- Email: [email protected]
Development of a loop-mediated isothermal amplification for rapid detection of orf virus
Journal of Virological Methods 157 (2009) 200–204
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Development of a loop-mediated isothermal amplification for rapid detection of orf virus Su-Ming Tsai b,1 , Kun-Wei Chan a,1 , Wei-Li Hsu b , Tien-Jye Chang a , Min-Liang Wong a , Chi-Young Wang a,∗ a
Department of Veterinary Medicine, College of Veterinary Medicine, National Chung Hsing University, 250 Road Kuo Kuang, Taichung 402, Taiwan Graduate Institute of Microbiology and Public Health, College of Veterinary Medicine, National Chung Hsing University, Taichung 402, Taiwan b
a b s t r a c t Article history: Received 23 October 2008 Received in revised form 24 December 2008 Accepted 12 January 2009 Available online 30 January 2009 Keywords: orf virus Loop-mediated isothermal amplification (LAMP) PCR Nested PCR
A loop-mediated isothermal amplification (LAMP) assay using six primers targeting a highly conserved region of the B2L gene has been developed to diagnose orf virus. The assay produces a ladder-like pattern of products on an agarose gel that can be specifically digested with BsrGI enzyme. The sensitivity of the LAMP assay, which was determined to be a single copy of the standard plasmid, was 100 fold and 10 fold higher than PCR and nested PCR, respectively; furthermore, no cross-reactivity was founded with the other tested viruses. By staining the products directly in the tube with PicoGreen or ethidium bromide, the products can be visualized with a similar sensitivity as by gel electrophoresis. Clinical samples were tested using PCR, nested PCR and LAMP assay and the positive rates were 60%, 70% and 70%, respectively. The LAMP assay allows easy, rapid, accurate and sensitive detection of infection with orf virus and is especially applicable in a resource-limited situation. © 2009 Elsevier B.V. All rights reserved.
1. Introduction The orf virus (ORFV) is a double-stranded DNA virus belonging to Parapoxvirus genus of Poxviridae family. The virus particle, with a size of 260 nm × 160 nm, has a cocoon shape with a regular spiral arrangement of surface tubules (Chan et al., 2007). There are 131 putative genes located within the virus genome, which is about 139 kbp in size. The genes are arranged in an orderly manner from the left to the right side and the conserved region, which includes essential genes such as the viral RNA polymerase, is located in the central region (Delhon et al., 2004). The orf virus has a world-wide distribution and causes an infectious skin disease known as contagious ecthyma in goats, sheep and other ruminants (Haig and McInnes, 2002). The disease lesions are characterized by a proliferative dermatitis in lips, nostrils, gums, tongues and teats (Murphy et al., 1999). Although it appears as a mild disease to lambs, mortality can reach 90% in young sheep because they are more predisposed to secondary infections in severe cases (Mondal et al., 2006). In addition orf is zoonotic and is known to cause nodular and papillomatous lesions in farmers, veterinarians and butchers who have
∗ Corresponding author. Tel.: +886 4 22840369 48; fax: +886 4 22862073. E-mail address: [email protected] (C.-Y. Wang). 1 Both the authors contributed equally to this work. 0166-0934/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2009.01.003
had contact with infected livestock and their products (Torfason and Gunadottir, 2002). The routes of infection for humans include accidental abrasions, cutting, shearing, slaughtering and milking (Robinson and Mercer, 1995). The duration of the lesions ranges from 4 to 9 weeks, but normal healing may be prolonged due to complications (Torfason and Gunadottir, 2002). Generally, other than using electron microscopy at a high cost, PCR based detection of the B2L gene, which encodes a major envelope protein, has been the most widely used approach to diagnosis of orf and this method has shown good sensitivity and specificity (Inoshima et al., 2000; Mondal et al., 2006). However, this assay requires skilled technicians and specialized instrumentation. Loop-mediated isothermal amplification (LAMP) is a novel method that amplifies DNA with speedily and with high sensitivity under isothermal conditions using a specific set of primers and a DNA polymerase with strand displacement activity (Notomi et al., 2000). To date, it has been successfully developed to diagnose pseudorabies virus (PRV), avian influenza virus, human immunodeficiency virus (HIV), hepatitis B virus and foot-and-mouth disease virus (FMDV) (Curtis et al., 2008; Dukes et al., 2006; En et al., 2008; Imai et al., 2007; Li et al., 2005). It is especially useful in resource-limited situations. In this study, a LAMP assay was developed and compared with conventional PCR and nested PCR for the detection of orf virus. This approach was found to be an excellent tool with high sensitivity, high specificity and fast turn around time.
S.-M. Tsai et al. / Journal of Virological Methods 157 (2009) 200–204
201
Table 1 Primers for the detection of orf virus. Primer name a,c
F3 B3a , c FIP (F1c + F2)a BIP (B1c + B2)a LFa LBa OVB2LFb OVB2LRb a b c
Type
Sequences (5 -3 )
Length (bp)
Forward outer Reverse outer Forward inner Reverse inner Forward loop Reverse loop Forward Reverse
GCGCAGGGCAACATGA GCTCGTCAGCGTCCTT GTTGCAGCAGAAGCTGCAGATGGCACCCTCGACTGCTTCAC GGACAAGCTATGCACGCTCGCCTTGCTCTGCACGTCCA TTCTTCGCGGACTCGGC TAAGGAGGGCGTCGACGTCAC TCCCTGAAGCCCTATTATTTTTGTG GCTTGCGGGCGTTCGGACCTTC
16 16 41 38 17 21 25 22
LAMP primers. PCR primers. Nested PCR primers.
2. Materials and methods
2.2. Designing the LAMP primers
2.1. DNA extraction and construction of a standard plasmid
The LAMP primers were designed using Primer Explorer V3 software based on a conserved region of the B2L gene identified by sequence alignment (Chan et al., 2007). The end stability of the candidate primers needs to follow the rule that the free energies of the 3 ends of F2/B2, F3/B3, LF/LB and of the 5 ends of F1c/B1c are less than −4 kcal/mol.
Samples were collected from the skin lesions around the muzzle and lips of goats during an outbreak of orf infection and DNA was extracted using the QlAamp DNA Mini Kit (Qiagen) according to the manufacturer’s protocol. Briefly, samples were homogenized in 0.1 M phosphate buffer saline, extracted with lysis buffer containing 1 mg/ml proteinase K and incubated at 56 ◦ C overnight. The product was passed through the column and the DNA was eluted in 20 l water. A standard plasmid, pT-Easy-B2L, was constructed by insertion of a B2L gene fragment generated using the OVB2LF1 and OVB2LR1 primers into the pT-Easy plasmid (Promega, USA). All primers used in this study are listed in Table 1. After verification by sequencing, the amount of plasmid present were measured spectrophotometrically using one OD260 = 50 g/ml and then the copy number was calculated by the formula: amount (copies/l) = 6 × 1023 (copies/mol) × concentration (g/l)/MW (g/mol).
2.3. LAMP detection, PCR and nested PCR The PCR reactions were performed in a 25 l reaction mixture, which contained 2.5 l of 10× buffer, 0.2 mM of each dNTP, 0.1 M of OVB2LF1 and OVB2LR1 primers, 1 l of extracted DNA and 0.5 l of Taq polymerase (5 units/l; NEB, USA). The PCR reactions were subjected to 94 ◦ C for 10 min and then 35 cycles consisting of denaturation at 94 ◦ C for 1 min, annealing at 55 ◦ C for 45 s and extension at 72 ◦ C for 1 min with one final extension at 72 ◦ C for 10 min. The second amplification of the nested PCR was performed with the same program except using 0.1 M of the F3 and B3 primers.
Fig. 1. A region of the B2L gene of the orf virus was used to design the LAMP primers (A) and a schematic representation of inner primers (FIP and BIP), outer primers (F3 and B3) and loop primers (LF and LB), which are composed of the complementary sequences of the region between F1/F2 and B1/B2, respectively (B).
202
S.-M. Tsai et al. / Journal of Virological Methods 157 (2009) 200–204
The LAMP reaction was carried out in a volume of 25 l containing 1 × ThermoPol buffer (NEB, USA), 8.0 mM MgSO4 , 0.4 M betaine (Sigma, USA), 1.2 mM dNTPs, 8U Bst polymerase (NEB, USA), 0.2 M of each of the F3 and B3 primers, 1.6 M of each of the FIP and BIP primers, 0.8 M of each of the LoopF and LoopB primers and 1 l of extracted DNA as template. The amplification was performed at 65 ◦ C in a laboratory water bath for 1 h. A control containing no template was included in each test as the negative control. The products were visualized with the naked eye under a UV lamp after addition of an intercalating dyes, PicoGreen (Invitrogen, USA) or ethidium bromide. They were also separated on a 2% agarose gel in 0.5 × TBE buffer, followed by staining with ethidium bromide and visualization on a UV transilluminator. To further confirm the specificity of products, 2 l of the reaction mixture was digested with BsrGI at 37 ◦ C for 4 h. 2.4. Optimization of the LAMP assay conditions An evaluation of the effects of different concentrations of MgSO4 (2–12 mM), of different concentrations of betaine (0–1.2 M), the amplification temperature (61–67 ◦ C), the amount of dNTPs present (0–1.2 mM), the reaction time (15–75 min) and the ratio of outer and inner primers (1:1–1:12) were carried out to optimize the LAMP reaction. A hundred copies of the standard plasmid, pT-Easy-B2L, were used for each test (Fig. 1). 2.5. Sensitivity and specificity of the LAMP reaction The sensitivity of the LAMP assay was tested and compared with PCR and nested PCR using the orf virus standard plasmid
Table 2 Samples tested in this study. Sample
Geographic location
Date of sampling
Source
Host
Nantou (NT) Taiping (TP) Dachia (DC) Wufong 1st Wufong 2nd Hoping (HP) Longjing (LJ)
Nantou County Taichung County Taichung County Taichung County Taichung County Taichung County Taichung County
2006/04/04 2007/08/28 2008/03/26 2008/05/06 2008/06/23 2008/07/02 2008/07/04
Naso-oral lesion Naso-oral lesion Naso-oral lesion Naso-oral lesion Naso-oral lesion Naso-oral lesion Naso-oral lesion
Goat Goat Goat Goat Goat Goat Goat
(1–105 copies) as template. Additionally, each product was visualized under a UV lamp after addition of an intercalating dye, PicoGreen (Invitrogen, USA) or ethidium bromide. The specificity of the LAMP assay was examined using DNA or cDNA from orf virus, FMDV, PRV, influenza virus, skin samples from normal goats and Madin-Darby ovine kidney (MDOK) cells. A control lacking template was included in each test as a negative control. 2.6. Evaluation of the LAMP assay using clinical samples Twenty samples of the skin lesions around the muzzle and lips of affected goats were collected from seven outbreaks of orf disease in central Taiwan; the background information is listed in Table 2. Samples from normal goats were included as negative controls. All were tested by PCR, nested PCR and LAMP assay in parallel. The rate for the positive detection of orf virus in the samples and the sensitivity of the assay were calculated.
Fig. 2. Optimization of the LAMP reaction for orf virus. (A) The effect of MgSO4 : lane 1–6 (2, 4, 6, 8, 10 and 12 mM, respectively). (B) The effect of betaine: lane 1–7 (0, 0.2, 0.4, 0.6, 0.8, 1.0 and 1.2 M, respectively). (C) The effect of temperature: lane 1–4 (61, 63, 65 and 67 ◦ C, respectively). (D) The effect of dNTPs: lane 1–7 (0, 0.2, 0.4, 0.6, 0.8, 1.0 and 1.2 mM, respectively). (E) The effect of reaction time: 1–5 (15, 30, 45, 60 and 75 min, respectively). (F) The effect of the ratio of outer and inner primers: lane 1–5 (1:1, 1:2, 1:4, 1:8 and 1:12, respectively).
S.-M. Tsai et al. / Journal of Virological Methods 157 (2009) 200–204
203
3. Results 3.1. Optimizing the LAMP assay conditions All of the possible variables were tested. The results indicated that the Mg2+ concentration need to be at least 8 mM to give a positive reaction and no additional change was observed up to 12 mM (Fig. 2A). Slightly different yields were observed with the various amounts of betaine used and a concentration higher than 0.2 M was found to be appropriate (Fig. 2B). No difference was founded when the reaction temperature was varied from 61 to 67 ◦ C (Fig. 2C). The size of the ladder increased as the concentration of dNTPs increased and a concentration greater 0.8 mM was found to be sufficient (Fig. 2D). A positive amplification could be detected as early as 30 min and product reached a maximal level after 60 min (Fig. 2E). Although positive reactions could be obtained using primer ratios ranging from 1:1 to 1:12, a more distinct pattern was shown when the ratio was above 1:8 (Fig. 2F). Taken together, the optimal conditions for the LAMP assay were determined to 65 ◦ C for 1 h with 8.0 mM MgSO4 , 0.2 M betaine, 1.0 mM dNTPs, 0.2 M each of outer primer, 1.6 M each of inner primer, 0.4 M each of loop primer and 8U Bst polymerase. The positive LAMP reaction generated a laddering pattern with a set of bands of different sizes consisting of several inverted-repeat structures. After the enzyme digestion, the specific pattern disappeared indicating a complete digestion of amplified products (Fig. 3A). Furthermore, a white precipitation composed of magnesium pyrophosphates was observed (Fig. 3B). 3.2. Sensitivity and specificity of the LAMP assay The detection limits for the LAMP assay, the nested PCR assay and the standard PCR assay were 1, 10 and 100 copies of the stan-
Fig. 4. The sensitivity of LAMP, nested PCR and PCR (A) and visual inspection with PicoGreen or ethidium bromide staining (B). Lane M: DNA markers, lane 1–6: 105 , 104 , 103 , 102 , 10 and 1 copies/tube, respectively, and lane 7: negative control.
dard plasmid, respectively. No amplified products were detected in the negative controls. Thus, the sensitivity of LAMP was 100 fold and 10 fold higher than those of the PCR and nested PCR assays, respectively (Fig. 4A). The fluorescent green and orange colored products could be visualized after PicoGreen and ethidium bromide staining, respectively, and their sensitivities were consistent with those obtained by gel electrophoresis (Fig. 4B). Across all viruses and cells tested using the orf LAMP assay, only DNA from the orf virus was amplified and this result confirmed the specificity of this assay (Fig. 5).
Fig. 3. Agarose gel electrophoresis (A) and visual inspection of the LAMP amplification products by turbidity (B). Lane M: DNA markers, lane 1: LAMP products, lane 2: LAMP products digested with BsrGI, lane 3: negative control, 4: LAMP products, and 5: negative control.
Fig. 5. The specificity of LAMP. Lane M: DNA markers, lane 1–6: orf virus, FMDV, PRV, influenza virus, normal goat tissues and MDOK cells, respectively, and lane 7: negative control.
204
S.-M. Tsai et al. / Journal of Virological Methods 157 (2009) 200–204
Table 3 The detection rate of PCR, nested PCR, and LAMP assay for clinical samples.
Positive Negative Sensitivity (%)
PCR
Nested PCR
LAMP
12 8 60
14 6 70
14 6 70
3.3. Comparison of the detection rate of clinical samples When 20 field samples were tested, fourteen samples were diagnosed as positive for orf virus by both nested PCR and LAMP. However, only 12 samples were detected as positive by PCR (data not shown). The specificity of the PCR products from the positive samples was further confirmed by DNA sequencing. Therefore, the sensitivities of the PCR assay, the nested PCR assay and the LAMP assay were 60%, 70% and 70%, respectively (Table 3). This indicated the LAMP assay described here is more sensitive than PCR for screening of clinical samples.
in the samples did not affect the positive rate of detection as long as virus was present. A trace amount of virus beyond the limit of detection, inefficient amplifications and inhibitory substances seem to have contributed to a lower than optimum positive rate when using PCR. Even though this can be compensated for by the use of nested PCR, it is reasonable to predict a larger difference in the success rate for positive diagnosis may occur if more samples were included. orf Occurs as an endemic infection in Taiwan. To date, a vaccination program has yet to implement. Although the mortality and economical losses are not very significant orf still can cause weight loss and poor performance because the disease prevents lambs from suckling. PCR and electron microscopy are routinely used for diagnosis of orf (Inoshima et al., 2000; Torfason and Gunadottir, 2002). Based on cost and simplicity, this assay can be used as a rapid, simple and economic alternative when undertaking largescale screening and will greatly benefit world agriculture, as it will promote differentiation of orf from other diseases. Acknowledgement
4. Discussion Since Notomi et al. (2000) first described an autocycling strand displacement DNA synthesis using the Bst DNA polymerase, the LAMP method has been widely used when carrying out diagnostic testing for bacteria and viruses (Saleh et al., 2008). A reliable LAMP mostly depends on the specificity of the primer sets. Therefore, primers were selected from the highly conserved region of B2L gene of the orf virus; this DNA region has been routinely chosen as the detection targets based on sequence alignments of published strains. This region is chosen in order to ensure adequate fidelity of the assay and reduce interference due to genetic mutation. This LAMP assay developed here has numerous advantages over the systems presently in use. LAMP does not require a thermocycler because reactions can be done in a heat block or water bath under isothermal conditions. Unlike PCR, no repetitive denaturing and annealing steps are needed and the inhibitory effects from substances in samples are largely eliminated (Kaneko et al., 2007; Nagamine et al., 2001). The risk of cross-contamination is minimal because only a single step is used. In addition, the probability of an incorrect target being mistakenly amplified is rare because a successful reaction needs six independent primers concomitantly to match their respective regions in targets. As a result, only orf virus DNA is amplified from among the other viral and cellular nucleic acids present in the sample. Pilot experiments were conducted to analyze the various factors affecting the reaction condition. Mg2+ concentration and the ratio of outer and inner primers have the most profound effect on LAMP because Mg2+ is a key cofactor for DNA polymerase activity and the ratio of outer and inner primers affects the initial step in the formation of stem-loop DNA (Notomi et al., 2000). To lower the melting temperature, increase the specificity and facilitate the separation of DNA templates, betaine is routinely used in LAMP (En et al., 2008). However, the results showed that betaine is not absolutely necessary as long as the overall conditions are optimal. Furthermore, our LAMP assay worked well in a wide range of temperatures (61–67 ◦ C) and this makes it even more applicable in the fields where poor temperature control may be a factor. Other than naked-eye identification of a white precipitate, the presence of amplified DNA stained with either PicoGreen and ethidium bromide could be visualized with the same sensitivity as detection by gel electrophoresis (Mori et al., 2001). This will facilitate rapid screening of samples without the use of gel electrophoresis. In these circumstances, taking into account availability and cost, ethidium bromide is the better option. Samples taken from the skin lesions around the muzzle and lips of goats were tested. By means of the LAMP assay, non-target DNA
This work was supported partly by the grant awarded to Dr. ChiYoung Wang by the National Science Council (NSC-97-2313-B-020005-MY2), Taiwan. References Chan, K.W., Lin, J.W., Lee, S.H., Liao, C.J., Tsai, M.C., Hsu, W.L., Wong, M.L., Shih, H.C., 2007. Identification and phylogenetic analysis of orf virus from goats in Taiwan. Virus Genes 35, 705–712. Curtis, K.A., Rudolph, D.L., Owen, S.M., 2008. Rapid detection of HIV-1 by reversetranscription, loop-mediated isothermal amplification (RT-LAMP). J. Virol. Methods 151, 264–270. Delhon, G., Tulman, E.R., Afonso, C.L., Lu, Z., de la Concha-Bermejillo, A., Lehmkuhl, H.D., Piccone, M.E., Kutish, G.F., Rock, D.L., 2004. Genomes of the parapoxviruses orf virus and bovine popular stomatitis virus. J. Virol. 78, 168–177. Dukes, J.P., King, D.P., Alexandersen, S., 2006. Novel reverse transcription loopmediated isothermal amplification for rapid detection of foot-and-mouth disease virus. Arch. Virol. 151, 1093–1106. En, F.X., Wei, X., Jian, L., Qin, C., 2008. Loop-mediated isothermal amplification establishment for detection of pseudorabies virus. J. Virol. Methods 151, 35–39. Haig, D.M., McInnes, C.J., 2002. Immunity and counter-immunity during infection with the parapoxvirus orf virus. Virus Res. 88, 3–16. Imai, M., Ninomiya, A., Minekawa, H., Notomi, T., Ishizaki, T., Tu, P.V., Tien, N.T.K., Tashiro, M., Odagiri, T., 2007. Rapid diagnosis of H5N1 avian influenza virus infection by newly developed influenza H5 hemagglutinin gene-specific loop mediated isothermal amplification method. J. Virol. Methods 141, 173– 180. Inoshima, Y., Morooka, A., Sentsui, H., 2000. Detection and diagnosis of parapoxvirus by polymerase chain reaction. J. Virol. Methods 84, 201–208. Kaneko, H., Kawana, T., Fukushima, E., Suzutani, T., 2007. Tolerance of loop-mediated isothermal amplification to a culture medium and biological substances. J. Biochem. Biophys. Methods 70, 499–501. Li, Q.Y., Xu, Q.Y., Liu, N., Zhang, F.X., 2005. Loop-mediated isothermal amplification for rapid detection of hepatitis B virus. Lett. Biotechnol. 16, 647–648. Mondal, B., Bera, A.K., Hosamani, M., Tembhurne, P.A., Bandyopadhyay, S.K., 2006. Detection of orf virus from an outbreak in goats and its genetic relation with other parapoxviruses. Vet. Res. Commun. 30, 531–539. Mori, Y., Nagamine, K., Tomita, N., Notomi, T., 2001. Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophoaphate formation. Biochem. Biophys. Res. Commun. 289, 150– 154. Murphy, F.A., Gibbs, E.P.J., Horzinek, M.C., Studdert, M.J., 1999. Poxviridae. In: Murphy, F.A., Gibbs, E.P.J., Horzinek, M.C., Studdert, M.J. (Eds.), Veterinary Virology, 3rd ed. Academic Press, San Diego, pp. 277–291. Nagamine, K., Watanabe, K., Ohtsuka, K., Hase, T., Notomi, T., 2001. Loop-mediated isothermal amplification reaction using a nondenatured template. Clin. Chem. 47, 1742–1743. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucl. Acids Res. 28, e63. Robinson, A.J., Mercer, A.A., 1995. Parapoxvirus of red deer: evidence for its inclusion as a new member in the genus parapoxvirus. Virology 208, 812–815. Saleh, M., Soliman, H., El-Matbouli, M., 2008. Loop-mediated isothermal amplification as an emerging technology for detection of Yersinia ruckeri the causative agent of enteric red mouth disease in fish. BMC Vet. Res. 4, 31. Torfason, E.G., Gunadottir, S., 2002. Polymerase chain reaction for laboratory diagnosis of orf virus infections. J. Clin. Virol. 24, 79–84.
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Development of a loop-mediated isothermal amplification for rapid detection of orf virus Su-Ming Tsai b,1 , Kun-Wei Chan a,1 , Wei-Li Hsu b , Tien-Jye Chang a , Min-Liang Wong a , Chi-Young Wang a,∗ a
Department of Veterinary Medicine, College of Veterinary Medicine, National Chung Hsing University, 250 Road Kuo Kuang, Taichung 402, Taiwan Graduate Institute of Microbiology and Public Health, College of Veterinary Medicine, National Chung Hsing University, Taichung 402, Taiwan b
a b s t r a c t Article history: Received 23 October 2008 Received in revised form 24 December 2008 Accepted 12 January 2009 Available online 30 January 2009 Keywords: orf virus Loop-mediated isothermal amplification (LAMP) PCR Nested PCR
A loop-mediated isothermal amplification (LAMP) assay using six primers targeting a highly conserved region of the B2L gene has been developed to diagnose orf virus. The assay produces a ladder-like pattern of products on an agarose gel that can be specifically digested with BsrGI enzyme. The sensitivity of the LAMP assay, which was determined to be a single copy of the standard plasmid, was 100 fold and 10 fold higher than PCR and nested PCR, respectively; furthermore, no cross-reactivity was founded with the other tested viruses. By staining the products directly in the tube with PicoGreen or ethidium bromide, the products can be visualized with a similar sensitivity as by gel electrophoresis. Clinical samples were tested using PCR, nested PCR and LAMP assay and the positive rates were 60%, 70% and 70%, respectively. The LAMP assay allows easy, rapid, accurate and sensitive detection of infection with orf virus and is especially applicable in a resource-limited situation. © 2009 Elsevier B.V. All rights reserved.
1. Introduction The orf virus (ORFV) is a double-stranded DNA virus belonging to Parapoxvirus genus of Poxviridae family. The virus particle, with a size of 260 nm × 160 nm, has a cocoon shape with a regular spiral arrangement of surface tubules (Chan et al., 2007). There are 131 putative genes located within the virus genome, which is about 139 kbp in size. The genes are arranged in an orderly manner from the left to the right side and the conserved region, which includes essential genes such as the viral RNA polymerase, is located in the central region (Delhon et al., 2004). The orf virus has a world-wide distribution and causes an infectious skin disease known as contagious ecthyma in goats, sheep and other ruminants (Haig and McInnes, 2002). The disease lesions are characterized by a proliferative dermatitis in lips, nostrils, gums, tongues and teats (Murphy et al., 1999). Although it appears as a mild disease to lambs, mortality can reach 90% in young sheep because they are more predisposed to secondary infections in severe cases (Mondal et al., 2006). In addition orf is zoonotic and is known to cause nodular and papillomatous lesions in farmers, veterinarians and butchers who have
∗ Corresponding author. Tel.: +886 4 22840369 48; fax: +886 4 22862073. E-mail address: [email protected] (C.-Y. Wang). 1 Both the authors contributed equally to this work. 0166-0934/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2009.01.003
had contact with infected livestock and their products (Torfason and Gunadottir, 2002). The routes of infection for humans include accidental abrasions, cutting, shearing, slaughtering and milking (Robinson and Mercer, 1995). The duration of the lesions ranges from 4 to 9 weeks, but normal healing may be prolonged due to complications (Torfason and Gunadottir, 2002). Generally, other than using electron microscopy at a high cost, PCR based detection of the B2L gene, which encodes a major envelope protein, has been the most widely used approach to diagnosis of orf and this method has shown good sensitivity and specificity (Inoshima et al., 2000; Mondal et al., 2006). However, this assay requires skilled technicians and specialized instrumentation. Loop-mediated isothermal amplification (LAMP) is a novel method that amplifies DNA with speedily and with high sensitivity under isothermal conditions using a specific set of primers and a DNA polymerase with strand displacement activity (Notomi et al., 2000). To date, it has been successfully developed to diagnose pseudorabies virus (PRV), avian influenza virus, human immunodeficiency virus (HIV), hepatitis B virus and foot-and-mouth disease virus (FMDV) (Curtis et al., 2008; Dukes et al., 2006; En et al., 2008; Imai et al., 2007; Li et al., 2005). It is especially useful in resource-limited situations. In this study, a LAMP assay was developed and compared with conventional PCR and nested PCR for the detection of orf virus. This approach was found to be an excellent tool with high sensitivity, high specificity and fast turn around time.
S.-M. Tsai et al. / Journal of Virological Methods 157 (2009) 200–204
201
Table 1 Primers for the detection of orf virus. Primer name a,c
F3 B3a , c FIP (F1c + F2)a BIP (B1c + B2)a LFa LBa OVB2LFb OVB2LRb a b c
Type
Sequences (5 -3 )
Length (bp)
Forward outer Reverse outer Forward inner Reverse inner Forward loop Reverse loop Forward Reverse
GCGCAGGGCAACATGA GCTCGTCAGCGTCCTT GTTGCAGCAGAAGCTGCAGATGGCACCCTCGACTGCTTCAC GGACAAGCTATGCACGCTCGCCTTGCTCTGCACGTCCA TTCTTCGCGGACTCGGC TAAGGAGGGCGTCGACGTCAC TCCCTGAAGCCCTATTATTTTTGTG GCTTGCGGGCGTTCGGACCTTC
16 16 41 38 17 21 25 22
LAMP primers. PCR primers. Nested PCR primers.
2. Materials and methods
2.2. Designing the LAMP primers
2.1. DNA extraction and construction of a standard plasmid
The LAMP primers were designed using Primer Explorer V3 software based on a conserved region of the B2L gene identified by sequence alignment (Chan et al., 2007). The end stability of the candidate primers needs to follow the rule that the free energies of the 3 ends of F2/B2, F3/B3, LF/LB and of the 5 ends of F1c/B1c are less than −4 kcal/mol.
Samples were collected from the skin lesions around the muzzle and lips of goats during an outbreak of orf infection and DNA was extracted using the QlAamp DNA Mini Kit (Qiagen) according to the manufacturer’s protocol. Briefly, samples were homogenized in 0.1 M phosphate buffer saline, extracted with lysis buffer containing 1 mg/ml proteinase K and incubated at 56 ◦ C overnight. The product was passed through the column and the DNA was eluted in 20 l water. A standard plasmid, pT-Easy-B2L, was constructed by insertion of a B2L gene fragment generated using the OVB2LF1 and OVB2LR1 primers into the pT-Easy plasmid (Promega, USA). All primers used in this study are listed in Table 1. After verification by sequencing, the amount of plasmid present were measured spectrophotometrically using one OD260 = 50 g/ml and then the copy number was calculated by the formula: amount (copies/l) = 6 × 1023 (copies/mol) × concentration (g/l)/MW (g/mol).
2.3. LAMP detection, PCR and nested PCR The PCR reactions were performed in a 25 l reaction mixture, which contained 2.5 l of 10× buffer, 0.2 mM of each dNTP, 0.1 M of OVB2LF1 and OVB2LR1 primers, 1 l of extracted DNA and 0.5 l of Taq polymerase (5 units/l; NEB, USA). The PCR reactions were subjected to 94 ◦ C for 10 min and then 35 cycles consisting of denaturation at 94 ◦ C for 1 min, annealing at 55 ◦ C for 45 s and extension at 72 ◦ C for 1 min with one final extension at 72 ◦ C for 10 min. The second amplification of the nested PCR was performed with the same program except using 0.1 M of the F3 and B3 primers.
Fig. 1. A region of the B2L gene of the orf virus was used to design the LAMP primers (A) and a schematic representation of inner primers (FIP and BIP), outer primers (F3 and B3) and loop primers (LF and LB), which are composed of the complementary sequences of the region between F1/F2 and B1/B2, respectively (B).
202
S.-M. Tsai et al. / Journal of Virological Methods 157 (2009) 200–204
The LAMP reaction was carried out in a volume of 25 l containing 1 × ThermoPol buffer (NEB, USA), 8.0 mM MgSO4 , 0.4 M betaine (Sigma, USA), 1.2 mM dNTPs, 8U Bst polymerase (NEB, USA), 0.2 M of each of the F3 and B3 primers, 1.6 M of each of the FIP and BIP primers, 0.8 M of each of the LoopF and LoopB primers and 1 l of extracted DNA as template. The amplification was performed at 65 ◦ C in a laboratory water bath for 1 h. A control containing no template was included in each test as the negative control. The products were visualized with the naked eye under a UV lamp after addition of an intercalating dyes, PicoGreen (Invitrogen, USA) or ethidium bromide. They were also separated on a 2% agarose gel in 0.5 × TBE buffer, followed by staining with ethidium bromide and visualization on a UV transilluminator. To further confirm the specificity of products, 2 l of the reaction mixture was digested with BsrGI at 37 ◦ C for 4 h. 2.4. Optimization of the LAMP assay conditions An evaluation of the effects of different concentrations of MgSO4 (2–12 mM), of different concentrations of betaine (0–1.2 M), the amplification temperature (61–67 ◦ C), the amount of dNTPs present (0–1.2 mM), the reaction time (15–75 min) and the ratio of outer and inner primers (1:1–1:12) were carried out to optimize the LAMP reaction. A hundred copies of the standard plasmid, pT-Easy-B2L, were used for each test (Fig. 1). 2.5. Sensitivity and specificity of the LAMP reaction The sensitivity of the LAMP assay was tested and compared with PCR and nested PCR using the orf virus standard plasmid
Table 2 Samples tested in this study. Sample
Geographic location
Date of sampling
Source
Host
Nantou (NT) Taiping (TP) Dachia (DC) Wufong 1st Wufong 2nd Hoping (HP) Longjing (LJ)
Nantou County Taichung County Taichung County Taichung County Taichung County Taichung County Taichung County
2006/04/04 2007/08/28 2008/03/26 2008/05/06 2008/06/23 2008/07/02 2008/07/04
Naso-oral lesion Naso-oral lesion Naso-oral lesion Naso-oral lesion Naso-oral lesion Naso-oral lesion Naso-oral lesion
Goat Goat Goat Goat Goat Goat Goat
(1–105 copies) as template. Additionally, each product was visualized under a UV lamp after addition of an intercalating dye, PicoGreen (Invitrogen, USA) or ethidium bromide. The specificity of the LAMP assay was examined using DNA or cDNA from orf virus, FMDV, PRV, influenza virus, skin samples from normal goats and Madin-Darby ovine kidney (MDOK) cells. A control lacking template was included in each test as a negative control. 2.6. Evaluation of the LAMP assay using clinical samples Twenty samples of the skin lesions around the muzzle and lips of affected goats were collected from seven outbreaks of orf disease in central Taiwan; the background information is listed in Table 2. Samples from normal goats were included as negative controls. All were tested by PCR, nested PCR and LAMP assay in parallel. The rate for the positive detection of orf virus in the samples and the sensitivity of the assay were calculated.
Fig. 2. Optimization of the LAMP reaction for orf virus. (A) The effect of MgSO4 : lane 1–6 (2, 4, 6, 8, 10 and 12 mM, respectively). (B) The effect of betaine: lane 1–7 (0, 0.2, 0.4, 0.6, 0.8, 1.0 and 1.2 M, respectively). (C) The effect of temperature: lane 1–4 (61, 63, 65 and 67 ◦ C, respectively). (D) The effect of dNTPs: lane 1–7 (0, 0.2, 0.4, 0.6, 0.8, 1.0 and 1.2 mM, respectively). (E) The effect of reaction time: 1–5 (15, 30, 45, 60 and 75 min, respectively). (F) The effect of the ratio of outer and inner primers: lane 1–5 (1:1, 1:2, 1:4, 1:8 and 1:12, respectively).
S.-M. Tsai et al. / Journal of Virological Methods 157 (2009) 200–204
203
3. Results 3.1. Optimizing the LAMP assay conditions All of the possible variables were tested. The results indicated that the Mg2+ concentration need to be at least 8 mM to give a positive reaction and no additional change was observed up to 12 mM (Fig. 2A). Slightly different yields were observed with the various amounts of betaine used and a concentration higher than 0.2 M was found to be appropriate (Fig. 2B). No difference was founded when the reaction temperature was varied from 61 to 67 ◦ C (Fig. 2C). The size of the ladder increased as the concentration of dNTPs increased and a concentration greater 0.8 mM was found to be sufficient (Fig. 2D). A positive amplification could be detected as early as 30 min and product reached a maximal level after 60 min (Fig. 2E). Although positive reactions could be obtained using primer ratios ranging from 1:1 to 1:12, a more distinct pattern was shown when the ratio was above 1:8 (Fig. 2F). Taken together, the optimal conditions for the LAMP assay were determined to 65 ◦ C for 1 h with 8.0 mM MgSO4 , 0.2 M betaine, 1.0 mM dNTPs, 0.2 M each of outer primer, 1.6 M each of inner primer, 0.4 M each of loop primer and 8U Bst polymerase. The positive LAMP reaction generated a laddering pattern with a set of bands of different sizes consisting of several inverted-repeat structures. After the enzyme digestion, the specific pattern disappeared indicating a complete digestion of amplified products (Fig. 3A). Furthermore, a white precipitation composed of magnesium pyrophosphates was observed (Fig. 3B). 3.2. Sensitivity and specificity of the LAMP assay The detection limits for the LAMP assay, the nested PCR assay and the standard PCR assay were 1, 10 and 100 copies of the stan-
Fig. 4. The sensitivity of LAMP, nested PCR and PCR (A) and visual inspection with PicoGreen or ethidium bromide staining (B). Lane M: DNA markers, lane 1–6: 105 , 104 , 103 , 102 , 10 and 1 copies/tube, respectively, and lane 7: negative control.
dard plasmid, respectively. No amplified products were detected in the negative controls. Thus, the sensitivity of LAMP was 100 fold and 10 fold higher than those of the PCR and nested PCR assays, respectively (Fig. 4A). The fluorescent green and orange colored products could be visualized after PicoGreen and ethidium bromide staining, respectively, and their sensitivities were consistent with those obtained by gel electrophoresis (Fig. 4B). Across all viruses and cells tested using the orf LAMP assay, only DNA from the orf virus was amplified and this result confirmed the specificity of this assay (Fig. 5).
Fig. 3. Agarose gel electrophoresis (A) and visual inspection of the LAMP amplification products by turbidity (B). Lane M: DNA markers, lane 1: LAMP products, lane 2: LAMP products digested with BsrGI, lane 3: negative control, 4: LAMP products, and 5: negative control.
Fig. 5. The specificity of LAMP. Lane M: DNA markers, lane 1–6: orf virus, FMDV, PRV, influenza virus, normal goat tissues and MDOK cells, respectively, and lane 7: negative control.
204
S.-M. Tsai et al. / Journal of Virological Methods 157 (2009) 200–204
Table 3 The detection rate of PCR, nested PCR, and LAMP assay for clinical samples.
Positive Negative Sensitivity (%)
PCR
Nested PCR
LAMP
12 8 60
14 6 70
14 6 70
3.3. Comparison of the detection rate of clinical samples When 20 field samples were tested, fourteen samples were diagnosed as positive for orf virus by both nested PCR and LAMP. However, only 12 samples were detected as positive by PCR (data not shown). The specificity of the PCR products from the positive samples was further confirmed by DNA sequencing. Therefore, the sensitivities of the PCR assay, the nested PCR assay and the LAMP assay were 60%, 70% and 70%, respectively (Table 3). This indicated the LAMP assay described here is more sensitive than PCR for screening of clinical samples.
in the samples did not affect the positive rate of detection as long as virus was present. A trace amount of virus beyond the limit of detection, inefficient amplifications and inhibitory substances seem to have contributed to a lower than optimum positive rate when using PCR. Even though this can be compensated for by the use of nested PCR, it is reasonable to predict a larger difference in the success rate for positive diagnosis may occur if more samples were included. orf Occurs as an endemic infection in Taiwan. To date, a vaccination program has yet to implement. Although the mortality and economical losses are not very significant orf still can cause weight loss and poor performance because the disease prevents lambs from suckling. PCR and electron microscopy are routinely used for diagnosis of orf (Inoshima et al., 2000; Torfason and Gunadottir, 2002). Based on cost and simplicity, this assay can be used as a rapid, simple and economic alternative when undertaking largescale screening and will greatly benefit world agriculture, as it will promote differentiation of orf from other diseases. Acknowledgement
4. Discussion Since Notomi et al. (2000) first described an autocycling strand displacement DNA synthesis using the Bst DNA polymerase, the LAMP method has been widely used when carrying out diagnostic testing for bacteria and viruses (Saleh et al., 2008). A reliable LAMP mostly depends on the specificity of the primer sets. Therefore, primers were selected from the highly conserved region of B2L gene of the orf virus; this DNA region has been routinely chosen as the detection targets based on sequence alignments of published strains. This region is chosen in order to ensure adequate fidelity of the assay and reduce interference due to genetic mutation. This LAMP assay developed here has numerous advantages over the systems presently in use. LAMP does not require a thermocycler because reactions can be done in a heat block or water bath under isothermal conditions. Unlike PCR, no repetitive denaturing and annealing steps are needed and the inhibitory effects from substances in samples are largely eliminated (Kaneko et al., 2007; Nagamine et al., 2001). The risk of cross-contamination is minimal because only a single step is used. In addition, the probability of an incorrect target being mistakenly amplified is rare because a successful reaction needs six independent primers concomitantly to match their respective regions in targets. As a result, only orf virus DNA is amplified from among the other viral and cellular nucleic acids present in the sample. Pilot experiments were conducted to analyze the various factors affecting the reaction condition. Mg2+ concentration and the ratio of outer and inner primers have the most profound effect on LAMP because Mg2+ is a key cofactor for DNA polymerase activity and the ratio of outer and inner primers affects the initial step in the formation of stem-loop DNA (Notomi et al., 2000). To lower the melting temperature, increase the specificity and facilitate the separation of DNA templates, betaine is routinely used in LAMP (En et al., 2008). However, the results showed that betaine is not absolutely necessary as long as the overall conditions are optimal. Furthermore, our LAMP assay worked well in a wide range of temperatures (61–67 ◦ C) and this makes it even more applicable in the fields where poor temperature control may be a factor. Other than naked-eye identification of a white precipitate, the presence of amplified DNA stained with either PicoGreen and ethidium bromide could be visualized with the same sensitivity as detection by gel electrophoresis (Mori et al., 2001). This will facilitate rapid screening of samples without the use of gel electrophoresis. In these circumstances, taking into account availability and cost, ethidium bromide is the better option. Samples taken from the skin lesions around the muzzle and lips of goats were tested. By means of the LAMP assay, non-target DNA
This work was supported partly by the grant awarded to Dr. ChiYoung Wang by the National Science Council (NSC-97-2313-B-020005-MY2), Taiwan. References Chan, K.W., Lin, J.W., Lee, S.H., Liao, C.J., Tsai, M.C., Hsu, W.L., Wong, M.L., Shih, H.C., 2007. Identification and phylogenetic analysis of orf virus from goats in Taiwan. Virus Genes 35, 705–712. Curtis, K.A., Rudolph, D.L., Owen, S.M., 2008. Rapid detection of HIV-1 by reversetranscription, loop-mediated isothermal amplification (RT-LAMP). J. Virol. Methods 151, 264–270. Delhon, G., Tulman, E.R., Afonso, C.L., Lu, Z., de la Concha-Bermejillo, A., Lehmkuhl, H.D., Piccone, M.E., Kutish, G.F., Rock, D.L., 2004. Genomes of the parapoxviruses orf virus and bovine popular stomatitis virus. J. Virol. 78, 168–177. Dukes, J.P., King, D.P., Alexandersen, S., 2006. Novel reverse transcription loopmediated isothermal amplification for rapid detection of foot-and-mouth disease virus. Arch. Virol. 151, 1093–1106. En, F.X., Wei, X., Jian, L., Qin, C., 2008. Loop-mediated isothermal amplification establishment for detection of pseudorabies virus. J. Virol. Methods 151, 35–39. Haig, D.M., McInnes, C.J., 2002. Immunity and counter-immunity during infection with the parapoxvirus orf virus. Virus Res. 88, 3–16. Imai, M., Ninomiya, A., Minekawa, H., Notomi, T., Ishizaki, T., Tu, P.V., Tien, N.T.K., Tashiro, M., Odagiri, T., 2007. Rapid diagnosis of H5N1 avian influenza virus infection by newly developed influenza H5 hemagglutinin gene-specific loop mediated isothermal amplification method. J. Virol. Methods 141, 173– 180. Inoshima, Y., Morooka, A., Sentsui, H., 2000. Detection and diagnosis of parapoxvirus by polymerase chain reaction. J. Virol. Methods 84, 201–208. Kaneko, H., Kawana, T., Fukushima, E., Suzutani, T., 2007. Tolerance of loop-mediated isothermal amplification to a culture medium and biological substances. J. Biochem. Biophys. Methods 70, 499–501. Li, Q.Y., Xu, Q.Y., Liu, N., Zhang, F.X., 2005. Loop-mediated isothermal amplification for rapid detection of hepatitis B virus. Lett. Biotechnol. 16, 647–648. Mondal, B., Bera, A.K., Hosamani, M., Tembhurne, P.A., Bandyopadhyay, S.K., 2006. Detection of orf virus from an outbreak in goats and its genetic relation with other parapoxviruses. Vet. Res. Commun. 30, 531–539. Mori, Y., Nagamine, K., Tomita, N., Notomi, T., 2001. Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophoaphate formation. Biochem. Biophys. Res. Commun. 289, 150– 154. Murphy, F.A., Gibbs, E.P.J., Horzinek, M.C., Studdert, M.J., 1999. Poxviridae. In: Murphy, F.A., Gibbs, E.P.J., Horzinek, M.C., Studdert, M.J. (Eds.), Veterinary Virology, 3rd ed. Academic Press, San Diego, pp. 277–291. Nagamine, K., Watanabe, K., Ohtsuka, K., Hase, T., Notomi, T., 2001. Loop-mediated isothermal amplification reaction using a nondenatured template. Clin. Chem. 47, 1742–1743. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucl. Acids Res. 28, e63. Robinson, A.J., Mercer, A.A., 1995. Parapoxvirus of red deer: evidence for its inclusion as a new member in the genus parapoxvirus. Virology 208, 812–815. Saleh, M., Soliman, H., El-Matbouli, M., 2008. Loop-mediated isothermal amplification as an emerging technology for detection of Yersinia ruckeri the causative agent of enteric red mouth disease in fish. BMC Vet. Res. 4, 31. Torfason, E.G., Gunadottir, S., 2002. Polymerase chain reaction for laboratory diagnosis of orf virus infections. J. Clin. Virol. 24, 79–84.