roche). 4. Discussion The principal events involved in any viral infection of host cells are attachment, absorption, uncoating, nucleic acid/protein synthesis, assembly and release. Degenerative changes in host cell viability due to viral infection are known collectively as the cytopathic effect (CPE), which can be observed after 24–48 h post-infection. The extent and nature of these cellular changes depend on the virus serotype, type of host cells and multiplicity of infection (MOI) used. It is well recognized that for HRVs, there are two main evolutionary groups that have evolved to use either the ICAM-1R (major) or LDL-R (minor) for host cell entry (Uncapher et al., 1991; Hofer et al., 1994; Neumann et al., 2003). Normally cell-based assays for HRV infectivity are lowthroughput (e.g. 96-well or lower well format densities) that require virus plaque determination or a crystal violet readout needing multiple cell fixative steps and handling of corrosive chemicals (Smee et al., 2002; Noah et al., 2007; Campbell et al., 2007; Li et al., 2009). Four different commercial kits were evaluated (Toxilight [Lonza]; Tox-8 [Sigma]; MultitoxFluor [Promega]; CellTiter-Glo [Promega]) for measuring cell toxicity/viability using Pirodavir and BTA-798, and compared to crystal violet (data not shown). Crystal violet was not the preferred method because it was inefficient and laborious, involving many serial steps (i.e. fixative and wash steps) before the assay plate was read. The aim was to develop a simpler and quicker method with the same fidelity, but ideally with only a single addition step for the detection system and measuring live HeLa OHIO cells rather than dead cells. Based on these assay requirements, the CellTiter-Glo assay was chosen as the most suitable to develop for high-throughput screening. The CellTiter-Glo assay described here is a 384-well highthroughput homogeneous assay using cryopreserved HeLa OHIO cells, a cell line that is highly susceptible to HRV infection, resulting in cell death. One advantage of this assay is that the readout is very stable with a half-life generally >5 h, allowing greater time and flexibility for batch processing of multiple assay plates. The homogeneous format also reduces the number of plate handling steps and has higher sensitivity compared with other colorimetric and fluorometric assays tested. However, any compound that interferes directly with chemiluminescence or cell toxicity would result in a false positive. Such compounds were filtered-out during the screening process with an appropriate counter-screen assay. This assay was identical to the CellTiter-Glo assay with the exception that HeLa OHIO cells were not infected with HRV serotypes.
T. Phillips et al. / Journal of Virological Methods 173 (2011) 182–188
187
Table 4 Comparison of compound pIC50 values in the human airway epithelial cells and CellTiter-Glo assays. HRV-serotype
Compound
AEC donor 1 (pIC50 )
AEC donor 2 (pIC50 )
RT-PCR pIC50
CellTiter-Glo pIC50
HRV-14
Compound 1 Compound 2 Compound 3
6.6 NDa 6.6
6.2 6.1 6.6
6.4 6.1 6.6
6.3 6.1 6.9
HRV-16
Compound 1 Compound 2 Compound 3
7.0 NDa 7.0
6.6 7.1 7.3
6.8 7.1 7.2
7.1 6.7 7.0
HRV-1b
Compound 1 Compound 2
6.6 6.0
6.9 5.9
6.8 6.0
7.1 6.1
a
ND, not determined. Arithmetic mean pIC50 value from two separate determinations. AEC – human airway epithelial cells.
The CellTiter-Glo assay was robust, reproducible and suitable for screening of both major and minor HRV serotypes. Pleconaril was the only agent that showed activity against all the 17 serotypes suggesting that the CellTiter-Glo assay will identify broad spectrum antiviral agents. The HRV CPE potency data for the three standard antiviral agents were similar to that reported in the literature, in spite of the differences in CPE detection methods and host cell phenotype (Andries et al., 1992; Barnard et al., 2004; Ledford et al., 2004; Ryan et al., 2005). The bell-shaped inhibition curve obtained for pleconaril (see Figs. 2 and 4) is unlikely to be a result of cell toxicity, as the compound was inactive up to 30 M in HeLa OHIO (48 h) and THP-1 (24 h) cell toxicity assays. Similarly, AstraZeneca compounds that showed a bell-shaped inhibition curve were also inactive in the THP-1 or HeLa OHIO toxicity assay. The results support the use of CellTiter-Glo for measuring HRVinduced cell death of HeLa OHIO cells and potencies of antiviral compounds. This is the first report of the use of CellTiter-Glo to measure specifically HRV-induced cell death following HRV infection in HeLa OHIO cell. Previously, this chemiluminescent detection system has been used in influenza virus H3N2 infection of Madin Darby canine kidney cells (Noah et al., 2007) and in blue tongue virus infection of a BSR cell line (Li et al., 2009). HRV CPE inhibition profiles for AstraZeneca compounds and the standard antiviral agents were similar, in that all displayed full protection of HeLa OHIO cells from virus-induced CPE. The assay has successfully identified novel AstraZeneca compounds that have similar pIC50 values and HRV serotype activities to the standard antiviral agents. This data also suggests that the CellTiter-Glo assay is capable of identifying potent anti-HRV compounds. Furthermore, results from the CellTiter-Glo assay correlated well with an ICAM-1 binding FRET assay to live HRV-16 (Newton, in preparation). HeLa OHIO cells are useful model cells to measure viral infectivity, but are far removed from the human diseased target cell, i.e. lung epithelial cells. Therefore it was prudent to confirm compound potency in human primary airway epithelial cells. RT-PCR detection was used to measure HRV infection and replication within these primary lung epithelial cells. All of the three AstraZeneca compounds tested had potencies similar to the CellTiter-Glo assay (see Table 4), providing further confidence that the assay will identify active compounds in the CellTiter-Glo assay as well as in the human primary host cells. The presence of multiple HRV serotypes in the infected host is typically seen in exacerbations of chronic obstructive pulmonary disease or asthma. To simulate more closely this clinical condition and improve screening capability, a combination of multiple HRV serotypes was used in the CellTiter-Glo assay. Interestingly, the experiments consistently identified compounds with broad spectrum antiviral activity. This method was very cost effective as it reduced the total use of HRV virus, compounds and reagents, and shortened the time for iterative screening. Although only up to five different serotypes were used, it will be interesting to test the
maximal serotype capacity that can be used in the combination assay. Lastly, this high-throughput CellTiter-Glo assay for measuring HRV infectivity in HeLa OHIO cells has proved useful for identifying and progressing novel anti-HRV agents in early drug discovery. Acknowledgements Thanks to Professor Paul Corris, Freeman Hospital, Newcastle upon Tyne, for supply of human chronic obstructive pulmonary disease transplant tissue. We are grateful to Paul Willis, Sarah King, James Crawford, Philip Newton, Paul Sharpe, Derek Ogg, Audrey Soars, Gary Allenby, Paul Harper and Andy Walkland for their useful discussions and constant support. References Andries, K., Dewindt, B., Snoeks, J., Willebrords, R., Van Eemeren, K., Stokbroekx, R., Janssen, P.A.J., 1992. In vitro activity of pirodavir (R77975), a substituted phenoxy-pyridazinamide with broad-spectrum antipicornaviral activity. Antimicrob. Agents Chemother. 36, 100–107. Barnard, D.L., Hubbard, V.D., Smee, D.F., Sidwell, R.W., Watson, K.G.W., Tucker, S.P.T., Reece, P.A.R., 2004. In vitro activity of expanded-spectrum pyridazinyl oxime ethers related to Pirodavir: novel caspid-binding inhibitors with potent antipicornavirus activity. Antimicrob. Agents Chemother. 48, 1766–1772. Baud, M., 1993. Data analysis, mathematical modeling. In: Masseheff, R.F., et al. (Eds.), Methods of Immunological Analysis, vol. 1: Fundamentals. VCH Publishers Inc., New York. Campbell, C.E., Laane, M.M., Haugarvoll, E., Giaever, I., 2007. Monitoring viralinduced cell death using electric cell-substrate impedance sensing. Biosens. Bioelectron. 23, 536–542. Chu, J.J.H., Yang, P.L., 2007. C-Src protein kinase inhibitors block assembly and maturation of dengue virus. Proc. Natl. Acad. Sci. USA 104, 3520–3525. De Palma, A.M., Vliegen, I., De Clercq, E., Neyts, J., 2008. Selective inhibitors of piconarvirus replication. Med. Res. Rev. 28, 823–884. Gern, J.E., 2009. Rhinovirus and the initiation of asthma. Curr. Opin. Allergy Clin. Immunol. 9, 73–78. Hayden, F.G., Herrington, D.T., Coats, T.L., Kim, K., Cooper, E.C., Villano, S.A., Liu, S., Hudson, S., Pevear, D.C., Collett, M., McKinlay, M., 2003. Efficacy and safety of oral pleconaril for treatment of colds due to picornaviruses in adults: results of 2 double-blind, randomized, placebo-controlled trials. Clin. Infect. Dis. 36, 1523–1532. Hofer, F., Gruenberger, M., Kowalski, H., Machat, H., Huettinger, M., Kuechler, E., Blaas, D., 1994. Members of the low density lipoprotein receptor family mediate cell entry of a minor-group common cold virus. Proc. Natl. Acad. Sci. USA 91, 1839–1842. Iro, M., Witteveldt, J., Augus, A.G.N., Woerz, I., Kaul, A., Bartenschlager, R., Patel, A.H., 2009. A reporter cell line for rapid and sensitive evaluation of hepatitis C virus infectivity and replication. Antiviral Res. 83, 148–155. Jackson, D.J., Johnston, S.L., 2010. The role of viruses in acute exacerbations of asthma. J. Allergy Clin. Immunol. 125, 1178–1187. Last-Barney, K., Marlin, S.D., McNally, E.J., Cahill, C., Jeanfavre, D., Faanes, R.B., Merluzzi, V.J., 1991. Detection of major group rhinoviruses by soluble intercellular adhesion molecule-1 (sICAM-1). J. Virol. Methods 35, 255–264. Ledford, R.M., Patel, N.R., Demenczuk, T.M., Watanyar, A., Herbertz, T., Collet, M.S., Pevear, D.C., 2004. VP1 sequencing of all human rhinovirus serotypes: insight into genus phylogeny and susceptibility to antiviral capsid-binding compounds. J. Virol. 78, 3663–3674. Leung, T.F., To, M.Y., Yeung, A.C.M., Wong, Y.S., Wong, G.W.K., Chan, P.K.S., 2010. Multiplex molecular detection of respiratory pathogens in children with asthma exacerbation. Chest 137, 348–354.
188
T. Phillips et al. / Journal of Virological Methods 173 (2011) 182–188
Li, Q., Maddox, C., Rasmussen, L., Hobrath, J.V., White, L.E., 2009. Assay development and high-throughput anti-viral drug screening against Bluetongue virus. Antiviral Res. 83, 267–273. Mondal, R., Koev, G., Pilot-Matias, T., He, Y., Ng, T., Kati, W., Molla, A., 2009. Development of a cell-based assay for high-throughput screening of inhibitors against HCV genotypes 1a and 1b in a single well. Antiviral Res. 82, 82–88. Neumann, E., Moser, R., Snyers, L., Blaas, D., Hewat, E.A., 2003. A cellular receptor of human rhyinovirus Type 2, the very low density lipoprotein receptor, binds to two neighboring proteins of viral capsid. J. Virol. 77, 8504–8511. Noah, J.W., Severson, W., Noah, D.L., Rasmussen, L., White, E.L., Jonsson, C.B., 2007. A cell-based luminescence assay is effective for high-throughput screening of potential influenza antivirals. Antiviral Res. 73, 50–59. Piralla, A., Rovida, F., Campanini, G., Rognoni, V., Marchi, A., Locatelli, F., Gerna, G., 2009. Clinical severity and molecular typing of human rhinovirus C strains during a fall outbreak affecting hospitalized patients. J. Clin. Virol. 45, 311–317. Rohde, G., 2009. Drug targets in rhinoviral infections. Infect. Disord.-Drug Targets 9, 126–132. Ryan, J., Tucker, S.P., Luttick, A., Hamilton, S., Nearn, R.H., 2005. A new oral rhinovirus inhibitor BTA798. In: 18th Int. Conf. Antivir. Res. , Barcelona, April 11–14, Abstract LB-11. Seemungal, T.A.R., Harper-Owen, R., Bhowmik, A., Jeffries, D.L., Wedzicha, J.A., 2000. Detection of rhinovirus in induced sputum at exacerbation of chronic obstructive pulmonary disease. Eur. Respir. J. 16, 677–683.
Severson, W., Mcdowell, M., Ananthan, S., Chung, D.-H., Rasmussen, L., Sosa, M.I., White, E.L., Noah, J., Jonssson, C.B., 2008. High-throughput screening of a 100,000-compound library for inhibitors of influenza A virus (H3N2). J. Biomol. Screen. 13, 879–887. Simasek, M., Blandino, D.A., 2007. Treatment of the common cold. Am. Fam. Physician 75, 515–522. Smee, D.F., Morrison, A.C., Barnard, D.L., Sidwell, R.W., 2002. Comparison of colorimetric, fluorimetric and visual methods for determining anti-influenza (H1N1 and H3N2) virus activities and toxicities of compounds. J. Virol. Methods 106, 71–79. Uncapher, C.R., Dewitt, C.M., Colonno, R.J., 1991. The major and minor group receptor families contain all but one human rhinovirus serotype. Virology 180, 814–817. van Rijt, L.S., van Kessel, C.H.G., Boogaard, I., Lambrecht, B.N., 2005. Respiratory viral infections and asthma pathogenesis: a critical role for dendritic cells. J. Clin. Virol. 34, 161–169. Yu, X., Sainz Jr., B., Uprichard, S.L., 2009. Development of a cell-based Hepatitis C virus infection fluorescent resonance energy transfer assay for highthroughput antiviral compound screening. Antimicrob. Agents Chemother. 53, 4311–4319. Zhang, J.-H., Chung, T.D.Y., Oldenburg, K.R., 1999. A simple statistical parameter for use in evaluation and validation of high throughput screening assays. J. Biomol. Screen. 4, 67–73.