Development of a multiplex immunocapture PCR with colourimetric detection for viruses of banana

Journal of Virological Methods 89 (2000) 75 – 88 www.elsevier.com/locate/jviromet

Development of a multiplex immunocapture PCR with colourimetric detection for viruses of banana Murray Sharman a, John E. Thomas a,*, Ralf G. Dietzgen b a

Department of Primary Industries, Queensland Horticulture Institute, 80 Meiers Road, Indooroopilly, Qld 4068, Australia b Department of Primary Industries, Queensland Agricultural Biotechnology Centre, Gehrmann Laboratories, The Uni6ersity of Queensland, St. Lucia, Qld 4068, Australia Received 7 February 2000; received in revised form 19 May 2000; accepted 22 May 2000

Abstract A multiplex, immunocapture PCR (M-IC-PCR) was developed for the simultaneous detection of three viruses from crude sap extracts of banana and plantain (Musa spp.). A reverse transcription step was required for Banana bract mosaic 6irus and Cucumber mosaic 6irus, which have ssRNA genomes. The detection of Banana bunchy top 6irus (ssDNA genome) was not adversely affected by inclusion in this step. All the three viruses could be detected simultaneously from a mixed infection. Identification and detection of individual viruses was achieved through the visualisation of discretely sized PCR amplicons by gel electrophoresis. Alternatively, a colourimetric microplate detection system utilising digoxigenin-labelled virus-specific probes was used. The latter assay was up to five times more sensitive than detection by gel electrophoresis and between 25 and 625 times more sensitive than ELISA for the various viruses. Careful selection of PCR primers was necessary to ensure the detection of a wide range of virus isolates and to avoid detrimental interactions between heterologous templates and primers. © 2000 Elsevier Science B.V. All rights reserved. Keywords: Diagnosis; Indexing; Abaca

1. Introduction Bananas and plantains (Musa spp.) are grown as staple food items, significant cash crops and major export crops in many of the tropical and subtropical areas of the world (Anonymous, 1992). Commercial banana plants are infertile and

* Corresponding author. Tel.: +61-7-38969371; fax: + 617-38969533. E-mail address: [email protected] (J.E. Thomas).

must be propagated vegetatively. Traditionally this has been done using suckers, but more recently, many commercial operators have adopted tissue culture. Tissue culture is also used by the curators of the major germplasm collections, and is the means through which banana germplasm is exchanged internationally. Four viruses known to infect naturally bananas have been characterised as; Banana bunchy top 6irus (BBTV), Banana streak 6irus (BSV), Banana bract mosaic 6irus (BBrMV), and Cucumber mosaic 6irus (CMV)

0166-0934/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 6 - 0 9 3 4 ( 0 0 ) 0 0 2 0 4 - 4

76

M. Sharman et al. / Journal of Virological Methods 89 (2000) 75–88

(Burns et al., 1994; Diekmann and Putter, 1996 and references therein; Thomas et al., 1997). These viruses are readily transmitted in vegetative propagules (Diekmann and Putter, 1996), and therefore pose a threat to the production in areas where the viruses are endemic, as well as in areas that are virus-free, but are in receipt of new planting material. Abaca (Musa textilis) can also be infected by BBTV (Wardlaw, 1961) and BBrMV (Sharman et al., 2000). No effective resistance is known in Musa to any of these viruses, so control is still largely based on the use of virus-free planting material, roguing of infected plants and implementation of quarantine barriers. The international standard for banana virus indexing is ELISA (Diekmann and Putter, 1996), and this serological methodology is effective, although time consuming and costly. Polymerase chain reaction (PCR) detection systems are now also available for viruses of banana (Dietzgen et al., 1999; Harper et al., 1999a) although inhibitors of PCR in banana extracts have often been problematic. One solution has been the inclusion of an immunocapture (IC) step, which involves immobilisation of virions on the reaction tube wall using antibodies, and washing to remove the leaf extract containing the inhibitors (Wetzel et al., 1992; Rowhani et al., 1995; Mumford and Seal, 1997; Harper et al., 1999a). Both the ELISA and PCR systems in current use require individual tests for each virus, while indexing programs usually require concurrent testing for several viruses. Multiplex (M)-PCR has been developed for some plant viruses, and allows the detection of more than one virus in a single PCR (Bariana et al., 1994; Minafra and Hadidi, 1994; Grieco and Gallitelli, 1999). Generally, progress in development of diagnostic assays for BSV has been much slower than that for the other banana-infecting viruses. The first complete sequence for a strain of BSV (BSVOnne) has only recently become available (Harper and Hull, 1998). This strain is only one of at least four strains of BSV, which show great genomic and serological heterogeneity and have been poorly characterised (Lockhart and Olszewski, 1993; Geering and Thomas, unpublished). An additional complication is that

BSV-Onne is integrated into the Musa genome and special precautions such as immunocapture PCR need to be taken to distinguish integrated from episomal viral DNA (Harper et al., 1999b; Ndowora et al., 1999). For these reasons, diagnostic assays for BSV have been excluded from this study. This paper describes the application of multiplex immunocapture PCR for the simultaneous detection of three of the four characterised viruses of banana, two (BBrMV and CMV) with ssRNA genomes and one (BBTV) with a ssDNA genome. Additionally, a microplate system adapted from Hataya et al. (1994) was used for the colourimetric detection of PCR amplicons.

2. Methods and materials

2.1. Virus isolates Samples of BBrMV-, CMV- and BBTV-infected plant tissue (Table 1) were obtained locally or imported into Australia under Australian Quarantine and Inspection Service permit number 99607507, and stored at −70°C or as freeze dried material at − 20°C. These samples were chosen to reflect the known genomic diversity for the respective viruses (Karan et al., 1994; Thomas et al., 1997; Pares et al., 1998; Rodoni et al., 1999). Reference isolates BBTV-482 (Geering and Thomas, 1996), CMV-207 (Thomas, 1991) and BBrMV-509 (Thomas et al., 1997) were used in all the experimental work unless otherwise specified. BBTV-482 and CMV-207 were propagated in Musa sp. cv. Williams (AAA, Cavendish Subgroup) plants, which, along with healthy control plants, were grown in a glasshouse. The three reference isolates were each tested for BBTV, CMV and BBrMV by IC-PCR and ELISA and shown to contain only the virus listed above. The sequences of all the primers used during the development of the M-PCR assay are listed in Table 2. For sequence analysis, data with the following GenBank accession numbers were used: BBrMV (U88882, U88885, U88887, AF071590); CMV subgroup I (D10538), CMV subgroup II

M. Sharman et al. / Journal of Virological Methods 89 (2000) 75–88

(J02059); BBTV (S56276). CMV-207 belongs to subgroup I (Pares et al., 1998). Component 1 of BBTV-482 has been partially sequenced (Sharman

77

and Thomas, unpublished), and the sequence is identical to that of an Australian isolate characterised earlier (GenBank S56276).

Table 1 Virus isolates and uninfected control samples used in this work Plant samplesa

Isolate numberb

BBrMV BBrMV BBrMV BBrMV BBrMV+BSV BBrMV BBrMV+BBTV BBrMV+BBTV CMV sub−group I CMV sub-group II CMV sub-group II CMV sub-group II CMV CMV CMV BBTV BBTV BBTV BBTV BBTV Healthy Williams Healthy Williams Healthy Williams

509 510 560 513 556 554 717 522 207 577 149 312 725 514/6 466 482 528/1 569/1 624 537 H3 H5 H7

Country of origin

Sample storage

Reference/source

Philippines Philippines India India India Sri Lanka Sri Lanka Philippines Australia Australia Australia Australia Philippines Philippines Western Samoa Australia Egypt Western Samoa Taiwan Vietnam Australia Australia Australia

−70°C −70°C −70°C −70°C −70°C −70°C −70°C −70°C Freshc F.D. (29/1/1996)d −70°C F.D. (15/12/1997) −70°C −70°C F.D. (24/8/1993) Fresh −70°C −70°C F.D. (16/5/1996) −70°C Fresh Fresh Fresh

Thomas et al., 1997 Thomas et al., 1997 Thomas et al., 1997 Thomas et al., 1997 Thomas et al., 1997 Thomas et al., 1997 E.M. Dassanayake J.L. Dale Authors Authors Authors Authors L. Magnaye L. Magnaye Authors Geering and Thomas, 1996 J.L. Dale Authors H.-J. Su J.L. Dale Authors Authors Authors

a All the isolates were from banana or plantain tissue (Musa spp.), except CMV-149 which was from Nicotiana glutinosa and isolate 522 which was from abaca (Musa textilis). b Queensland Department of Primary Industries, Plant Virus Collection isolate number. c Fresh tissue. d Freeze dried tissue (date of preparation).

Table 2 Primer sequences and target templates Primer name

Primer sequence (5%“ 3%)

Target virus

Reference

U341 D341 Poty1 Pot1 Pot2 CMV3% CMV5% BBT1 BBT2 bract1 bract2

CCGGAATTCATGRTITGGTGYATIGAIAAYGG CGCGGATCCGCIGYYTTCATYTGIRIIWKIGC GGATCCCGGGTTTTTTTTTTTTTTTTTV GACTGGATCCATTBTCDATRCACCA GACGAATTCTGYGAYGCBGATGGYTC TTTTAGCCGTAAGCTGGATGGACAACCC TATGATAAGAAGCTTGTTTCGCGCA CTCGTCATGTGCAAGGTTATGTCG GAAGTTCTCCAGCTATTCATCGCC GACATCACCAAATTTGAATGGCACATGG CCATTATCACTCGATCAATACCTCACAG

BBrMV BBrMV BBrMV BBrMV BBrMV CMV CMV BBTV BBTV BBrMV BBrMV

Langeveld et al., 1991 Langeveld et al., 1991 Based on Gibbs and Mackenzie, 1997 Colinet and Kummert, 1993 Colinet and Kummert, 1993 Bariana et al., 1994 Bariana et al., 1994 Thomson and Dietzgen, 1995 Thomson and Dietzgen, 1995 Rodoni et al., 1997 Rodoni et al., 1997

78

M. Sharman et al. / Journal of Virological Methods 89 (2000) 75–88

2.2. Serology The following antisera were used in this study: anti-CMV-TF (rabbit polyclonal from R.I.B. Francki), anti-BBrMV (rabbit polyclonal, Thomas et al., 1997) and anti-BBTV (rabbit polyclonal and, BT-1 and BT-2 mouse monoclonal; Geering and Thomas, 1996). Initial serological comparisons were done using double antibody sandwich (DAS)-ELISA (Clark and Adams, 1977) for BBrMV, DAS-ELISA and biotin/streptavidin ELISA (Thomas, 1991) for CMV, and triple antibody sandwich (TAS)ELISA for BBTV (Geering and Thomas, 1996). Polystyrene microplates (Nunc-Immuno Maxisorp, Nalge Nunc International, Roskilde, Denmark) were used. For the CMV and BBrMV ELISAs, reaction volumes were 100 ml, but for the BBTV ELISA, all the reaction volumes were 50 ml except for the substrate (100 ml). Incubations were for 2–4 h at room temperature or overnight at 5°C. Between steps, microplates were washed three times with phosphate-buffered saline (PBS) containing 0.05% Tween 20 (PBS-T), 3 min each wash. Enzyme substrate was 1 mg/ml p-nitrophenyl phosphate in 10% diethanolamine buffer, pH 9.8, and absorbance at 410 nm (A410 nm) was measured using a Dynatech MR7000 plate reader. Samples with a mean absorbance at least twice that of appropriate healthy controls were considered positive. For CMV DAS- and biotin/streptavidin ELISA, microplates were coated with 5 mg/ml immunoglobulins (Ig) and sap extracts diluted 1:50 in CMV extraction buffer (0.05 M citrate, pH 8.0, containing 0.5 mM EDTA, 2% PVP, 0.05% Tween-20 and 0.5% monothiogylcerol) adapted from Thomas (1991). For CMV DAS-ELISA, alkaline phosphatase conjugate (Sanofi, Marnes la Coquette, France) was diluted 1:100 in PBS-T containing 1% skim milk. CMV biotin/streptavidin ELISA was used for optimising extraction buffer, Ig and extract concentration, after which the DAS-ELISA was utilised. For BBrMV DASELISA, microplates were coated with Ig at 3 mg/ml, sap extracts diluted 1:10 in 0.2 M potassium phosphate, pH 7.0, containing 15 mM EDTA, 2% PVP, 2% PEG 6000 and 0.04%

Na2SO3 (adapted from Ahlawat et al., 1996) and alkaline phosphatase conjugate diluted 1:500 in a healthy banana sap extract (1 g tissue/50 ml PBST). In attempts to find a common extraction buffer for all the three viruses, comparisons were made between the specific extraction buffers described above, PBS-T containing either 0.2% albumin, 2% PVP or 0.13% Na2SO3, and the CMV extraction buffer with 1% skim milk powder added instead of the PVP.

2.3. Immunocapture re6erse transcription (RT) -PCR To establish the suitability of thin-walled 600 ml tubes (Quantum Scientific, Brisbane, Australia) for the immunocapture of virions, parallel ELISAs were done in the tubes and in a microplate with all the three viruses extracted using the CMV-milk extraction buffer as common extraction buffer (CEB). Hydrolysed substrate from tubes was transferred to a microplate and A410 nm read in the plate reader. Once it was demonstrated that virions could be captured in the tubes, the optimum common extraction dilution and antibody coating concentration were determined for each virus by IC-PCR. Extract dilutions were 1:10, 1:100, 1:1000 and 1:10 000 in CEB, antibody coating dilutions were 10, 1, 0.1, and 0.01 mg/ml in 0.05 M sodium carbonate buffer, pH 9.6, and reaction volumes were 50 ml. Antibody and sap extract incubation steps were for 2–3 h at room temperature. RT-PCR was completed as given; cDNA synthesis was done in the IC tube using the Pharmacia First-Strand cDNA Synthesis Kit (Amersham Life Science, Buckinghamshire, England) essentially as described in the manufacturer’s instructions, except that virions were disrupted at 80°C for 10 min. For convenience, extracts containing virions with both RNA and DNA genomes underwent the RT step. PCR amplification was performed essentially as described below (Section 2.6), in separate tubes for each virus, with the primers Pot1 and Pot2 for BBrMV, BBT1 and BBT2 for BBTV, and CMV3% and CMV5% for CMV. PCR products were electrophoresed as described below (Section 2.7.1).

M. Sharman et al. / Journal of Virological Methods 89 (2000) 75–88

2.4. cDNA synthesis A range of RT methods were utilised during the development of the final assay. Tth DNA polymerase, Moloney murine leukemia virus (MMuLV) and avian myeloblastis virus (AMV) reverse transcriptases (RTases) were used in either one or two step RT-PCR. Four one-tube RT-PCR systems were trialed. Tth DNA polymerase (Roche Diagnostics, Basel, Switzerland), AMV RTase in the Titan RT-PCR System (Roche Diagnostics) and SuperScript I RTase in SuperScript One-Step RT-PCR System (Life Technologies, Rockville, Maryland, USA) were used essentially according to the manufacturers’ instructions. RT was carried out for 30 min at 50°C for the Titan system followed by cycling parameters as used for the M-PCR (refer to Section 2.6). Also, SuperScript I RTase was used essentially as described by Thomas et al. (1997) except 5 nmoles of each dNTP and 50 U of SuperScript I RT were used and RT was for 45 min at 47°C followed by cycling parameters as used for the M-PCR. The primers used were Poty1 and U341 (20 pmol each), BBT1 and BBT2 (5 pmol each), and CMV3% and CMV5% (10 pmol each) either combined or used separately as virusspecific primer pairs. Three two tube RT-PCR systems (i.e. separate RT step) were put through a trial. The FirstStrand cDNA Synthesis Kit (Amersham), and SuperScript I and SuperScript II RTases (Life Technologies) were used according to the manufacturers’ recommendations with the following exceptions; 30 pmol each of downstream primers Poty1 or Pot1 for BBrMV and CMV3% for CMV were used (either together or separately); immuno-captured template or 1:10 TNAE (Thomas et al., 1997) were used; virion disruption was at 80°C for 10 min; and ca. 20 U of RNAguard RNase inhibitor (Amersham) was used. SuperScript I was used at 100 U per reaction and RT was performed at 47°C for 1 h. SuperScript II was used as for SuperScript I, except that reaction volumes were doubled to a total volume of 40 ml (amount of primers and enzymes remained the same), 0.3 mg of acetylated BSA (Life Technologies)/reaction was added (Nathan and Fox, 1997)

79

and RT was done at 50°C for 45 min followed by 15 min at 70°C.

2.5. Determination of common PCR conditions for all 6iruses Initial virus-specific PCRs were based on those published for BBTV (Thomson and Dietzgen, 1995), BBrMV (Thomas et al., 1997) and CMV (Bariana et al., 1994). To establish common amplification parameters, optimisation tests were carried out within the following ranges: initial denaturation for 1–2 min at 94°C, then 35 cycles of denaturation at 94°C for 20–60 s, annealing at 52–60°C for 1–3 min, and extension at 72°C for 1–2 min, and a final extension at 72°C for 0–10 min in an Omni Gene temperature cycler (Hybaid, Middlesex, UK). Minor adjustments to MgCl2, Taq DNA polymerase (Life Technologies) and primer concentrations were also made during this optimisation.

2.6. Optimised M-IC-PCR 2.6.1. Antibody coating of tubes Thin-walled 600 ml tubes were coated with 50 ml of an antibody mixture containing BBTV polyclonal Ig and CMV Ig both at 1 mg/ml and BBrMV IgG at 5 mg/ml diluted in sterile 0.05 M sodium carbonate buffer, pH 9.6, for 2–3 h at room temperature. Tubes were washed 3× 3 min with PBS-T. 2.6.2. Test samples Leaf samples were extracted in sterile CEB (1 g/50 ml) and 50 ml of the clarified extract then incubated in the tubes for 3–4 h at room temperature or 5°C overnight. Tubes were washed 3× 3 min with ca. 500 ml of PBS-T and once briefly with sterile double distilled (dd) H2O. 2.6.3. Synthesis of cDNA To the IC tubes was added 30 pmol each of the downstream primers Poty1 and CMV3%, and ddH2O to a volume of 24.5 ml. Virions were disrupted at 80°C for 10 min, tubes were then chilled on ice and the contents centrifuged briefly. Next was added 8 ml of 5× First Strand Buffer

80

M. Sharman et al. / Journal of Virological Methods 89 (2000) 75–88

(Life Technologies), 4 ml of 0.1 M DTT, 2 ml of 10 mM dNTPs, 0.5 ml (100 U) of SuperScript II RTase, 0.5 ml (ca. 20 U) of RNAguard and 0.3 mg of acetylated BSA to give a total volume of 40 ml. RT was done at 50°C for 45 min followed by 70°C for 15 min to inactivate the RTase. The cDNA was then chilled on ice, centrifuged briefly and either used directly in PCR or stored at − 20°C.

2.6.4. PCR The PCR mix consisted of 2.5 ml of 10× PCR Buffer (Life Technologies), 1.75 mM MgCl2, 200 mM of each dNTP, 200 nM each of primers BBT1 and BBT2, 340 nM of CMV3%, 400 nM each of CMV5%, bract1, bract2 and Poty1, 1.5 U of Taq DNA polymerase (Life Technologies), 2 ml of template (from cDNA synthesis), and sterile ddH2O to a total reaction volume of 25 ml, in thin-walled 600 ml tubes. The mixtures were overlayed with ca. 30 ml of mineral oil and PCR was done using the following parameters; one cycle of 94°C for 1 min, 35 cycles of 94°C for 20 s, 60°C for 1 min and 72°C for 1 min, followed by one cycle of 72°C for 3 min. The PCR products were either used directly in the detection systems described below or stored at either 4°C or −20°C. 2.7. Systems for detection of PCR products 2.7.1. Agarose gel electrophoresis PCR products (8 ml) were separated on a 1% agarose gel in 0.5×TBE and visualised by ethidium bromide staining. 2.7.2. Colourimetric microplate detection of PCR products The method used was adapted from that of Hataya et al. (1994). Digoxigenin (DIG)-labelled probes were prepared from BBTV-482, CMV-149, CMV-207, BBrMV-509 and BBrMV-513 by PCR using DIG-11-dUTP according to the manufacturer’s instructions (Roche Diagnostics). A dUTP:dTTP ratio of 1:19 was used in a M-ICPCR mix as described earlier, except that single virus cDNA templates and PCR primer pairs were used. cDNA and viral DNA were prepared from immunocaptured virions. Probes were made

for an isolate of each subgroup of CMV and two isolates of BBrMV in order to cover the known genomic variation displayed by the two viruses. Labelled PCR products were gel-purified using a QIAEX II Gel Extraction Kit (Qiagen, Hilden, Germany). To detect PCR products, Nunc Maxisorp microplates were used and wells were washed 3× 3 min with PBS-T between steps. PCR products were denatured for 5 min at 100°C in an Omni Gene temperature cycler (Hybaid), then chilled on ice and centrifuged. The denatured PCR products were diluted 1:150 in cold 10× SSC containing 10 mM EDTA and 100 ml of diluted PCR products loaded into duplicate wells of the microplate. Microplates were incubated at 37°C for 2 h in a humid chamber. DIG-labelled probes were heat-denatured and diluted in DIG Easy Hyb solution (Roche Diagnostics) at 1:1000 for probes made to BBTV482, BBrMV-509 and -513, or 1:2000 for probes made to CMV-207 and -149. One hundred ml of the probe was loaded into the washed microplate wells, the microplate placed in a humid chamber, and incubated at 48°C for 14–16 h. After washing, 100 ml per well of anti-DIG alkaline phosphatase Fab fragments (Roche Diagnostics), diluted 1:5000 in PBS-T, were added and incubated at 37°C for 1 h in a humid chamber. Bound conjugate was detected using p-nitrophenyl phosphate as described for ELISA.

2.8. Comparison of assay formats The relative sensitivities of DAS-ELISA (CMV and BBrMV) and TAS-ELISA (BBTV) compared with M-IC-PCR using agarose gel or colourimetric microplate detection, was investigated using the final test protocol outlined above. Leaf extracts (1 g leaf/50 ml CEB) of BBTV-482, BBrMV-509 and CMV-207 were prepared as serial five-fold dilutions in a healthy banana leaf extract (1 g leaf/50 ml CEB). The concentration of virus, therefore, decreased through the dilution series, but the concentration of leaf extract remained the same. Aliquots of the dilution series were then simultaneously tested in each assay format. Furthermore, the reliability of M-IC-PCR

M. Sharman et al. / Journal of Virological Methods 89 (2000) 75–88

for detecting a range of isolates of the three test viruses was examined. Isolates that represented the known geographical and genomic diversity of each virus were selected.

3. Results

3.1. Optimisation of immunocapture parameters For each of the viruses studied, the CMV extraction buffer (containing 1% skim milk) gave positive:negative A410 nm ratios in ELISA on microplates as good or better than the other buffers tested. This buffer was, therefore, chosen as the common extraction buffer (CEB) for all the subsequent work. When a mixture of polyclonal antibodies was used to coat microfuge tubes, the following concentrations were found to be optimal; anti-BBTV, 1 mg/ml; anti-BBrMV, 5 mg/ml; and anti-CMVTF, 1 mg/ml. A sample dilution of 1:50 was found to be satisfactory for all the three viruses and was well above the detection limits when the trapped virions were assayed by PCR.

3.2. Optimisation of PCR cycling parameters Reduction of the 94°C denaturation step from 45 to 20 s was beneficial while no loss in sensitivity resulted from raising the annealing temperature for BBrMV and CMV primers (initially 56 and 55°C, respectively) to 60°C. The latter temperature was that used initially for the BBTV PCR assays. A small loss of sensitivity was noted in the M-PCR for all the three viruses if the final 3 min 72°C extension was omitted.

3.3. Optimisation of multiplex (M) PCR using reference isolates A number of factors, individually or combined, had a significant effect on the sensitivity of MPCR. These included the choice of RT-PCR system and the primers used for production of both the cDNA and PCR.

81

3.3.1. RT-PCR Systems The Titan RT-PCR system worked well in virus-specific RT-PCR with a single virus template (i.e. BBrMV with Poty1-U341 primers or CMV with CMV3% and CMV5% primers). However, a strong BBrMV-specific product (ca. 1050 bp) was produced with primers Poty1 and CMV3% (in addition to the expected U341/Poty1 product of ca. 700 bp) when BBrMV and CMV primer pairs and BBrMV template only were present. With both CMV and BBrMV templates present and either all the four primers or BBrMV primers only, no BBrMV specific product was detectable. These problems made the Titan RT-PCR system unsuitable for multiplex detection of these two viruses. Using the SuperScript one-step RT-PCR system, very low levels of amplification were obtained with either BBrMV or CMV RT-PCRs. Additionally, when SuperScript I RTase and Taq polymerase were used in a one tube RT-PCR as described by Thomas et al. (1997), strong amplification was obtained with virus-specific systems (i.e. CMV with CMV3% and CMV5% primers or BBrMV with Poty1 and U341 primers). However, little if any amplification was achieved when all the four primers were combined, regardless of whether the templates were added individually or together. Using SuperScript I in a two tube RTPCR, simultaneous cDNA synthesis of CMV (with downstream primer CMV3%) and BBrMV (Poty1) was greatly improved by increasing the incubation temperature from 37 to 47°C. However, SuperScript II RTase was shown to be superior than the SuperScript I using a RT temperature of 47°C and worked even better at 50°C. Further improvements in sensitivity were obtained by increasing the RT volume in the IC tubes from 20 to 40 ml and adding 0.3 mg of acetylated BSA to the RT step. Simultaneous amplifications of CMV and BBrMV were readily achieved with these improvements to the RTPCR. 3.3.2. Primers The choice of CMV downstream primer for cDNA synthesis and the presence of the CMV template (viral RNA or cDNA) often had a sig-

82

M. Sharman et al. / Journal of Virological Methods 89 (2000) 75–88

nificant effect on the amplification of BBrMV. When using the Pharmacia First-Strand cDNA Synthesis Kit, the presence of the CMV3% primer in the cDNA synthesis and/or PCR mix significantly reduced the BBrMV product using any of the primer pairs Poty1 – Pot2, Poty1 – U341, D341–Pot2 or Pot1 – Pot2, compared with the amplification of BBrMV without the presence of CMV3% primer. Sequence alignment of the CMV3% primer with the known sequence of BBrMV (GenBank AF071590) between the Poty1 and Pot2 primer sites revealed two possible spurious binding sites, one each on the complementary and virus-sense strand of the BBrMV genome. As predicted by the sequence alignments, cDNA synthesis from BBrMV RNA (using either Pot1 or Poty1) was greatly reduced by the presence of CMV3% primer. Strong BBrMV PCR products of the predicted sizes could be obtained using either Pot1 and CMV3%, or Poty1 and CMV3% confirming that CMV3% was affecting both the cDNA synthesis and PCR steps for BBrMV amplification. The Poty1–U341 RT-PCR of BBrMV appeared to be the least inhibited by CMV3%, although significant losses in PCR product yield were observed compared with the virus-specific amplification of BBrMV (using degenerate potyvirus primers). The potyvirus downstream primer D341 impaired the production of CMV cDNA, so the potyvirus-specific primer combination Poty1/U341 was used for subsequent experiments. The subsequent use of Superscript II in the final M-IC-PCR protocol enabled amplification of BBrMV with no detectable negative effect of primer CMV3%. A large improvement in sensitivity in the multiplex assay was obtained by adjusting primer concentrations. BBTV primer concentrations (BBT1 and BBT2) were changed to 200 nM each, BBrMV primers (Poty1 and U341) to 800 nM each and CMV primers (CMV3% and CMV5%) remained at 400 nM each.

3.4. Optimisation of M-IC-PCR with field isolates When a collection of six BBrMV isolates from Table 1 was tested by M-IC-RT-PCR, only one

(the reference isolate 509) was readily detected. The results were similar for a collection of BBTV and CMV isolates in the same test (only reference isolates BBTV-482 and CMV-207 were readily detected). The presence of BBrMV primers Poty1/ U341 reduced PCR product of some BBTV and CMV isolates in a multiplex PCR. When the BBrMV-specific primers bract1 and bract2 were used instead of the potyvirus-specific primers Poty1 and U341, a large increase in PCR product was evident for four of the six BBrMV isolates. For the two isolates which did not produce a bract1–bract2 amplicon (604 bp in size), a faintly visible amplicon of ca. 700 bp was detectable by gel analysis. The latter product was hypothesised to be a Poty1–bract1 product, the presence of the Poty1 primer due to carryover from cDNA synthesis. By also including 10 pmoles of primer Poty1 in the M-PCR (i.e. with BBTV and CMV primers also) strong Poty1– bract1 derived bands were obtained for the BBrMV isolates lacking the bract2 primer site (isolates 513 and 560) and for the other BBrMV isolates both the Poty1–bract1 and bract1–bract2 product was obtained (Fig. 1a). This new mix of the three BBrMV primers had no detrimental effects on the BBTV or CMV isolates in an MPCR and enabled amplification of all the isolates. This was the final system used for the M-IC-PCR (see Section 2.6).

3.5. Comparison of ELISA with M-IC-PCR using gel-based or colourimetric microplate detection Figs. 1–3 show the comparison of sensitivity between virus-specific ELISA, and M-IC-PCR with gel or colourimetric detection for BBrMV, BBTV and CMV, respectively. Colourimetric microplate detection of PCR products was 25 times (CMV), 125 times (BBTV) and 625 times (BBrMV) more sensitive than ELISA. M-IC-PCR enabled unequivocal detection of all the three viruses at a dilution of at least 1:31 250. Also, bulking up to 30 healthy field samples with one positive for each virus yielded no significant loss in sensitivity compared with single positive sample reactions (results not shown).

M. Sharman et al. / Journal of Virological Methods 89 (2000) 75–88

83

separate samples (Fig. 4). A reduction in A410 nm of ca. 10% was noted for colourimetric detection for combined viruses compared with separate samples when analysing PCR products shown in Fig. 4. There was no detectable reduction in A410 nm for any of the viruses using colourimetric detection with combined probes (at the same dilution as used separately) compared with using separate probes (results not shown). However, values for healthy and PCR negative controls were increased about three-fold with combined probes as compared with separate probes. We have detected a range of isolates of CMV, BBTV and BBrMV using M-IC-PCR (Fig. 5a–c). All the 17 isolates tested were easily detected: five each of CMV, BBTV and BBrMV, and two isolates of mixed infections of BBTV and BBrMV. Gel detection of the PCR products gave bands

Fig. 1. Relative sensitivity of M-IC-PCR using agarose gel (a) or colourimetric microplate detection (b), or ELISA (c) for the detection of BBrMV. Lanes 1–13 (a) correspond to respective columns in colourimetric microplate detection (b) and ELISA (c) graphs below each gel lane. M is a 100 bp DNA ladder. Lanes 1 – 8 are BBrMV-509 serially diluted five-fold from 1:50 (to 1:3 906 250); lanes 9–11, three independent healthy controls samples (H3, H5 and H7); lane 12, CMV-207; and lane 13, BBTV-482. Lanes 14 and 15 are extraction negative and PCR negative, respectively, for agarose gel (a); PCR negative and SSC buffer, respectively, for colourimetric microplate detection (b); and extraction negative and extraction buffer, respectively, for ELISA (c). A410 nm was measured for the colourimetric microplate detection after 2.3 and 1.7 h for ELISA, both at room temperature. * The 1:3 906 250 dilution was not tested by ELISA.

For all the three viruses, colourimetric detection of PCR products was at least as sensitive and sometimes five-fold more sensitive than detection by gel electrophoresis. There were no-cross reactions in the colourimetric system with non-specific products, indicating that the probes were specific to the homologous PCR amplicons. Using the M-IC-PCR system with gel-based detection, it was possible to detect all the three viruses combined in a single extract with no significant loss in sensitivity when compared with

Fig. 2. Relative sensitivity of M-IC-PCR using agarose gel (a) or colourimetric microplate detection (b), or ELISA (c) for the detection of BBTV. All the lanes (1 – 15) are as described for Fig. 1 except the dilution series in lanes 1 – 8 is for BBTV-482 and lane 13 is BBrMV-509. A410 nm was measured for the colourimetric microplate detection after 2.5 h at room temperature and overnight at 4°C for ELISA. * The 1:3 906 250 dilution was not tested by ELISA.

84

M. Sharman et al. / Journal of Virological Methods 89 (2000) 75–88

Fig. 3. Relative sensitivity of M-IC-PCR using agarose gel (a) or colourimetric microplate detection (b), or ELISA (c) for the detection of CMV. All the lanes (1–15) are as described for Fig. 1 except the dilution series in lanes 1–8 is for CMV-207 and lane 12 is BBTV-482 and lane 13 is BBrMV-509. A410 nm was measured for the colourimetric microplate detection after 2.5 and 2 h for ELISA, both at room temperature. *The 1:3 906 250 dilution was not tested by ELISA.

gle extract with no significant loss in sensitivity compared with single virus-specific assays. The colourimetric microplate detection system was at least as sensitive as the detection of PCR amplicons by gel electrophoresis. Furthermore, it eliminated problems associated with differentiating specific amplicons and spurious non-specific banding patterns on gels. Increased sensitivity of the M-IC-PCR provides the potential for bulking samples, resulting in significant savings with respect to RT-PCR reagents and plasticware, and labour involved in sample handling. Using a conservative tissue dilution of 1:5000, each of the three viruses can be detected by gel electrophoresis of RT-PCR products. Thus, the potential exists for one positive sample to be easily detected in a bulked extract of 1000 samples utilising the M-IC-PCR assay. This scale of bulking samples could be very useful for large scale surveys or indexing where the rate of positive samples is expected to be low. As was noted by Wetzel et al. (1992), one of the major constraints in the use of this type of assay for routine indexing, is the increased cost of reagents required compared with ELISA. However, a

with relative intensity comparable with the values obtained by colourimetric detection and the weakest band was well above the detection limits of the stained gel. Mixed infections were easily recognised on the gel as shown for isolate 717 (Fig. 4).

4. Discussion The M-IC-PCR for the three banana viruses BBTV, CMV and BBrMV is at least 25 times more sensitive then the respective ELISAs which are currently the international standard for indexing these viruses (Diekmann and Putter, 1996). A range of geographical and genomic variants of each virus could be easily detected. The three viruses could be detected simultaneously in a sin-

Fig. 4. M-IC-PCR for combined viruses BBTV, CMV and BBrMV. M is a 100 bp DNA ladder. Lane 1 is CMV-207; lane 2 is isolate 717 which has natural infection of BBTV and BBrMV; lane 3 is CMV-207 extract mixed with isolate 717 (BBTV and BBrMV); lane 4 is healthy-H3; and lane 5 is PCR negative.

M. Sharman et al. / Journal of Virological Methods 89 (2000) 75–88

Fig. 5. Colourimetric microplate detection of a range of isolates of CMV (a), BBTV (b) and BBrMV (c). PCR products in (a) were probed with a mixture of DIG-labelled probe made to the complementary PCR product of CMV-207 and -149. DIGlabelled probe made to BBTV-482 was used in (b) and a mixture of DIG-labelled probe made to BBrMV-509 and -513 was used in (c). The values for the negative control samples in (a, b and c) are the highest of the controls tested. A410 nm was measured for the colourimetric microplate detection after 1 h for (a), and 1.2 h for both (b) and (c). Both isolate 522 and 717 are mixed infections of BBTV and BBrMV. Isolate details are outlined in Table 1.

simultaneous assay for the three viruses instead of three separate ELISAs and the potential for bulking large numbers of samples should result in significant cost savings compared with the existing indexing procedures. We experienced significant difficulties in developing an assay to detect the widest range of virus isolates possible. At one stage we could easily detect our reference isolates BBTV-482, CMV-207 and BBrMV-509 both singly and combined using one M-IC-PCR assay. However, when the same assay was applied to a wider range of isolates, most of the other isolates were not detected. Most of the difficulties were probably due to primers

85

interacting unexpectedly with non-target virus templates during PCR. By changing the PCR primer combination (elimination of the degenerate potyvirus primer U341 and incorporation of BBrMV-specific primers bract1 and bract2) most problems were eliminated and the multiplex assay worked for all the isolates tested. Such difficulties have not been commonly reported in the literature for other types of multiplex PCR assays, although in some cases it appears the range of isolates tested may have been limited. Bariana et al. (1994) developed a M-RT-PCR assay for the detection of five viruses infecting legumes, which included CMV and two potyviruses (Bean yellow mosaic 6irus and Clo6er yellow 6ein 6irus). It appears that a range of isolates of each virus were tested using virus-specific PCRs (containing only two primers in each PCR mix) and that the M-RT-PCR (with all the virus primers in the same PCR mix) was only done for one isolate of each virus. Reduced amplification of two viruses was observed when their templates were combined in the M-RT-PCR and this was assumed to be due to competition for a common 3% primer (Bariana et al., 1994). However, our experiences suggest that it may also have been due to interactions between primers and non-target virus templates as we experienced with the CMV primer CMV3% interfering with BBrMV cDNA synthesis and PCR amplification. In other M-RT-PCR assays it also appears that only one isolate of each virus was used to test the procedure (Minafra and Hadidi, 1994; Grieco and Gallitelli, 1999). Grieco and Gallitelli (1999) experienced reduced amplification and had difficulty detecting one of the viruses in samples of combined templates compared with separate reactions, but did not suggest a reason. Our results clearly demonstrate the importance of thoroughly testing M-PCR for a wide range of virus isolates in order to be confident of avoiding non-specific primer–template interactions that would otherwise inhibit the detection of some isolates. The benefits of utilising IC in conjunction with RT-PCR to remove inhibitory plant compounds and to make nucleic acid extractions unnecessary has been well recognised (Wetzel et al., 1992; Mumford and Seal, 1997; Harper et al., 1999a).

86

M. Sharman et al. / Journal of Virological Methods 89 (2000) 75–88

We also found that IC was a fast and effective method for obtaining clean template that resulted in a highly sensitive assay. The high sensitivity of RT-PCR can make it difficult to avoid contamination problems unless great care is taken (Bariana et al., 1994). For our M-IC-PCR this was especially important during the washing step for the removal of samples from the IC tubes. Following the incubation of samples we found it beneficial to centrifuge the IC tubes, then remove as much of the contents as possible with filtered micro-pipette tips before proceeding with the PBS-T washes. Care was also taken during handling to avoid touching around the lids of the tubes, as this is where tube to tube contamination is most likely to occur. However, others report using much more relaxed tube washing techniques during IC with no apparent problems (Mumford and Seal, 1997). During development of the M-IC-PCR we experienced many significant difficulties with nonspecific reactions associated with the primers and type of RT-PCR system used, including primer – template and template – template interactions. These interactions included BBrMV amplicons produced from interactions with primer CMV3%, the complete inhibition of BBrMV amplification in the presence of CMV template and the partial amplification inhibition of many BBTV and CMV isolates in the presence of potyvirus primer U341. In some instances we could not identify the reasons for the problems, particularly regarding the effects of different RT-PCR systems. There was no obvious correlation between effects and the type of reverse transcriptase used and we ultimately chose a more robust two tube RT-PCR instead of a one tube RT-PCR. The separation of the RT and PCR reactions enables fewer components to interact at any one time. Bariana et al. (1994) also found their M-RT-PCR to be less robust than single virus-specific RT-PCR, and experienced a strong non-specific band in a virusspecific RT-PCR, and reduced amplification from two templates in the M-RT-PCR. We observed non-specific bands for many BBrMV isolates (at ca. 1400 bp) (Fig. 1) and to a lesser extent for the amplification of BBTV and CMV with faint bands at ca. 720 and 1000 bp, respectively (Figs. 2 and 3).

Non-specific bands made the identification of mixed infections difficult or inconclusive in instances where the faint non-specific bands were close to the expected size of a virus-specific amplicon. However, the colourimetric microplate detection of PCR products using virus-specific hybridisation probes eliminated this problem. Colourimetric detection of PCR products provided two levels of specificity (primers and probes) which resulted in a more sensitive assay. Combining several probes would eliminate the need to perform separate assays for the three viruses, though this does not allow identification of individual viruses in a positive sample. Colourimetric microplate detection is more expensive in consumables and requires more time compared with gel electrophoresis but is marginally more sensitive, unambiguous and eliminates the need to use ethidium bromide. As suggested by Bariana et al. (1994), an internal positive control would be a desirable inclusion for this assay as a confirmation that negative results are real and not due to the failure of the test. Unfortunately, the addition of primers designed to amplify a region of the 18S ribosomal RNA to their M-RT-PCR resulted in the appearance of many non-specific bands. The IC step of our assay would make it unlikely that banana nucleic acid would be captured and available as template for an internal positive control (Harper et al., 1999a). Furthermore, the IC step has been shown to remove RT and PCR inhibitors known to occur in banana tissue extracts making false negative results unlikely (Harper et al., 1999a). The M-IC-PCR described above, detected BBTV, CMV and BBrMV, the most thoroughly characterised viruses known to infect bananas at the time of development. Future improvements for this assay would include the incorporation of primers for additional viruses as they are characterised, such as the recently recognised banana mild mosaic virus (C.F. Gambley, J.E. Thomas, B.E.L. Lockhart and M.-L. Caruana, unpublished). The inclusion of BSV primers awaits a clearer understanding of the diversity and life cycle of the virus.

M. Sharman et al. / Journal of Virological Methods 89 (2000) 75–88

Acknowledgements We are grateful to all the staff of the Virology unit at the Queensland Horticulture Institute for their advice, critical comments and encouragement during this work. We also thank those who supplied the virus isolates. This work was funded by the Cooperative Research Centre for Tropical Plant Pathology.

References Ahlawat, Y.S., Pant, R.P., Lockhart, B.E.L., Srivastava, M., Chakraborty, N.K., Varma, A., 1996. Association of a badnavirus with citrus mosaic disease in India. Plant Dis. 80, 590 – 592. Anonymous, 1992. Annual Report 1992. Bananas, Plantains and INIBAP. International Network for the Improvement of Banana and Plantain, Montpellier, France, p. 64. Bariana, H.S., Shannon, A.L., Chu, P.W.G., Waterhouse, P.M., 1994. Detection of five seedborne legume viruses in one sensitive multiplex polymerase chain reaction test. Phytopathology 84, 1201–1205. Burns, T.M., Harding, R.M., Dale, J.L, 1994. Evidence that banana bunchy top virus has a multiple component genome. Arch. Virol. 137, 371–380. Clark, M.F., Adams, A.N., 1977. Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. J. Gen. Virol. 34, 475– 483. Colinet, D., Kummert, J., 1993. Identification of a sweet potato feathery mottle virus isolate from China (SPFMVCH) by the polymerase chain reaction with degenerate primers. J. Virol. Methods 45, 149–159. Diekmann, M., Putter, C.A.J., 1996. FAO/IPGRI Technical Guidelines for the Safe Movement of Germplasm, No. 15, Musa, second ed. Food and Agriculture Organization of the United Nations/International Plant Genetic Resources Institute, Rome. Dietzgen, R.G., Thomas, J.E., Smith, G.R., Maclean, D.L., 1999. PCR — based detection of viruses in banana and sugarcane. Curr. Top. Virol. 1, 105–118. Geering, A.D.W., Thomas, J.E., 1996. A comparison of four serological tests for the detection of banana bunchy top virus in banana. Aust. J. Agric. Res. 47, 403–412. Gibbs, A., Mackenzie, A., 1997. A primer pair for amplifying part of the genome of all potyvirids by RT-PCR. J. Virol. Methods 63, 9 – 16. Grieco, F., Gallitelli, D., 1999. Multiplex reverse transcriptasepolymerase chain reaction applied to virus detection in globe artichoke. J. Phytopathol. 147, 183–185. Harper, G., Hull, R., 1998. Cloning and sequence analysis of banana streak virus DNA. Virus Genes 17, 271–278.

87

Harper, G., Dahal, G., Thottappilly, G., Hull, R., 1999a. Detection of episomal banana streak badnavirus by ICPCR. J. Virol. Methods 79, 1 – 8. Harper, G., Osuji, J.O., Heslop-Harrison, J.S., Hull, R., 1999b. Integration of banana streak badnavirus into the Musa genome: molecular and cytogenetic evidence. Virology 255, 207 – 213. Hataya, T., Inoue, A.K., Shikata, E., 1994. A PCR-microplate hybridization method for plant virus detection. J. Virol. Methods 46, 223 – 236. Karan, M., Harding, R.M., Dale, J.L., 1994. Evidence for two groups of banana bunchy top virus isolates. J. Gen. Virol. 75, 3541 – 3546. Langeveld, S.A., Dore, J.M., Memelink, J., Derks, A.F.L.M., van der Vlugt, C.I.M., Asjes, C.J., Bol, J.F., 1991. Identification of potyviruses using the polymerase chain reaction with degenerate primers. J. Gen. Virol. 72, 1531 – 1541. Lockhart, B.E.L., Olszewski, N.E., 1993. Serological and genomic heterogeneity of banana streak badnavirus: implications for virus detection in Musa germplasm. In: Ganry, J. (Ed), Breeding Bananas and Plantain for Resistance to Disease and Pests. In: Proceedings of the International Symposium On Genetic Improvement of Bananas for Resistance To Diseases and Pests, organised by CIRAD – FLHOR. Montpellier, France, 7 – 9 September 1992. CIRAD in collaboration with INIBAP, Montpellier, pp. 105 – 113. Minafra, A., Hadidi, A., 1994. Sensitive detection of grapevine virus A, B, or leafroll-associated III from viruliferous mealybugs and infected tissue by cDNA amplification. J. Virol. Methods. 47, 175 – 188. Mumford, R.A., Seal, S.E., 1997. Rapid single-tube immunocapture RT-PCR for the detection of two yam potyviruses. J. Virol. Methods 69, 73 – 79. Nathan, M., Fox, D.K., 1997. Acetylated BSA increases the sensitivity of RT-PCR with low levels of RNA. FOCUS 19, 50 – 51. Ndowora, T., Dahal, G., LaFleur, D., Harper, G., Hull, R., Olszewski, N.E., Lockhart, B., 1999. Evidence that badnavirus infection in Musa can originate from integrated pararetroviral sequences. Virology 255, 214 – 220. Pares, R.D., Dietzgen, R.G., Gunn, L.V., Rizos, H., 1998. Differentiation of Australian cucumber mosaic cucumovirus isolates: comparison of dsRNA type, polymerase chain reaction-restriction enzyme analysis, DNA hybridisation and serogrouping. Australas. Plant Pathol. 27, 36 – 39. Rodoni, B.C., Ahlawat, Y.S., Varma, A., Dale, J.L., Harding, R.M., 1997. Identification and characterization of banana bract mosaic virus in India. Plant Dis. 81, 669 – 672. Rodoni, B.C., Dale, J.L., Harding, R.M., 1999. Characterization and expression of the coat protein-coding region of banana bract mosaic potyvirus, development of diagnostic assays and detection of the virus in banana plants from five countries in southeast Asia. Arch. Virol. 144, 1725 – 1737. Rowhani, A., Maningas, M.A., Lile, L.S., Daubert, S.D., Golino, D.A., 1995. Development of a detection system for viruses of woody plants based on PCR analysis of immobilized virions. Phytopathology 85, 347 – 352.

88

M. Sharman et al. / Journal of Virological Methods 89 (2000) 75–88

Sharman, M., Gambley, C.F., Oloteo, E.O., Abgona, R.V.J., Thomas, J.E., 2000. First record of natural infection of abaca (Musa textilis) with banana bract mosaic potyvirus in the Philippines. Australas. Plant Pathol. 29, 69. Thomas, J.E., 1991. Virus indexing procedures for banana in Australia. In: Valmayor, R.V., Umali, B.E., Bejosano, C.P. (Eds.), Banana Diseases in Asia and the Pacific: Proceedings of a Technical Meeting On Diseases Affecting Banana and Plantain In Asia and the Pacific, Brisbane, Australia, 15 – 18 April 1991. International Network for the Improvement of Banana and Plantain, Montpellier, France, p. 180. Thomson, D., Dietzgen, R.G., 1995. Detection of DNA and RNA plant viruses by PCR and RT-PCR using a rapid

.

virus release protocol without tissue homogenization. J. Virol. Methods 54, 85 – 95. Thomas, J.E., Geering, A.D.W., Gambley, C.F., Kessling, A.F., White, M., 1997. Purification, properties, and diagnosis of banana bract mosaic potyvirus and its distinction from abaca mosaic potyvirus. Phytopathology 87, 698 – 705. Wardlaw, C.W., 1961. The virus diseases: bunchy top. In: Banana Diseases, Including Plantains and abaca. Longmans, London, pp. 68 – 115. Wetzel, T., Candresse, T., Macquaire, G., Ravelonandro, M., Dunez, J., 1992. A highly sensitive immunocapture polymerase chain reaction method for plum pox potyvirus detection. J. Virol. Methods 39, 27 – 37.