- Email: [email protected]
Development of a multiplex PCR for detection of avian adenovirus, avian reovirus, infectious bursal disease virus, and chicken anemia virus
Molecular and Cellular Probes 18 (2004) 293–298 www.elsevier.com/locate/ymcpr
Development of a multiplex PCR for detection of avian adenovirus, avian reovirus, infectious bursal disease virus, and chicken anemia virus Kristen M. Caterinaa, Salvatore Frasca Jrb, Theodore Girshickb, Mazhar I. Khana,* a
Department of Pathobiology and Veterinary Science, University of Connecticut, 61 North Eagleville Road, Storrs, CT 06269-3089, USA b Charles River, SPAFAS, Inc., 67 Baxter Road, Storrs, CT 06268, USA Received 16 February 2004; accepted for publication 6 April 2004
Abstract A multiplex polymerase chain reaction (mPCR) was developed and optimized for the simultaneous detection and differentiation of avian reovirus (ARV), avian adenovirus group I (AAV-I), infectious bursal disease virus (IBDV), and chicken anemia virus (CAV). Four sets of specific oligonucleotide primers were used in this test for ARV, AAV-I, IBDV, and CAV. The mPCR DNA products were visualized by gel electrophoresis and consisted of fragments of 365 bp for IBDV, 421 bp for AAV-I, 532 bp for ARV, and 676 bp for CAV. The mPCR assay developed in this study was found to be sensitive and specific. Detection of PCR-amplified DNA products was 100 pg for both CAV and IBDV, and 10 pg for both ARV and AAV-I and this mPCR did not amplify nucleic acids from the other avian pathogens tested. The mPCR demonstrated similar sensitivity in tests using experimental fecal cloacal swab specimens that were spiked with ARV, AAV-1, IBDV, and CAV, and taken from specific pathogen free (SPF) chickens. This mPCR detected and differentiated various combinations of RNA/DNA templates from ARV, AAV-I, CAV, and IBDV without reduction of amplification from feces. q 2004 Elsevier Ltd. All rights reserved. Keywords: Multiplex polymerase chain reaction; Avian adenovirus; Avian reovirus; Infectious bursal disease virus; Chicken anemia virus
1. Introduction Avian reovirus (ARV), avian adenovirus group 1 (AAV-I), infectious bursal disease virus (IBDV) and chicken anemia virus (CAV) are all highly pathogenic viruses that have detrimental effects on the health of poultry, and share a number of similarities. Birds that become infected with each of these viruses individually can present with similar symptoms, such as depression, immunosuppression, weight loss, and enteritis [1,3 – 9,34 –39]. All of these viruses can be isolated from the feces, [1 – 3] and multiple infections with these viruses can also occur, making it difficult to determine which of these viruses is causing disease in infected flocks [3, 10 –14]. Diagnostic testing is essential to determine which pathogen may be causing illness in poultry. Rapid diagnostic detection of these viruses is particularly important to the poultry industry in order to prevent spread of disease and to limit economic losses. Serology, isolation and identification are methods used to detect these viruses; however, isolation * Corresponding author. Tel.: þ 1-860-486-0228; fax: þ1-860-486-2794. E-mail address: [email protected] (M.I. Khan). 0890-8508/$ - see front matter q 2004 Elsevier Ltd. All rights reserved. doi:10.1016/j.mcp.2004.04.003
and identification can be laborious and time consuming, while serology is often plagued by nonspecific reactions and problems with reagent cross-reaction [2]. Although, singleband PCR has also been used to detect these pathogens, it only allows for detection of nucleic acid from one specific pathogen at a time [15 – 23]. Multiplex polymerase chain reaction (mPCR) is advantageous because it allows one to detect and distinguish multiple pathogenic agents through the use of one test rather than four separate single-band PCRs. Multiplex PCR has the added benefits of being cost effective, time saving, specific and sensitive, furthermore, it has been used for screening and surveillance of poultry flocks [24 – 28]. The goal of this research was to develop mPCR that would allow for identification of ARV, AAV-I, IBDV, and CAV simultaneously in one reaction. Because ARV, AAV-1, IBDV, and CAV are all shed in the feces of chickens, fecal samples can be the best source for simultaneous detection of these viruses. Previous studies have shown that fecal samples can be used in PCR and mPCRs, and that the tests are still highly sensitive [31 – 34]. Testing of experimentally prepared fecal cloacal swabs was carried out in order to
294
K.M. Caterina et al. / Molecular and Cellular Probes 18 (2004) 293–298
determine whether potential fecal inhibitors will have an effect on the sensitivity and specificity of this mPCR in the detection of ARV, AAV-1, IBDV, and CAV.
[30]. The cell culture was clarified by centrifugation. Salmonella enteritidis was grown in nutrient broth and obtained from American Type Culture Collection (Manassas, VA).
2. Materials and methods
2.2. Extraction of RNA and DNA
2.1. Avian pathogens
RNA extraction from ARV, NDV, AI, ALV-J and IBDV was carried out according to the Trizol LS manufacturer’s protocol and as described by Xie et al. (Trizol LS, Life Technologies, Bethesda, MD) [17], DNA from CAV, MD, AAV-I and S. enteritidis was extracted using the phenol: chloroform:isoamyl alcohol (1:1:24 v/v) (Gibco BRL, Grand Island, NY) method as described by Xie et al. [18]. The concentrations of the RNA/DNA were determined by spectrophotometry using the Bio Mate 5 (Thermo Spectronic, Rochester, NY) and stored at 2 20 C.
The avian pathogens used in this study are listed in Table 1. AAV-I, avian influenza (AI), Newcastle Disease virus (NDV), and IBDV were propagated in the allantoic cavity of 10-day-old SPF embryonated chicken eggs; the allantoic fluids were harvested and clarified by centrifugation. ARV was propagated in chicken embryo fibroblast (CEF) monolayers as described by van der Heide et al. [29]. ARV-infected cell cultures were clarified by centrifugation. Marek’s Disease virus (MDV) and Avian Leukosis Virus, Subgroup J (ALV-J) were also propagated in CEFs and the cell cultures were clarified by centrifugation. CAV was grown in MDCC-MSB1 cells as described by McNulty et al.
Table 1 Avian pathogens used in multiplex PCR
2.3. Oligonucleotide primers Four sets of primers that specifically amplify ARV, AAV-I, IBDV, and CAV were published previously and their sequences are listed in Table 2. All four sets of oligonucleotide primers were synthesized at Invitrogen/ Gibco (Carlsbad, CA). The primers were aliquoted into 100 ml volumes and stored at 2 20 C.
Avian pathogen
Strain/isolate
Source
Avian adenovirus group 1 (AAV-1) AAV-1 AAV-1 AAV-1 AAV-1 AAV-1 Chicken anemia virus (CAV) CAV Avian reovirus (ARV) ARV ARV ARV ARV Infectious bursal disease virus (IBDV) IBDV IBDV
CELO
University of Rhode Island
2.4. Reverse transcription and multiplex PCR reaction
Type 3 Type 5 Type 7 94:536 (p2) 570 CL-1
Cornell University Cornell University Cornell University Washington State University Washington State University University of Maryland
The mPCR consists of a two-step procedure, which includes reverse transcription (RT) and PCR amplification.
Delrose S1133
NVSLa University of Connecticut
S1133(p11) S1133(p9) S1133(p8) S1133(p76) Serotype 1, strain 2512 D78 Variant E
University University University University University
Pathogens used in specificity testing of mPCR NDV AI ALV-J MD S. enteritidis a b c d e
B1 LaSota T/W/66 HC-1 SB1
of Connecticut of Connecticut of Connecticut of Connecticut of Delaware
Intervet Inc.b University of Maryland
Provided by SPAFASc University of Minnesota ADOLd Cornell University ATCCe
National Veterinary Services Laboratory, Ames, IA. Intervet Incorporated, Millsboro, DE. Charles River, SPAFAS, Inc., Storrs, CT, 06268. Avian Disease and Oncology Laboratory, East Lansing, MI. American Type Culture Collection, Manassas, VA, 20108.
Table 2 .PCR primers used in multiplex PCR Avain pathogen
Primer sequence
PCR product size (bp)
CAVa (MK10) CAVa (MK11) Reovirusb (MK87) Reovirusb (MK88) Adenovirusc (MK89) Adenovirusc (MK90) IBDVd (MK114) IBDVd (MK115)
50 GACTGTAAGATGGCAAGACGAGCTC30
675
a b c d
Ref. Ref. Ref. Ref.
[17]. [18]. [19]. [16].
50 GGCTGAAGGATCCCTCATTC30 50 GGTGCGACTGCTGTATTTGGTAAC30
532
50 AATGGAACGATAGCGTGTGGG30 50 CCCTCCCACCGCTTACCA30
421BP
50 CACGTTGCCCTTATCTTGC30 50 AGCCTTCTGATGCCAACAAC30 50 ATCTGTCAGTTCACTCAGGC30
365
K.M. Caterina et al. / Molecular and Cellular Probes 18 (2004) 293–298
The Gene Amp RNA PCR kit (Applied Biosystems, Branchburg, NJ) was used for the reverse transcription reaction. RT was performed in 25 ml volumes, in which the reaction mixture contained 5 mM MgCl2, 1 £ of 10 £ PCR buffer II, 1 mM of each dinucleoside triphosphate (dNTP), 1 Unit RNase inhibitor, 2.5 mM random hexamers, 2.5 Units Moloney murine leukemia virus (MuLV) reverse transcriptase, RNA in 3 ml volumes in different concentrations and sterile de-ionized water was added to bring the final volume to 25 ml. RT was carried out in a thermal cycler (Model 480, Perkin Elmer Cetus, Norwalk, CT) for one cycle at 42 C for 15 min, 99 8C for 5 min, and 5 8C for 5 min. The mPCR reaction was performed in a 100 ml volume with using the Gene Amp PCR kit (Applied Biosystems, Branchburg, NJ) and AmpliTaq Goldw (Applied Biosystems, Branchburg, NJ). The reaction contained 2.5 mM MgCl2, 1 £ PCR Buffer II (500 mM KCL, 100 mM Tris HCl, pH 8.3), 200 mM each dNTP, 15 pmol of reovirus primers, MK87 and MK88, 15 pmol CAV primers MK10 and MK11, 10.5 pmol of adenovirus primers MK89 and MK90, 90 pmol IBDV primers, MK114 and MK115, and 2.5 Units AmpliTaq Goldw. This mixture was added to the RT reaction tubes along with 100 ng of DNA template. Sterile de-ionized water was added to this mixture to bring the total volume to 100 ml. The mixture was overlaid with 50 ml mineral oil and mPCR was carried out in the same thermal cycler used for RT. The cycling protocol consisted of an initial denaturation at 94 8C for 5 min, then 35 cycles that each consisted of denaturation at 94 8C for 1 min, annealing at 50 8C for 1 min, and extension at 72 8C for 2 min. The sample was then heated at 72 8C for 10 min for a final extension. A negative control was run with each test. The negative control did not contain template DNA and consisted of PCR master mix, all four sets of primers and de-ionized water. 2.5. Detection of amplified mPCR products Agarose gel electrophoresis was used to detect mPCR products. Ten microliter volumes of PCR products were separated through a 2% agarose horizontal gel by electrophoresis at 84 Volts. Gels were stained with ethidium bromide (0.5 ug/ml), and visualized by ultraviolet light and photographed. 2.6. MPCR sensitivity and specificity Determination of the specificity of the mPCR was carried out by examining the ability of the test to detect and differentiate only ARV, AAV, CAV, and IBDV. The mPCR was tested using other avian pathogens that are shed in the feces, have similar symptoms or can be present in a multiple infection with ARV, AAV-I, CAV or IBDV. Those avian pathogens tested were NDV, MD, ALV-J, AI, and S. enteritidis. Further assessment of the mPCR specificity was carried out by testing different isolates and strains of
295
AAV-1, ARV, IBDV and CAV. These isolates and strains are listed in Table 1. Sensitivity of the mPCR was determined by making 10-fold serial dilutions of a mixture containing 100 ng of the RNA/DNA templates of each of the four pathogens. 2.7. Detection of ARV, AAV-1, IBDV, and CAV in fecal cloacal swab samples Sterile, cotton-tipped applicators were used to take fecal cloacal swab samples from 20 SPF chickens. The swabs were soaked in 1 ml of sterile de-ionized water for 1 h at room temperature. Five hundred microliters from each of four of the water-containing fecal swab samples were inoculated with 108.8 ELD50 of AAV-1 (CELO). Along with this, 500 ml from each of four of the water-containing fecal swab samples were inoculated with 107.0 TCID50 of CAV (CL-1). Also, 250 ml from each of four of the watercontaining fecal swab samples were inoculated with 104.1 ELD50 of IBDV (2512). Lastly, 250 ml from each of four of the water-containing fecal swab samples were inoculated with 107.2 TCID50 ARV (S1133). The remaining watercontaining fecal swab samples that were not inoculated with virus were used as negative controls. Sterile de-ionized water, which was inoculated with each of the viral pathogens as above, was used as the positive control. The RNA/DNA was extracted according to the protocol, described above. The concentrations of the RNA/DNA were determined by spectrophotometry using the Bio Mate 5 (Thermo Spectronic, Rochester, NY) and stored at 2 20 8C. One hundred nanograms of each of the extracted viral RNA/DNA were tested with the mPCR. In order to examine if chicken feces had an inhibitory effect on the ability of the mPCR to detect and differentiate ARV, AAV-I, IBDV and CAV in the same reaction, different combinations of 100 ng of the RNA/DNA templates from the four pathogens were tested by the mPCR. Sensitivity of the mPCR was determined by making 10-fold serial dilutions of a mixture containing 100 ng of the RNA/DNA templates of each of the four pathogens.
3. Results Throughout this research manipulations were made to the annealing temperature, extension time, cycle quantity, and primer concentrations in order to obtain the optimal conditions for this mPCR. This multiplex PCR was developed to detect ARV, AAV-I, CAV and IBDV in a single reaction through 35 cycles of PCR. The mPCR products were 676 bp for CAV, 532 bp for ARV, 421 bp for AAV, and 365 bp for IBDV and each product was visualized by electrophoresis on 2% agarose gel followed by ethidium bromide staining and UV transillumination (Figs. 1 and 2). This mPCR was found to be specific assay for ARV, AAV-I, CAV and IBDV with no amplification of
296
K.M. Caterina et al. / Molecular and Cellular Probes 18 (2004) 293–298
the 10-fold serial dilutions of a spiked fecal mixture containing 100 ng of the DNA/RNA templates of each of the four pathogens (data not shown). No spurious PCR amplification reactions among all four pathogens were noticed with various amount of DNA and RNA mixtures. All the negative controls were negative.
4. Discussion
Fig. 1. Agarose gel electrophoresis of multiplex PCR-amplified products from purified DNAs RNAs of known avian pathogens. Lane 1, 100 bp ladder. Lane2, mPCR; CAV (CL-1),ARV (S1133), AAV-1, IBDV (serotype 1). Lane 3, CAV. Lane 4, ARV. Lane 5, AAV-1. Lane 6, IBDV. Lane 7, AI. Lane 8, NDV. Lane 9, MDV. Lane 10, Salmonella enteritidis. Lane 11, ALV-J. Lane 12, negative control.
nucleic acids from MD, NDV, AI, ALV-J, or S. enteritidis (Fig. 1). It was able to detect nucleic acid for ARV, AAV-I, CAV and IBDV that are listed in Table 1. Detection by visualization of PCR-amplified DNA products was 100 pg for both IBDV and CAV, and 10 pg for both ARV and AAV-I (Fig. 2). The mPCR detected and differentiated the various combinations of RNA/DNA templates from the ARV, AAV-I, CAV, and IBDV spiked fecal swab samples (Fig. 3). Further this mPCR was found to be equally sensitive on
The mPCR developed in this research was able to detect ARV, AAV-I, IBDV, and CAV simultaneously in one reaction. These four viruses are highly pathogenic and are transmitted rapidly among birds. Therefore, rapid diagnostic detection of these pathogens is important for early detection, prevention of spread of disease and avoidance of economic losses. The mPCR has been proven to be sensitive, specific, cost effective and can be useful in diagnosis, screening and surveillance of flocks. Furthermore, this mPCR has the added benefits of being time saving, e.g. only one sample from one source, such as feces or cloacal swabs, has to be processed, economical, e.g. less reagents are used to carry out one mPCR rather than four separate single-band PCRs, sensitive and specific, e.g. providing detection of small quantities of only these four viruses. Inhibitors can be a problem when using fecal samples in the diagnosis of pathogens through the use of PCR. This study focused on testing whether chicken feces would hinder the sensitivity of the mPCR and its ability to detect ARV, AAV-1, IBDV, and CAV. The results of this study showed that chicken feces do not reduce the ability of the mPCR to detect different combinations of the four avian pathogens (Fig. 3). The mPCR was still highly sensitive in
Fig. 2. Sensitivity of mPCR. Lane 1, 123 bp ladder. Lane 2, CAV. Lane 3, ARV (S1133). Lane 4, AAV-1. Lane 5, IBDV, Lane 6, 100 ng of DNA or RNA for each of CAV, ARV, AAV-1, and IBDV, Lane 7, 10 ng, Lane 8, 1 ng, Lane 9, 100 pg, Lane 10, 10 pg, Lane 11, 1 pg, Lane 12, 100 fg, Lane 13, 10 fg, Lane 14, 1 fg, Lane 15 no sample.
K.M. Caterina et al. / Molecular and Cellular Probes 18 (2004) 293–298
Fig. 3. Agarose gel electrophoresis of mPCR products from in vitro combinatory viral assay, testing ARV, AAV-1, IBDV, and CAV spiked fecal cloacal swab specimens. Lane 1, 123 bp ladder; Lane 2, CAV; Lane 3, ARV; Lane 4, AAV-1; Lane 5, IBDV; Lane 6, ARV; IBDV; Lane 7, ARV; AAV-1; IBDV; Lane 8, CAV; AAV-1; Lane 9, CAV; ARV; AAV-1.
its detection of AAV-1, CAV, ARV and IBDV in spiked fecal samples. Overall this study has shown that feces will be acceptable as a principal sample in testing for ARV, AAV-1, IBDV and CAV with this mPCR, and that one fecal cloacal swab sample can be tested for each of the four pathogens which allows for a quick, sensitive, and specific diagnosis with this mPCR.
Acknowledgements This work was supported by the Charles River, SPAFAS, Inc. We thank Mrs Marianne Kalbac for technical assistant in propagation and isolation of the viruses. We also thank Dr K. S. Venkitanarayanan for his advice and criticism.
References [1] Charlton BR, editor. Avian disease manual, 5th ed. American Association of Avian Pathologists; 2000. [2] Swayne DE, Glisson JR, Jackwood MW, Pearson JE, Reed WM, editors. A laboratory manual for the isolation and identification of avian pathogens, 4th ed. Florida: The American Association of Avian Pathologists, PA Rose Printing; 1998. [3] Saif YM, Barnes HJ, Glisson JR, Fadly AM, McDougald LR, Swayne DE, editors. Diseases of poultry, 11th ed. Ames, IA: Iowa State University Press; 2003. [4] Bakay M, Beladi I, Berensci K, Sidorova E, Agadzanyan M, Fachet J, Erdei J. Immunoenhancement and suppression induced by adenovirus in chicken. Acta Virol 1992;36:269–76.
297
[5] Hirai K, Shimakura S, Kawamoto E, Taguchi F, Kim ST, Chang CN, Iritani Y. The immunodepressive effect of infectious bursal disease virus in chickens. Avian Dis 1974;18:50–7. [6] Lutlicken D. Viral diseases of the immune system and strategies to control infectious bursal disease by vaccination. Acta Vet Hung 1997; 47:239–49. [7] Markowski-Grimsrud CJ, Schat KA. Infection with chicken anemia virus impairs the generation of pathogen-specific cytotoxic T lymphocytes. Immunology 2003;109:283–94. [8] Rinehart CL, Rosenberger JK. Effects of avian reoviruses on the immune responses of chickens. Poult Sci 1983;62:1488–9. [9] Sharma JM, Karaca K, Pertile T. Virus-induced immunosuppression in chickens. Poult Sci 1994;73:1082–6. [10] Toro H, Gonzalez C, Cerada L, Hess M, Reyes E, Geissea C. Chicken anemia virus and fowl adenoviruses: association to induce inclusion body hepatitis/hydropericardium syndrome. Avian Dis 2000;44:51 –8. [11] Imai K, Mase M, Tsukamoto K, Hihara H, Yuasa N. Persistent infection with chicken anaemia virus and some effects of highly virulent infectious bursal disease virus infection on its persistency. Res Vet Sci 1999;67:233–8. [12] Ragland WL, Novak R, El-Attrache J, Savic V, Ester K. Chicken anemia virus and infectious bursal disease virus interfere with transcription of chicken IFN-alpha and IFN-gamma mRNA. J Interferon Cytokine Res 2002;22:437–41. [13] Fadly AM, Winterfield RW, Olander HJ. Role of the bursa of Fabricius in the pathogenicity of inclusion body hepatitis and infectious bursal disease viruses. Avian Dis 1976;20:467–72. [14] McNeilly F, Smyth JA, Adair BM, McNulty MS. Synergism between chicken anemia virus (CAV) and avian reovirus following dual infection of 1-day-old chicks by a natural route. Avian Dis 1995;39: 32–537. [15] Stram Y, Meir R, Molad T, Blumenkranz R, Malkinson M, Weisman Y. Applications of the polymerase chain reaction to detect infectious bursal disease virus in naturally infected chickens. Avian Dis 1994;38: 879–84. [16] Todd D, MaWhinney KA, McNulty MS. Detection and differentiation of chicken anemia virus isolates by using the polymerase chain reaction. J Clin Microbiol 1992;30: 1661–6. [17] Xie Z, Fadl AA, Girshick T, Khan MI. Amplification of avian reovirus RNA using the reverse transcription-polymerase chain reaction. Avian Dis 1997;41:654– 60. [18] Xie Z, Fadl AA, Girshick T, Khan MI. Amplification of avian adenovirus by polymerase chain reaction. Avian Dis 2000;43: 98–105. [19] Imai K, Mase M, Yamaguchi S, Yuasa N, Nakmura K. Detection of chicken anemia virus DNA from formalin-fixed tissues by polymerase chain reaction. Res Vet Sci 1998;64:205–8. [20] Jackwood DJ, Nielson CK. Detection of infectious bursal disease viruses in commercially reared chickens using the reverse transcriptase/ polymerase chain reaction-restriction endonuclease assay. Avian Dis 1997;41:137–43. [21] Jiang P, Ojkic D, Tuboly T, Huber P, Nagy E. Application of the polymerase chain reaction to detect fowl adenoviruses. Can J Vet Res 1999;63:124 –8. [22] Kataria RS, Tiwari AK, Nanthakumar T, Goswami PP. One step RT-PCR for the detection of infectious bursal disease virus in clinical samples. Vet Res Comm 2001;25:429–36. [23] Liu HJ, Chen JH, Liao MH, Lin MY, Chang GN. Identification of the sigma C-encoded gene of avian reovirus by nested PCR and restriction endonuclease analysis. J Virol Meth 1999;81:83–90. [24] Pang Y, Wang H, Girshick T, Xie Z, Khan MI. Development and application of a multiplex polymerase chain reaction for avian respiratory agents. Avian Dis 2002;46:691–9. [25] Wang H, Amin FA, Khan MI. Multiplex PCR for avian pathogenic mycoplasmas. J Mol Cell Probes 1997;11:211 –6.
298
K.M. Caterina et al. / Molecular and Cellular Probes 18 (2004) 293–298
[26] Wang X, Khan MI. A multiplex PCR for Massachusetts and Arkansas serotypes of infectious bronchitis virus. J Mol Cell Probes 1999;13: 1–7. [27] Penna MS, Khan MI, French RA. Development of a multiplex PCR for the detection of Halosporidium nelsoni, Haplosporidium costale and Perkinsus marinus in the eastern oyster (Crassotrea virginica, Gmelin, 1971). Mol Cell Probes 2001;15:385 –90. [28] Soumet C, Ermel G, Rose N, Rose V, Drowin P, Salrat G, Colin P. Evaluation of a multiplex PCR assay for simultaneous identification of Salmonella sp., Salmonella enteritidis and Salmonella typhimurium from environmental swabs of poultry houses. Lett Appl Microbiol 1998;28:113 –7. [29] van der Heide L, Kalbac M, Hall WC. Infectious tenosynovitis (viral arthritis): characterization of a Connecticut viral isolant as a reovirus and evidence of viral egg transmission by reovirus-infected broiler breeders. Avian Dis 1975;19:653 –8. [30] McNulty MS, Connor TJ, McNeilly F, Kirkpatrick KS, McFerran JB. A serological survey of domestic poultry in the United Kingdom for antibody to chicken anaemia agent. Avian Pathol 1988;17:315– 24. [31] Inglis GD, Kalischuk LD. Use of PCR for direct detection of Campylobacter species in bovine feces. Appl Environ Microbiol 2003;69:3435 –47.
[32] Fagen PK, Hornitzky MA, Bettelheim KA, Djordjevic SP. Detection of Shiga-like toxin (stx1 and stx2), Intimin (eaeA), and Enterohemorrhagic Escherichia coli (EHEC) Hemolysin (EHEC hlyA) Genes in animal feces by mulitplex PCR. Appl Environ Microbiol 1999;65: 868 –72. [33] Pass MA, Odedra R, Batt RM. Multiplex PCRs for identification of Escherichia coli virulence genes. J Clin Microbiol 2000;38: 2001–4. [34] van der Heide L. Viral arthritis/tenosynovitis: a review. Avian Pathol 1977;6:271–84. [35] Cook JKA. Spread of an avian adenovirus (CELO virus) to uninoculated fowls. Res Vet Sci 1974;16:156–61. [36] Cosgrove AS. An apparently new disease of chickens-avian nephrosis. Avian Dis 1962;6:385 –9. [37] Benton WJ, Cover MS, Rosenberger JK, Lake RS. Physiochemical properties of the infectious bursal agent (IBA). Avian Dis 1967;11: 438 –45. [38] Hoop RK. Persistence and vertical transmission of chicken anaemia agent in experimentally infected laying hens. Avian Pathol 1992;21: 493 –501. [39] Yuasa N, Taniguchi T, Yoshida I. Isolation and some characteristics of an agent inducing anaemia in chicks. Avian Dis 1979;23:366 –85.
Development of a multiplex PCR for detection of avian adenovirus, avian reovirus, infectious bursal disease virus, and chicken anemia virus Kristen M. Caterinaa, Salvatore Frasca Jrb, Theodore Girshickb, Mazhar I. Khana,* a
Department of Pathobiology and Veterinary Science, University of Connecticut, 61 North Eagleville Road, Storrs, CT 06269-3089, USA b Charles River, SPAFAS, Inc., 67 Baxter Road, Storrs, CT 06268, USA Received 16 February 2004; accepted for publication 6 April 2004
Abstract A multiplex polymerase chain reaction (mPCR) was developed and optimized for the simultaneous detection and differentiation of avian reovirus (ARV), avian adenovirus group I (AAV-I), infectious bursal disease virus (IBDV), and chicken anemia virus (CAV). Four sets of specific oligonucleotide primers were used in this test for ARV, AAV-I, IBDV, and CAV. The mPCR DNA products were visualized by gel electrophoresis and consisted of fragments of 365 bp for IBDV, 421 bp for AAV-I, 532 bp for ARV, and 676 bp for CAV. The mPCR assay developed in this study was found to be sensitive and specific. Detection of PCR-amplified DNA products was 100 pg for both CAV and IBDV, and 10 pg for both ARV and AAV-I and this mPCR did not amplify nucleic acids from the other avian pathogens tested. The mPCR demonstrated similar sensitivity in tests using experimental fecal cloacal swab specimens that were spiked with ARV, AAV-1, IBDV, and CAV, and taken from specific pathogen free (SPF) chickens. This mPCR detected and differentiated various combinations of RNA/DNA templates from ARV, AAV-I, CAV, and IBDV without reduction of amplification from feces. q 2004 Elsevier Ltd. All rights reserved. Keywords: Multiplex polymerase chain reaction; Avian adenovirus; Avian reovirus; Infectious bursal disease virus; Chicken anemia virus
1. Introduction Avian reovirus (ARV), avian adenovirus group 1 (AAV-I), infectious bursal disease virus (IBDV) and chicken anemia virus (CAV) are all highly pathogenic viruses that have detrimental effects on the health of poultry, and share a number of similarities. Birds that become infected with each of these viruses individually can present with similar symptoms, such as depression, immunosuppression, weight loss, and enteritis [1,3 – 9,34 –39]. All of these viruses can be isolated from the feces, [1 – 3] and multiple infections with these viruses can also occur, making it difficult to determine which of these viruses is causing disease in infected flocks [3, 10 –14]. Diagnostic testing is essential to determine which pathogen may be causing illness in poultry. Rapid diagnostic detection of these viruses is particularly important to the poultry industry in order to prevent spread of disease and to limit economic losses. Serology, isolation and identification are methods used to detect these viruses; however, isolation * Corresponding author. Tel.: þ 1-860-486-0228; fax: þ1-860-486-2794. E-mail address: [email protected] (M.I. Khan). 0890-8508/$ - see front matter q 2004 Elsevier Ltd. All rights reserved. doi:10.1016/j.mcp.2004.04.003
and identification can be laborious and time consuming, while serology is often plagued by nonspecific reactions and problems with reagent cross-reaction [2]. Although, singleband PCR has also been used to detect these pathogens, it only allows for detection of nucleic acid from one specific pathogen at a time [15 – 23]. Multiplex polymerase chain reaction (mPCR) is advantageous because it allows one to detect and distinguish multiple pathogenic agents through the use of one test rather than four separate single-band PCRs. Multiplex PCR has the added benefits of being cost effective, time saving, specific and sensitive, furthermore, it has been used for screening and surveillance of poultry flocks [24 – 28]. The goal of this research was to develop mPCR that would allow for identification of ARV, AAV-I, IBDV, and CAV simultaneously in one reaction. Because ARV, AAV-1, IBDV, and CAV are all shed in the feces of chickens, fecal samples can be the best source for simultaneous detection of these viruses. Previous studies have shown that fecal samples can be used in PCR and mPCRs, and that the tests are still highly sensitive [31 – 34]. Testing of experimentally prepared fecal cloacal swabs was carried out in order to
294
K.M. Caterina et al. / Molecular and Cellular Probes 18 (2004) 293–298
determine whether potential fecal inhibitors will have an effect on the sensitivity and specificity of this mPCR in the detection of ARV, AAV-1, IBDV, and CAV.
[30]. The cell culture was clarified by centrifugation. Salmonella enteritidis was grown in nutrient broth and obtained from American Type Culture Collection (Manassas, VA).
2. Materials and methods
2.2. Extraction of RNA and DNA
2.1. Avian pathogens
RNA extraction from ARV, NDV, AI, ALV-J and IBDV was carried out according to the Trizol LS manufacturer’s protocol and as described by Xie et al. (Trizol LS, Life Technologies, Bethesda, MD) [17], DNA from CAV, MD, AAV-I and S. enteritidis was extracted using the phenol: chloroform:isoamyl alcohol (1:1:24 v/v) (Gibco BRL, Grand Island, NY) method as described by Xie et al. [18]. The concentrations of the RNA/DNA were determined by spectrophotometry using the Bio Mate 5 (Thermo Spectronic, Rochester, NY) and stored at 2 20 C.
The avian pathogens used in this study are listed in Table 1. AAV-I, avian influenza (AI), Newcastle Disease virus (NDV), and IBDV were propagated in the allantoic cavity of 10-day-old SPF embryonated chicken eggs; the allantoic fluids were harvested and clarified by centrifugation. ARV was propagated in chicken embryo fibroblast (CEF) monolayers as described by van der Heide et al. [29]. ARV-infected cell cultures were clarified by centrifugation. Marek’s Disease virus (MDV) and Avian Leukosis Virus, Subgroup J (ALV-J) were also propagated in CEFs and the cell cultures were clarified by centrifugation. CAV was grown in MDCC-MSB1 cells as described by McNulty et al.
Table 1 Avian pathogens used in multiplex PCR
2.3. Oligonucleotide primers Four sets of primers that specifically amplify ARV, AAV-I, IBDV, and CAV were published previously and their sequences are listed in Table 2. All four sets of oligonucleotide primers were synthesized at Invitrogen/ Gibco (Carlsbad, CA). The primers were aliquoted into 100 ml volumes and stored at 2 20 C.
Avian pathogen
Strain/isolate
Source
Avian adenovirus group 1 (AAV-1) AAV-1 AAV-1 AAV-1 AAV-1 AAV-1 Chicken anemia virus (CAV) CAV Avian reovirus (ARV) ARV ARV ARV ARV Infectious bursal disease virus (IBDV) IBDV IBDV
CELO
University of Rhode Island
2.4. Reverse transcription and multiplex PCR reaction
Type 3 Type 5 Type 7 94:536 (p2) 570 CL-1
Cornell University Cornell University Cornell University Washington State University Washington State University University of Maryland
The mPCR consists of a two-step procedure, which includes reverse transcription (RT) and PCR amplification.
Delrose S1133
NVSLa University of Connecticut
S1133(p11) S1133(p9) S1133(p8) S1133(p76) Serotype 1, strain 2512 D78 Variant E
University University University University University
Pathogens used in specificity testing of mPCR NDV AI ALV-J MD S. enteritidis a b c d e
B1 LaSota T/W/66 HC-1 SB1
of Connecticut of Connecticut of Connecticut of Connecticut of Delaware
Intervet Inc.b University of Maryland
Provided by SPAFASc University of Minnesota ADOLd Cornell University ATCCe
National Veterinary Services Laboratory, Ames, IA. Intervet Incorporated, Millsboro, DE. Charles River, SPAFAS, Inc., Storrs, CT, 06268. Avian Disease and Oncology Laboratory, East Lansing, MI. American Type Culture Collection, Manassas, VA, 20108.
Table 2 .PCR primers used in multiplex PCR Avain pathogen
Primer sequence
PCR product size (bp)
CAVa (MK10) CAVa (MK11) Reovirusb (MK87) Reovirusb (MK88) Adenovirusc (MK89) Adenovirusc (MK90) IBDVd (MK114) IBDVd (MK115)
50 GACTGTAAGATGGCAAGACGAGCTC30
675
a b c d
Ref. Ref. Ref. Ref.
[17]. [18]. [19]. [16].
50 GGCTGAAGGATCCCTCATTC30 50 GGTGCGACTGCTGTATTTGGTAAC30
532
50 AATGGAACGATAGCGTGTGGG30 50 CCCTCCCACCGCTTACCA30
421BP
50 CACGTTGCCCTTATCTTGC30 50 AGCCTTCTGATGCCAACAAC30 50 ATCTGTCAGTTCACTCAGGC30
365
K.M. Caterina et al. / Molecular and Cellular Probes 18 (2004) 293–298
The Gene Amp RNA PCR kit (Applied Biosystems, Branchburg, NJ) was used for the reverse transcription reaction. RT was performed in 25 ml volumes, in which the reaction mixture contained 5 mM MgCl2, 1 £ of 10 £ PCR buffer II, 1 mM of each dinucleoside triphosphate (dNTP), 1 Unit RNase inhibitor, 2.5 mM random hexamers, 2.5 Units Moloney murine leukemia virus (MuLV) reverse transcriptase, RNA in 3 ml volumes in different concentrations and sterile de-ionized water was added to bring the final volume to 25 ml. RT was carried out in a thermal cycler (Model 480, Perkin Elmer Cetus, Norwalk, CT) for one cycle at 42 C for 15 min, 99 8C for 5 min, and 5 8C for 5 min. The mPCR reaction was performed in a 100 ml volume with using the Gene Amp PCR kit (Applied Biosystems, Branchburg, NJ) and AmpliTaq Goldw (Applied Biosystems, Branchburg, NJ). The reaction contained 2.5 mM MgCl2, 1 £ PCR Buffer II (500 mM KCL, 100 mM Tris HCl, pH 8.3), 200 mM each dNTP, 15 pmol of reovirus primers, MK87 and MK88, 15 pmol CAV primers MK10 and MK11, 10.5 pmol of adenovirus primers MK89 and MK90, 90 pmol IBDV primers, MK114 and MK115, and 2.5 Units AmpliTaq Goldw. This mixture was added to the RT reaction tubes along with 100 ng of DNA template. Sterile de-ionized water was added to this mixture to bring the total volume to 100 ml. The mixture was overlaid with 50 ml mineral oil and mPCR was carried out in the same thermal cycler used for RT. The cycling protocol consisted of an initial denaturation at 94 8C for 5 min, then 35 cycles that each consisted of denaturation at 94 8C for 1 min, annealing at 50 8C for 1 min, and extension at 72 8C for 2 min. The sample was then heated at 72 8C for 10 min for a final extension. A negative control was run with each test. The negative control did not contain template DNA and consisted of PCR master mix, all four sets of primers and de-ionized water. 2.5. Detection of amplified mPCR products Agarose gel electrophoresis was used to detect mPCR products. Ten microliter volumes of PCR products were separated through a 2% agarose horizontal gel by electrophoresis at 84 Volts. Gels were stained with ethidium bromide (0.5 ug/ml), and visualized by ultraviolet light and photographed. 2.6. MPCR sensitivity and specificity Determination of the specificity of the mPCR was carried out by examining the ability of the test to detect and differentiate only ARV, AAV, CAV, and IBDV. The mPCR was tested using other avian pathogens that are shed in the feces, have similar symptoms or can be present in a multiple infection with ARV, AAV-I, CAV or IBDV. Those avian pathogens tested were NDV, MD, ALV-J, AI, and S. enteritidis. Further assessment of the mPCR specificity was carried out by testing different isolates and strains of
295
AAV-1, ARV, IBDV and CAV. These isolates and strains are listed in Table 1. Sensitivity of the mPCR was determined by making 10-fold serial dilutions of a mixture containing 100 ng of the RNA/DNA templates of each of the four pathogens. 2.7. Detection of ARV, AAV-1, IBDV, and CAV in fecal cloacal swab samples Sterile, cotton-tipped applicators were used to take fecal cloacal swab samples from 20 SPF chickens. The swabs were soaked in 1 ml of sterile de-ionized water for 1 h at room temperature. Five hundred microliters from each of four of the water-containing fecal swab samples were inoculated with 108.8 ELD50 of AAV-1 (CELO). Along with this, 500 ml from each of four of the water-containing fecal swab samples were inoculated with 107.0 TCID50 of CAV (CL-1). Also, 250 ml from each of four of the watercontaining fecal swab samples were inoculated with 104.1 ELD50 of IBDV (2512). Lastly, 250 ml from each of four of the water-containing fecal swab samples were inoculated with 107.2 TCID50 ARV (S1133). The remaining watercontaining fecal swab samples that were not inoculated with virus were used as negative controls. Sterile de-ionized water, which was inoculated with each of the viral pathogens as above, was used as the positive control. The RNA/DNA was extracted according to the protocol, described above. The concentrations of the RNA/DNA were determined by spectrophotometry using the Bio Mate 5 (Thermo Spectronic, Rochester, NY) and stored at 2 20 8C. One hundred nanograms of each of the extracted viral RNA/DNA were tested with the mPCR. In order to examine if chicken feces had an inhibitory effect on the ability of the mPCR to detect and differentiate ARV, AAV-I, IBDV and CAV in the same reaction, different combinations of 100 ng of the RNA/DNA templates from the four pathogens were tested by the mPCR. Sensitivity of the mPCR was determined by making 10-fold serial dilutions of a mixture containing 100 ng of the RNA/DNA templates of each of the four pathogens.
3. Results Throughout this research manipulations were made to the annealing temperature, extension time, cycle quantity, and primer concentrations in order to obtain the optimal conditions for this mPCR. This multiplex PCR was developed to detect ARV, AAV-I, CAV and IBDV in a single reaction through 35 cycles of PCR. The mPCR products were 676 bp for CAV, 532 bp for ARV, 421 bp for AAV, and 365 bp for IBDV and each product was visualized by electrophoresis on 2% agarose gel followed by ethidium bromide staining and UV transillumination (Figs. 1 and 2). This mPCR was found to be specific assay for ARV, AAV-I, CAV and IBDV with no amplification of
296
K.M. Caterina et al. / Molecular and Cellular Probes 18 (2004) 293–298
the 10-fold serial dilutions of a spiked fecal mixture containing 100 ng of the DNA/RNA templates of each of the four pathogens (data not shown). No spurious PCR amplification reactions among all four pathogens were noticed with various amount of DNA and RNA mixtures. All the negative controls were negative.
4. Discussion
Fig. 1. Agarose gel electrophoresis of multiplex PCR-amplified products from purified DNAs RNAs of known avian pathogens. Lane 1, 100 bp ladder. Lane2, mPCR; CAV (CL-1),ARV (S1133), AAV-1, IBDV (serotype 1). Lane 3, CAV. Lane 4, ARV. Lane 5, AAV-1. Lane 6, IBDV. Lane 7, AI. Lane 8, NDV. Lane 9, MDV. Lane 10, Salmonella enteritidis. Lane 11, ALV-J. Lane 12, negative control.
nucleic acids from MD, NDV, AI, ALV-J, or S. enteritidis (Fig. 1). It was able to detect nucleic acid for ARV, AAV-I, CAV and IBDV that are listed in Table 1. Detection by visualization of PCR-amplified DNA products was 100 pg for both IBDV and CAV, and 10 pg for both ARV and AAV-I (Fig. 2). The mPCR detected and differentiated the various combinations of RNA/DNA templates from the ARV, AAV-I, CAV, and IBDV spiked fecal swab samples (Fig. 3). Further this mPCR was found to be equally sensitive on
The mPCR developed in this research was able to detect ARV, AAV-I, IBDV, and CAV simultaneously in one reaction. These four viruses are highly pathogenic and are transmitted rapidly among birds. Therefore, rapid diagnostic detection of these pathogens is important for early detection, prevention of spread of disease and avoidance of economic losses. The mPCR has been proven to be sensitive, specific, cost effective and can be useful in diagnosis, screening and surveillance of flocks. Furthermore, this mPCR has the added benefits of being time saving, e.g. only one sample from one source, such as feces or cloacal swabs, has to be processed, economical, e.g. less reagents are used to carry out one mPCR rather than four separate single-band PCRs, sensitive and specific, e.g. providing detection of small quantities of only these four viruses. Inhibitors can be a problem when using fecal samples in the diagnosis of pathogens through the use of PCR. This study focused on testing whether chicken feces would hinder the sensitivity of the mPCR and its ability to detect ARV, AAV-1, IBDV, and CAV. The results of this study showed that chicken feces do not reduce the ability of the mPCR to detect different combinations of the four avian pathogens (Fig. 3). The mPCR was still highly sensitive in
Fig. 2. Sensitivity of mPCR. Lane 1, 123 bp ladder. Lane 2, CAV. Lane 3, ARV (S1133). Lane 4, AAV-1. Lane 5, IBDV, Lane 6, 100 ng of DNA or RNA for each of CAV, ARV, AAV-1, and IBDV, Lane 7, 10 ng, Lane 8, 1 ng, Lane 9, 100 pg, Lane 10, 10 pg, Lane 11, 1 pg, Lane 12, 100 fg, Lane 13, 10 fg, Lane 14, 1 fg, Lane 15 no sample.
K.M. Caterina et al. / Molecular and Cellular Probes 18 (2004) 293–298
Fig. 3. Agarose gel electrophoresis of mPCR products from in vitro combinatory viral assay, testing ARV, AAV-1, IBDV, and CAV spiked fecal cloacal swab specimens. Lane 1, 123 bp ladder; Lane 2, CAV; Lane 3, ARV; Lane 4, AAV-1; Lane 5, IBDV; Lane 6, ARV; IBDV; Lane 7, ARV; AAV-1; IBDV; Lane 8, CAV; AAV-1; Lane 9, CAV; ARV; AAV-1.
its detection of AAV-1, CAV, ARV and IBDV in spiked fecal samples. Overall this study has shown that feces will be acceptable as a principal sample in testing for ARV, AAV-1, IBDV and CAV with this mPCR, and that one fecal cloacal swab sample can be tested for each of the four pathogens which allows for a quick, sensitive, and specific diagnosis with this mPCR.
Acknowledgements This work was supported by the Charles River, SPAFAS, Inc. We thank Mrs Marianne Kalbac for technical assistant in propagation and isolation of the viruses. We also thank Dr K. S. Venkitanarayanan for his advice and criticism.
References [1] Charlton BR, editor. Avian disease manual, 5th ed. American Association of Avian Pathologists; 2000. [2] Swayne DE, Glisson JR, Jackwood MW, Pearson JE, Reed WM, editors. A laboratory manual for the isolation and identification of avian pathogens, 4th ed. Florida: The American Association of Avian Pathologists, PA Rose Printing; 1998. [3] Saif YM, Barnes HJ, Glisson JR, Fadly AM, McDougald LR, Swayne DE, editors. Diseases of poultry, 11th ed. Ames, IA: Iowa State University Press; 2003. [4] Bakay M, Beladi I, Berensci K, Sidorova E, Agadzanyan M, Fachet J, Erdei J. Immunoenhancement and suppression induced by adenovirus in chicken. Acta Virol 1992;36:269–76.
297
[5] Hirai K, Shimakura S, Kawamoto E, Taguchi F, Kim ST, Chang CN, Iritani Y. The immunodepressive effect of infectious bursal disease virus in chickens. Avian Dis 1974;18:50–7. [6] Lutlicken D. Viral diseases of the immune system and strategies to control infectious bursal disease by vaccination. Acta Vet Hung 1997; 47:239–49. [7] Markowski-Grimsrud CJ, Schat KA. Infection with chicken anemia virus impairs the generation of pathogen-specific cytotoxic T lymphocytes. Immunology 2003;109:283–94. [8] Rinehart CL, Rosenberger JK. Effects of avian reoviruses on the immune responses of chickens. Poult Sci 1983;62:1488–9. [9] Sharma JM, Karaca K, Pertile T. Virus-induced immunosuppression in chickens. Poult Sci 1994;73:1082–6. [10] Toro H, Gonzalez C, Cerada L, Hess M, Reyes E, Geissea C. Chicken anemia virus and fowl adenoviruses: association to induce inclusion body hepatitis/hydropericardium syndrome. Avian Dis 2000;44:51 –8. [11] Imai K, Mase M, Tsukamoto K, Hihara H, Yuasa N. Persistent infection with chicken anaemia virus and some effects of highly virulent infectious bursal disease virus infection on its persistency. Res Vet Sci 1999;67:233–8. [12] Ragland WL, Novak R, El-Attrache J, Savic V, Ester K. Chicken anemia virus and infectious bursal disease virus interfere with transcription of chicken IFN-alpha and IFN-gamma mRNA. J Interferon Cytokine Res 2002;22:437–41. [13] Fadly AM, Winterfield RW, Olander HJ. Role of the bursa of Fabricius in the pathogenicity of inclusion body hepatitis and infectious bursal disease viruses. Avian Dis 1976;20:467–72. [14] McNeilly F, Smyth JA, Adair BM, McNulty MS. Synergism between chicken anemia virus (CAV) and avian reovirus following dual infection of 1-day-old chicks by a natural route. Avian Dis 1995;39: 32–537. [15] Stram Y, Meir R, Molad T, Blumenkranz R, Malkinson M, Weisman Y. Applications of the polymerase chain reaction to detect infectious bursal disease virus in naturally infected chickens. Avian Dis 1994;38: 879–84. [16] Todd D, MaWhinney KA, McNulty MS. Detection and differentiation of chicken anemia virus isolates by using the polymerase chain reaction. J Clin Microbiol 1992;30: 1661–6. [17] Xie Z, Fadl AA, Girshick T, Khan MI. Amplification of avian reovirus RNA using the reverse transcription-polymerase chain reaction. Avian Dis 1997;41:654– 60. [18] Xie Z, Fadl AA, Girshick T, Khan MI. Amplification of avian adenovirus by polymerase chain reaction. Avian Dis 2000;43: 98–105. [19] Imai K, Mase M, Yamaguchi S, Yuasa N, Nakmura K. Detection of chicken anemia virus DNA from formalin-fixed tissues by polymerase chain reaction. Res Vet Sci 1998;64:205–8. [20] Jackwood DJ, Nielson CK. Detection of infectious bursal disease viruses in commercially reared chickens using the reverse transcriptase/ polymerase chain reaction-restriction endonuclease assay. Avian Dis 1997;41:137–43. [21] Jiang P, Ojkic D, Tuboly T, Huber P, Nagy E. Application of the polymerase chain reaction to detect fowl adenoviruses. Can J Vet Res 1999;63:124 –8. [22] Kataria RS, Tiwari AK, Nanthakumar T, Goswami PP. One step RT-PCR for the detection of infectious bursal disease virus in clinical samples. Vet Res Comm 2001;25:429–36. [23] Liu HJ, Chen JH, Liao MH, Lin MY, Chang GN. Identification of the sigma C-encoded gene of avian reovirus by nested PCR and restriction endonuclease analysis. J Virol Meth 1999;81:83–90. [24] Pang Y, Wang H, Girshick T, Xie Z, Khan MI. Development and application of a multiplex polymerase chain reaction for avian respiratory agents. Avian Dis 2002;46:691–9. [25] Wang H, Amin FA, Khan MI. Multiplex PCR for avian pathogenic mycoplasmas. J Mol Cell Probes 1997;11:211 –6.
298
K.M. Caterina et al. / Molecular and Cellular Probes 18 (2004) 293–298
[26] Wang X, Khan MI. A multiplex PCR for Massachusetts and Arkansas serotypes of infectious bronchitis virus. J Mol Cell Probes 1999;13: 1–7. [27] Penna MS, Khan MI, French RA. Development of a multiplex PCR for the detection of Halosporidium nelsoni, Haplosporidium costale and Perkinsus marinus in the eastern oyster (Crassotrea virginica, Gmelin, 1971). Mol Cell Probes 2001;15:385 –90. [28] Soumet C, Ermel G, Rose N, Rose V, Drowin P, Salrat G, Colin P. Evaluation of a multiplex PCR assay for simultaneous identification of Salmonella sp., Salmonella enteritidis and Salmonella typhimurium from environmental swabs of poultry houses. Lett Appl Microbiol 1998;28:113 –7. [29] van der Heide L, Kalbac M, Hall WC. Infectious tenosynovitis (viral arthritis): characterization of a Connecticut viral isolant as a reovirus and evidence of viral egg transmission by reovirus-infected broiler breeders. Avian Dis 1975;19:653 –8. [30] McNulty MS, Connor TJ, McNeilly F, Kirkpatrick KS, McFerran JB. A serological survey of domestic poultry in the United Kingdom for antibody to chicken anaemia agent. Avian Pathol 1988;17:315– 24. [31] Inglis GD, Kalischuk LD. Use of PCR for direct detection of Campylobacter species in bovine feces. Appl Environ Microbiol 2003;69:3435 –47.
[32] Fagen PK, Hornitzky MA, Bettelheim KA, Djordjevic SP. Detection of Shiga-like toxin (stx1 and stx2), Intimin (eaeA), and Enterohemorrhagic Escherichia coli (EHEC) Hemolysin (EHEC hlyA) Genes in animal feces by mulitplex PCR. Appl Environ Microbiol 1999;65: 868 –72. [33] Pass MA, Odedra R, Batt RM. Multiplex PCRs for identification of Escherichia coli virulence genes. J Clin Microbiol 2000;38: 2001–4. [34] van der Heide L. Viral arthritis/tenosynovitis: a review. Avian Pathol 1977;6:271–84. [35] Cook JKA. Spread of an avian adenovirus (CELO virus) to uninoculated fowls. Res Vet Sci 1974;16:156–61. [36] Cosgrove AS. An apparently new disease of chickens-avian nephrosis. Avian Dis 1962;6:385 –9. [37] Benton WJ, Cover MS, Rosenberger JK, Lake RS. Physiochemical properties of the infectious bursal agent (IBA). Avian Dis 1967;11: 438 –45. [38] Hoop RK. Persistence and vertical transmission of chicken anaemia agent in experimentally infected laying hens. Avian Pathol 1992;21: 493 –501. [39] Yuasa N, Taniguchi T, Yoshida I. Isolation and some characteristics of an agent inducing anaemia in chicks. Avian Dis 1979;23:366 –85.