- Email: [email protected]
Development of a novel multiplex PCR for the detection and differentiation of Salmonella enterica serovars Typhi and Paratyphi A
Research in Microbiology 161 (2010) 243e248 www.elsevier.com/locate/resmic
Development of a novel multiplex PCR for the detection and differentiation of Salmonella enterica serovars Typhi and Paratyphi A Grace Jie Yin Ngan, Li Mei Ng, Raymond T.P. Lin, Jeanette W.P. Teo* National University Hospital, Department of Laboratory Medicine, 5 Lower Kent Ridge Road, Main Building I, Singapore 119074, Singapore Received 21 December 2009; accepted 11 March 2010 Available online 8 April 2010
Abstract In this study, we developed a multiplex polymerase chain reaction (mPCR) assay for pan-Salmonella detection as well as for specific detection of serovars Typhi and Paratyphi A. The assay detects members of the Salmonella genus by amplifying the outer membrane protein C (ompC ). The presence of either Salmonella serovar Typhi or Paratyphi A is indicated by amplification of the putative regulatory protein gene STY4220, which is common to both serovars. Further differentiation of the serovars was achieved by targeting the intergenic region (SSPAI) between SSPA1723a and SSPA1724 in serovar Paratyphi A, and stgA, a fimbrial subunit protein, in serovar Typhi. mPCR was evaluated using 124 clinical and reference Salmonella serovars. S. enterica serovars Typhi and Paratyphi A were detected at 100% specificity and sensitivity. Each PCR reaction detected approximately 1 pg of Salmonella genomic DNA. Sensitivity of the PCR when tested on 8-h-enriched spiked blood samples of serovars Typhi and Paratyphi A was estimated at 4.5 104e5.5 104 CFU/ml, with similar detection levels observed for spiked fecal samples. This mPCR could prove to be a useful diagnostic tool for the detection and differentiation of serovars Typhi and Paratyphi A. Ó 2010 Elsevier Masson SAS. All rights reserved. Keywords: Salmonella enterica serovar Typhi; Salmonella enterica serovar Paratyphi A; Enteric fever; Multiplex polymerase chain reaction; Comparative genomics
1. Introduction Salmonella enterica serovars Typhi and Paratyphi (A, B, C) are causative bacterial agents of typhoid and paratyphoid fever (enteric fevers). Enteric fevers remain a global public concern in many geographic areas, particularly in developing countries with poor sanitary systems and improper treatment of water supplies (Parry et al., 2002). Annually these pathogens account for more than 25 million infections worldwide, resulting in approximately 200,000 deaths (Crump et al., 2004). Historically, typhoid fever is considered a more critical and predominant illness than paratyphoid fever; however, in recent decades, it has been superceded by paratyphoid fever (Ochiai et al., 2005). Amongst S. enterica serovar Paratyphi, Paratyphi A is gaining prevalence in southeast Asia and is
* Corresponding author. Tel.: þ65 6772 2342; fax: þ65 6775 1575. E-mail address: [email protected] (J.W.P. Teo). 0923-2508/$ - see front matter Ó 2010 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.resmic.2010.03.005
responsible for 30e50% of enteric fever cases (Maskey et al., 2008; Woods et al., 2006). This increment is attributed to the emergence of multiple-drug or fluoroquinolone-resistant strains of serovar Paratyphi A and administration of the Salmonella serovar Typhi vaccine which provides little crossprotection against serovar Paratyphi A (Pokheral et al., 2006; Tankhiwale et al., 2003; Zhang et al., 2004). Early and accurate diagnosis of typhoid and paratyphoid fever coupled with prompt medical intervention is essential in reducing the morbidity and mortality associated with enteric fevers. Currently, most routine microbiology laboratories still rely on conventional methods (culture method and biochemical test) for diagnosis of typhoid and paratyphoid fever and this requires a minimum of 4e5 days for identification. PCR diagnostic tests have proven to be rapid and effective for the detection and identification of typhoid fever and paratyphoid fever (Alvarez et al., 2004; Pathmanathan et al., 2003). In this study, the approach we have taken to designing this mPCR assay was based on searching for genes unique to the serovars
244
G.J. Yin Ngan et al. / Research in Microbiology 161 (2010) 243e248
(Ou et al., 2007; Nagarajan et al., 2009). This is unlike conventional mPCRs, which often target H antigen genes, O antigen synthesis genes, Vi capsular antigen gene, 16S rRNA gene for detection of S. enterica serovar Typhi and other Salmonella serovars (Kumar et al., 2005; Mcquiston et al., 2004; Teh et al., 2008; Hirose et al., 2002) where the diagnosis is often based on sequence polymorphisms or differences rather than the absence or presence of genes. Here we report the development of an mPCR assay that targets novel serovarspecific genes for the differentiation between serovars Typhi and Paratyphi A. For the specific detection of serovar Typhi, the first gene of the fimbrial operon gene (stgA) was targeted, whilst in serovar Paratyphi A, the intergenic region between genes SSPA1723a and SSPA1724 was used. The STY4220 loci which encodes a putative regulatory protein was
indicative of the presence of both serovars Typhi and Paratyphi A. Finally, outer membrane protein gene (ompC ) was used for pan-Salmonella detection. Hence this assay enabled detection of bacterial isolates of the Salmonella genus with discrimination between serovars Typhi and Paratyphi A. 2. Materials and methods 2.1. Bacterial isolates and genomic DNA extraction A total of 124 Salmonella strains (clinical and reference strains) and 8 non-Salmonella Gram-negative bacteria strains were obtained from the microbiology laboratory at the National University Hospital, Singapore and the National Public Health Laboratory, Singapore (Table 1). The period of
Table 1 Bacterial strains used for the evaluation of primer specificity in the mPCR assay and mPCR results. Salmonella enterica strains
No. of isolates
Antigenic
Structure
mPCR
positive
for
O antigen
H-1
1,2,12 4,5,12 4,5,12 4,5,12
a b d i
H-2
ompC
STY4220
stgA
SSPAI
e 1,2 1,2 1,2
þ þ þ þ
þ
þ
8 6,7 6,7 6,7 8,20 6,8 8 8,20 6,8 6,8 6,7 7 6,7 6,7 6,7
z4,z24 i y e,h z4, z23 z10 z10 z10 d e,h a f,g r c c
e 1,2 1,5 e,n,z15 e e,n,x e,n,x Z6 1,2 1,2 e,n,x e 1,2 1,5 1,5
þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ
Serogroup
Serovar
A B
Paratyphi A Paratyphi B Stanley Typhimurium
7 3 4 10
C
Albany Augustenborg Bareilly Braenderup Corvallis Hadar Istanbul Molade Muenchen Newport Oslo Rissen Virchow Choleraesuis Paratyphi C
2 2 4 4 6 2 1 1 1 2 2 1 1 1 1
D
Typhi Enteritidis Javiana Sendai Panama
14 29 2 1 1
9,12 [Vi] 1,9,12 1,9,12 1,9,12 1,9,12
d g,m l,z28 a l,v
e e 1,5 1,5 1,5
þ þ þ þ þ
þ
þ
E
Senftenberg Weltevreden Gaminara Hvittingfoss Minnesota subsp.diarizonae
1 17 1 1 1 1
1,3,19 3,10 16 16 21 (6),14
g,s,t r d b b 10
e z6 1,7 e,n,x e,n,x z
þ þ þ þ þ þ
e e e e e e e e
e e e e e e e e
e e e e e e e e
e e e e e e e e
I L Others
Non-Salmonella strains Providencia spp. Pseudomonas aeruginosa Citrobacter freundii Shigella dysenteriae Serratia marcescens Proteus mirabilis Escherichia coli Enterobacter cloacae Total
1 1 1 1 1 1 1 1 132
G.J. Yin Ngan et al. / Research in Microbiology 161 (2010) 243e248
245
collection was between the years 2007e2009. The 7 reference Salmonella enterica serovars from the American Type Culture Collection (ATCC) were: Paratyphi A (ATCC 9150), Paratyphi B (ATCC 10719), Paratyphi C (ATCC 13428), Choleraesuis (ATCC 13312), Enteritidis (ATCC 13076), Typhimurium (ATCC 700720), and Sendai (ATCC 1586). The serotypes of all clinical Salmonella strains were identified based on the White-Kauffmann-Le Minor Scheme (Table 1). Genomic DNA of all bacterial strains was extracted using the QiagenÒ DNeasy blood & tissue kit (Qiagen, Hilden, Germany), following the protocol for Gram-negative bacteria supplied by the manufacturer. The concentration of DNA samples was determined using a Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE). DNA samples were stored at 20 C until required for PCR analysis.
Clp protease ATP-binding subunit SSPA1724 of serovar Paratyphi A was chosen for PCR analysis, as BLAST database searches showed the region to be unique to serovar Paratyphi A. Primers for pan-Salmonella detection based on the ompC gene have been described by Alvarez et al. (2004).
2.2. Genomic PCR targets and primers
2.4. mPCR amplification and analysis of PCR products
The mPCR assay in this study contained primers for the detection of the Salmonella genus as well as serovar-specific genes (Table 2). The serovar-specific PCR targets were selected based on comparative genomic analysis that provided information on the regions of difference between the genomes. For the combined detection of both serovars Typhi and Paratyphi A, the STY4220 locus encoding a putative regulatory protein was targeted. This was based on comparative genomic data that indicated the gene was present in both serovars (Tracz et al., 2006). The first gene of the stg fimbrial operon, stgA, was reported to be unique to the S. enterica serovar Typhi genome (Edwards et al., 2002) and hence targeted for PCR detection. In order to obtain a region suitable for distinguishing between serovars Typhi and Paratyphi A, the two genomes were compared using the WebACT online resource freely available at http://www.webact.org/WebACT/home. Reference genomes for S. enterica serovars Typhi CT18 and Paratyphi A ATCC 9150 were used for comparison purposes. Several regions of difference were generated; however, the intergenic region (designated as SSPAI) between genes encoding hypothetical protein SSPA1723 and ATP-dependent
mPCR was performed using the Qiagen Multiplex PCR kit in 20 mL (genomic DNA testing) or 35 mL (spiked stool/blood sample testing) PCR reaction mixtures. Each reaction mix contained 1X Multiplex Master Mix, 0.5X Q-Solution, Salmonella genus and serovar-specific primers, IAC primers and IAC plasmid at a final concentration of 100 pg/mL. The primer pair concentrations in the PCR reaction mix were as follows: 0.15 mM of STGA-F and R; 0.15 mM of OMPC-F and R; 0.30 mM SSPAI-F2 and R2; 0.174 mM STY4220-F1 and R1; 0.05 mM of GFP-F and R. For genomic DNA PCR assays, 1 mL of bacterial genomic DNA was used, whilst 2 mL of bacterial suspension was used for spiked stool and blood sample (see section 2.6). PCR amplification reaction was performed using the Biometra TProfessional Basic Thermocycler with an initial denaturation at 95 C for 15 min, followed by 35 temperature cycles of heat denaturation at 94 C for 30 s, primer annealing at 60 C for 90 s and extension at 72 C for 60 s and a final step of extension at 72 C for 10 min. PCR products were separated by electrophoresis in 1.8% agarose gel, stained with ethidium bromide and visualized by UV transillumination.
2.3. Internal amplification control (IAC) The IAC which was used in each PCR reaction was a chimeric plasmid and its construction is briefly described. A 433 bp fragment from the green fluorescent protein gene of pGLO plasmid (Bio-Rad, Hercules, CA) was amplified using GFP-F and R primers (Table 2). The PCR products were TAcloned into a pDrive cloning vector (Qiagen). The cloned insert from a recombinant plasmid was sequenced to confirm its identity.
Table 2 Primers used in the multiplex PCR. Primer name
Primer sequence (50 -30 )
Target gene
Target serovar
Amplicon size (bp)
Source
OMPC-F
ATCGCTGACTTATGCAATCG
ompC
Salmonella genus
204
Alvarez et al., 2004
OMPC-R STY4220-F1 STY4220-R1 STGA-F STGA-R SSPAI-F2
CGGGTTGCGTTATAGGTCTG AGTATCACCGCCTGCCATCT CGGCAGCAATTGGCTCATAC TGCCAGGTTACGCCACAAACC CGCTGTGGTATCAATCGTGC TGATCTTCAAGGAATTGATAAAGTG
STY4220
Typhi & Paratyphi A
176
This study
stgA
Typhi
354
This study
Serovar Paratyphi A unique intergenic region between SSPA1723a and SSPA1724
Paratyphi A
300
This study
SSPAI-R2 GFP-F
CTCTGCCATCATGAAACTGAA ATGAATTCGCCGAAGGTTATGTACAGG
Cloned green fluorescent protein of the IAC
e
433
This study
GFP-R
AGGAATTCGCCATGTGTAATCCCAGCA
246
G.J. Yin Ngan et al. / Research in Microbiology 161 (2010) 243e248
2.5. Specificity of the mPCR The specificity of primer sets in the mPCR was assessed using genomic DNA from 124 Salmonella serovars and 8 nonSalmonella Gram-negative bacterial strains (Table 2) using the same PCR conditions described above. 2.6. Sensitivity of the mPCR Genomic DNA from S. enterica serovars Typhi, Paratyphi A and Paratyphi B (non-Typhi, non-Paratyphi A serovar) was serially diluted from 10 ng/mL to 0.1 fg/mL with 1 mL from each dilution used for mPCR. Analytical sensitivity was defined as the lowest concentration of genomic DNA that was able to produce a clearly visible band upon gel electrophoresis. The preparation of spiked blood and stool samples was similar to that described by Pathmanathan et al. (2003). Blood or fecal samples obtained from a healthy volunteer were diluted 10-fold in Gram-negative (GN) broth (Difco, Fraklin Lakes, NJ) so as to minimize PCR inhibition. Overnight cultures of S. enterica serovar Typhi and Paratyphi A were serially diluted 10-fold in GN broth and 10 mL from each bacterial dilution was spiked into an equal volume of diluted blood-GN broth or feces-GN broth mix. For enrichment studies, the diluted bacterial mix was further incubated at 37 C for 8 h. For mPCR assays, 2 ml of the bacterial mix was used for PCR. Colony forming unit (CFU) counts were determined for each bacterial dilution. Analytical sensitivity was defined as the lowest number of bacteria cells which yielded a positive result upon visualization after gel electrophoresis. 3. Results 3.1. Detection of Salmonella spp., serovars Typhi and Paratyphi A by mPCR assay mPCR comprises a total of 5 primer pairs, 4 of which detect Salmonella spp. and provide differentiation between serovars Typhi and Paratyphi A. The fifth primer set was used for amplification of the IAC (Table 2). The ompC gene, which is described as a Salmonella-genus-specific outer membrane protein (Alvarez
et al., 2004) was used for pan-Salmonella detection. All 124 Salmonella serovars tested amplified the 204 bp fragment for ompC (Table 2, Fig. 1). The sty4220-F1 and R1 primers targeted the sty4220 gene which encoded a putative regulatory protein. This set of primers was specific for both serovars Typhi and Paratyphi A and, in all the Typhi and Paratyphi A serovars tested, an amplicon of 176 bp was produced (Fig. 1, Table 2). S. enterica serovar Typhi was distinguished from the other serovars by amplification of a 354 bp fragment of the stgA gene, the first gene of the stgABCD fimbrial operon. All 14 Typhi serovars tested were positive for stgA. For differentiation and detection of serovar Paratyphi A, the unique intergenic region (SSPAI) between genes SPPA1723 and SSPA1724 was targeted and amplification of the 300 bp band was observed only in Paratyphi A strains (Table 1, Fig. 1). The mPCR assay showed 100% specificity when tested against 132 strains (Salmonella spp. and non-Salmonella spp.), correctly identifying serovars Typhi and Paratyphi A with common bands of 204 bp and 176 bp corresponding to ompC and sty4220 amplicons, respectively. Additionally, serovars Typhi and Paratyphi A were differentiated from each other through a 300 bp band specific for serovar Paratyphi A and a 354 bp stgA band unique to serovar Typhi (Fig. 1, Table 2). The assay also incorporates an IAC, a chimerically constructed recombinant plasmid, which is co-amplified as a 433 bp band (Fig. 1). The IAC was used as an indicator for PCR inhibitory substances that may be present in clinical samples or a PCR reaction failure. 3.2. Specificity of the mPCR Each of the primers in the assay were tested individually and in combination using all Salmonella serovars available for this study together with non-Salmonella strains (Table 1). Non-Salmonella bacteria and non-targeted Salmonella strains did not produce any amplicons, indicating there was no crossreactivity and the assay had 100% specificity (data not shown). 3.3. Sensitivity of the mPCR assay 3.3.1. Extracted genomic DNA When tested on serially diluted bacterial genomic DNA, the limit of detection of the mPCR assay for S. enterica serovars
Fig. 1. Representative agarose gel of amplified mPCR products using genomic DNA from various Salmonella enterica subsp. Lane M, 100 bp DNA ladder (New England Biolabs, Ipswich, MA); lane N, negative control; lane P, positive control; lane 1, serovar Paratyphi A; lane 2, serovar Paratyphi B; lane 3, serovar Stanley; lane 4, serovar Typhimurium; lane 5, serovar Albany; lane 6, serovar Augustenborg; lane 7, serovar Bareilly; lane 8, serovar Braenderup; lane 9, serovar Corvallis; lane 10, serovar Hadar; lane 11, serovar Istanbul; lane 12, serovar Molade; lane 13, serovar Muenchen; lane 14, serovar Newport; lane 15, serovar Oslo; lane 16, serovar Rissen; lane 17, serovar Virchow; lane 18, serovar Enteritidis; lane 19, serovar Javiana; lane 20, serovar Panama; lane 21, serovar Typhi; lane 22, serovar Seftenberg; lane 23, serovar Weltevreden; lane 24, serovar Hvittingfoss; lane 25, serovar Gaminara; lane 26, serovar Minessota; lane 27, diarizonae. The individual gene targets are described in Table 1.
G.J. Yin Ngan et al. / Research in Microbiology 161 (2010) 243e248
Typhi and Paratyphi A was 1 pg/mL, which was approximately equivalent to 200 genome copies (Fig. 2a and b). The assay was observed to be 10-fold more sensitive when detecting nonTyphi, non-Salmonella Paratyphi A serovars, with a detection limit of 100 fg/mL (data not shown). This was expected, as only two amplicons (ompC and IAC) needed to be amplified instead of all four amplicons. 3.3.2. Spiked blood and fecal samples The detection limit of spiked blood samples for S. enterica serovars Typhi and Paratyphi A was approximately 1 105 CFU/ml (200 cells per PCR reaction) and 2 105 CFU/ml (400 cells per reaction), respectively (data not shown). After 8 h enrichment at 37 C in GN broth, the sensitivity of the assay for serovars Typhi and Paratyphi A increased to 4.5 104 CFU/ml (90 cells per PCR reaction) and 5.5 104 CFU/ml (110 cells per PCR reaction), respectively (data not shown). In spiked fecal samples, the detection limit of the mPCR assay for serovars Typhi and Paratyphi A was approximately 1 106 CFU/ml (2000 cells per PCR reaction) and 2 106 CFU/ml (4000 cells per PCR reaction), respectively (data not shown). Following the 8 h enrichment step, the assay detected serovars Typhi and Paratyphi A in spiked fecal samples at 5 104 CFU/ml (100 cells per PCR reaction) and 6 104 CFU/ml (120 cells per PCR reaction), respectively (data not shown). 4. Discussion In this study, we adopted the ‘translational genomics’ approach, similar to that described by Ou et al. (2007) and
247
Nagarajan et al. (2009), for the selection of novel targets that were unique to the genomes of S. enterica serovars Typhi and Paratyphi A. Here, published comparative genomics data (Tracz et al., 2006; Edwards et al., 2002) and genomic databases such those available at the Sanger Institute provided information on the absence and presence of genes in the serovars. Tracz et al. (2006) demonstrated that the STY4220 locus was present in serovars Typhi and Paratyphi A, and our PCR results were in agreement with their observation. Similarly, the stg fimbrial operon was proposed to be present only in serovar Typhi (Edwards et al., 2002) and the PCR screen of our Salmonella collection also demonstrated likewise. Online tool WebACT enabled comparisons between Typhi and Paratyphi A genomes with the SSPAI section generated as a region of difference from the comparison which proved to be a useful PCR marker for serovar Paratyphi A detection. The ompCtargeted primers used for paneSalmonella detection had been previously utilized by Alvarez et al. (2004) and our PCR results were in agreement with that study. The clinical utility of this assay was demonstrated, since bacterial-spiked blood and fecal samples could be used for amplification allowing the omission of a genomic DNA purification step. However, the PCR did require a further dilution of the bacteria-fecal/bacteria-blood sample in GN broth and the inclusion of an enrichment step for improved sensitivity (Chiu and Ou, 1996). In our study, we validated the analytical performance of our mPCR approach for the detection and differentiation between serovars Typhi and Paratyphi A based on novel targets stgA, STY4220, and SSPAI. The results show that the assay was both specific and sensitive, suggesting that these genetic loci
Fig. 2. Analytical sensitivity of the mPCR assay on serially diluted S. enterica serovar Typhi genomic DNA (A) and serovar Paratyphi A genomic DNA (B). Lane M, 100 bp DNA ladder size marker (New England Biolabs, Ipswich, MA); lane N, negative control; lane P, positive control. (A) lanes 1-10 represent different concentrations of serovar Typhi genomic DNA; lane 1, 173 ng/ml; lane 2- 10, serially diluted DNA from 10 ng/ml to 0.1 fg/ul. The 354 bp amplicon from stgA is indicative of the presence of S. enterica serovar Typhi. (B) lanes 1e10 represent different concentrations of S. enterica serovar Paratyphi A genomic DNA; lane 1, 173 ng/ml; lane 2- 10, serially diluted DNA from 10 ng/ml to 0.1 fg/ul. The 300 bp amplicon from SSPAI is indicative of the presence of S. enterica Paratyphi A.
248
G.J. Yin Ngan et al. / Research in Microbiology 161 (2010) 243e248
were potentially useful diagnostic markers. To further build on this data, we intend to perform a clinical comparison and validation of our mPCR assay by screening stool samples of suspected typhoid patients and correlating the results with conventional culture and identification. We are also looking at other serovar-specific targets in clinically important serovars such as Enteritidis and Typhimurium to be included in our mPCR assay, thereby expanding the test’s diagnostic utility, particularly in instances of Salmonella outbreaks.
Acknowledgements This study was supported by a grant from the Ministry of Health, Singapore (grant number HSDPX06/X04). We thank Qin Wang, Hock Wan Khor, Isyraf Bin Ismail and Charlotte Cheang for their technical assistance and Siti Zuliani for her help in serotyping the Salmonella strains.
References Alvarez, J., Sota, M., Vivanco, A.B., Perales, I., Cisterna, R., Rementeria, A., Garaizar, J., 2004. Development of a multiplex PCR technique for detection and epidemiological typing of Salmonella in human clinical samples. J. Clin. Microbiol. 42, 1734e1738. Chiu, C.H., Ou, J.T., 1996. Rapid identification of Salmonella Serovars in feces by specific detection of virulence genes, invA and spvC, by an enrichment broth culture-multiplex PCR combination assay. J. Clin. Microbiol. 34, 2619e2622. Crump, J.A., Luby, S.P., Mintz, E.D., 2004. The global burden of typhoid fever. Bull. World Health Organ. 5, 346e353. Edwards, R.A., Olsen, G.J., Maloy, S.R., 2002. Comparative genomics of closely related salmonellae. Trends Microbiol. 10, 94e99. Hirose, K., Itoh, K.I., Nakajima, H., Kurozono, T., Yamaguchi, M., Moriya, K. , Ezaki, T., Kawamura, Y., Tamura, K., Watanabe, H., 2002. Selective Amplification of tyv (rfbE), prt (rfbS), viaB and fliC Genes by Multiplex PCR for Identification of Salmonella enterica Serovars Typhi and Paratyphi A. J. Clin. Microbiol. 40, 633e636. Kumar, S., Blakrishna, K., Batra, H.V., 2005. Detection of Salmonella enterica serovar Typhi (S. Typhi) by selective amplification of invA, viaB, fliC-d and prt genes by polymerase chain reaction in multiplex format. Lett. Appl. Microbiol. 42, 149e154.
Maskey, A.P., Basnyat, B., Thwaites, G.E., Campbell, J.I., Farrar, J.J., 2008. Emerging trends in enteric fever in Nepal:9124 cases confirmed by blood culture 1993e2003. Trans. R. Soc. Trop. Med. Hyg. 102, 91e95. Mcquiston, J.R., Parrenas, R., Ortiz-Rivera, M., Gheesling, L., Brenner, F., Fields, P.I., 2004. Sequencing and comparative analysis of Flagellin Genes fliC, fliB, and flpA from Salmonella. J. Clin. Microbiol. 42, 1923e1932. Nagarajan, A.G., Karnam, G., Lahiri, A., Allam, U.S., Chakravortty, D., 2009. Reliable means of diagnosis and serovar determination of blood-borne Salmonella strains: quick PCR amplification of unique genomic loci by novel primer sets. J. Clin. Microbiol. 47, 2435e2441. Ochiai, R.L., Wang, X., von Seidlein, L., Yang, J., Bhutta, Z.A., Bhattacharya, S.K., Agtini, M., Deen, J.L., Wain, J., Kim, Dr., Ali, M., Acosta, C.J., Jodar, L., Clemens, J.D., 2005. Salmonella Paratyphi A rates, Asia. Chin. J. Antibiot. 11, 1764e1766. Ou, H.Y., Ju, C.T., Thong, K.L., Ahmad, N., Deng, Z., Barer, M.R., Rajakumar, K.J., 2007. Translational genomics to develop a Salmonella enterica serovar Paratyphi A multiplex polymerase chain reaction assay. J. Mol. Diagn. 9, 624e630. Pathmanathan, S.G., Cardona-Castro, N., Sa´nchez-Jime´nez, M.M., CorreaOchoa, M.M., Puthucheary, S.D., Thong, K.L., 2003. Simple and rapid detection of Salmonella strains by direct PCR amplification of the hilA gene. J. Med. Microbiol. 52, 773e776. Parry, C.M., Hien, T.T., Dougan, G., White, N.J., Farrar, J.J., 2002. Typhoid fever. N. Engl. J. Med. 22, 1770e1782. Pokheral, B.M., Koirala, J., Dahal, R.K., Mishra, S.K., Khadga, P.K., Tuladhar, N.R., 2006. Multidrug-resistant and extended-spectrum betalactamase (ESBL)-producing Salmonella enterica (serotypes Typhi and Paratyphi A) from blood isolates in Nepal: surveillance of resistance and a search for newer alternatives. Int. J. Infect. Dis. 10, 434e438. Tankhiwale, S.S., Agrawal, G., Jalgoankar, S.V., 2003. An unusually high occurrence of Salmonella enterica serotype Paratyphi A in patients with enteric fever. Indian Med. Res. 117, 10e12. Teh, C.S.J., Chua, K.H., Savithri, D.P., Thong, K.L., 2008. Further evaluation of a multiplex PCR for differentiation of Salmonella Paratyphi A from Other Salmonellae. Jpn. J. Infect. Dis. 61, 313e314. Tracz, D.M., Tabor, H., Jerome, M., Ng, L.K., Gilmour, M.W., 2006. Genetic determinants and polymorphisms specific for human-adapted serovars of Salmonella enterica that cause enteric fever. J. Clin. Microbiol. 44, 2007e2018. Woods, C.W., Murdoch, D.R., Zimmerman, M.D., Glover, W.A., Basnyat, B., Wolf, L., Belbase, R.H., Reller, L.B., 2006. Emergence of Salmonella enterica serotype Paratyphi A as a major cause of enteric fever in Kathmandu, Nepal. Trans. R. Soc. Trop. Med. Hyg. 100, 1063e1067. Zhang, Z.K., Huang, Y.N., Guo, B.C., Deng, M.L., Yuan, R.Z., Wang, Q.S., 2004. Surveillance of the antibiotic-resistance and plasmid of Salmonella paratyphoid. Chin. J. Antibiot. 29, 6e10.
Development of a novel multiplex PCR for the detection and differentiation of Salmonella enterica serovars Typhi and Paratyphi A Grace Jie Yin Ngan, Li Mei Ng, Raymond T.P. Lin, Jeanette W.P. Teo* National University Hospital, Department of Laboratory Medicine, 5 Lower Kent Ridge Road, Main Building I, Singapore 119074, Singapore Received 21 December 2009; accepted 11 March 2010 Available online 8 April 2010
Abstract In this study, we developed a multiplex polymerase chain reaction (mPCR) assay for pan-Salmonella detection as well as for specific detection of serovars Typhi and Paratyphi A. The assay detects members of the Salmonella genus by amplifying the outer membrane protein C (ompC ). The presence of either Salmonella serovar Typhi or Paratyphi A is indicated by amplification of the putative regulatory protein gene STY4220, which is common to both serovars. Further differentiation of the serovars was achieved by targeting the intergenic region (SSPAI) between SSPA1723a and SSPA1724 in serovar Paratyphi A, and stgA, a fimbrial subunit protein, in serovar Typhi. mPCR was evaluated using 124 clinical and reference Salmonella serovars. S. enterica serovars Typhi and Paratyphi A were detected at 100% specificity and sensitivity. Each PCR reaction detected approximately 1 pg of Salmonella genomic DNA. Sensitivity of the PCR when tested on 8-h-enriched spiked blood samples of serovars Typhi and Paratyphi A was estimated at 4.5 104e5.5 104 CFU/ml, with similar detection levels observed for spiked fecal samples. This mPCR could prove to be a useful diagnostic tool for the detection and differentiation of serovars Typhi and Paratyphi A. Ó 2010 Elsevier Masson SAS. All rights reserved. Keywords: Salmonella enterica serovar Typhi; Salmonella enterica serovar Paratyphi A; Enteric fever; Multiplex polymerase chain reaction; Comparative genomics
1. Introduction Salmonella enterica serovars Typhi and Paratyphi (A, B, C) are causative bacterial agents of typhoid and paratyphoid fever (enteric fevers). Enteric fevers remain a global public concern in many geographic areas, particularly in developing countries with poor sanitary systems and improper treatment of water supplies (Parry et al., 2002). Annually these pathogens account for more than 25 million infections worldwide, resulting in approximately 200,000 deaths (Crump et al., 2004). Historically, typhoid fever is considered a more critical and predominant illness than paratyphoid fever; however, in recent decades, it has been superceded by paratyphoid fever (Ochiai et al., 2005). Amongst S. enterica serovar Paratyphi, Paratyphi A is gaining prevalence in southeast Asia and is
* Corresponding author. Tel.: þ65 6772 2342; fax: þ65 6775 1575. E-mail address: [email protected] (J.W.P. Teo). 0923-2508/$ - see front matter Ó 2010 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.resmic.2010.03.005
responsible for 30e50% of enteric fever cases (Maskey et al., 2008; Woods et al., 2006). This increment is attributed to the emergence of multiple-drug or fluoroquinolone-resistant strains of serovar Paratyphi A and administration of the Salmonella serovar Typhi vaccine which provides little crossprotection against serovar Paratyphi A (Pokheral et al., 2006; Tankhiwale et al., 2003; Zhang et al., 2004). Early and accurate diagnosis of typhoid and paratyphoid fever coupled with prompt medical intervention is essential in reducing the morbidity and mortality associated with enteric fevers. Currently, most routine microbiology laboratories still rely on conventional methods (culture method and biochemical test) for diagnosis of typhoid and paratyphoid fever and this requires a minimum of 4e5 days for identification. PCR diagnostic tests have proven to be rapid and effective for the detection and identification of typhoid fever and paratyphoid fever (Alvarez et al., 2004; Pathmanathan et al., 2003). In this study, the approach we have taken to designing this mPCR assay was based on searching for genes unique to the serovars
244
G.J. Yin Ngan et al. / Research in Microbiology 161 (2010) 243e248
(Ou et al., 2007; Nagarajan et al., 2009). This is unlike conventional mPCRs, which often target H antigen genes, O antigen synthesis genes, Vi capsular antigen gene, 16S rRNA gene for detection of S. enterica serovar Typhi and other Salmonella serovars (Kumar et al., 2005; Mcquiston et al., 2004; Teh et al., 2008; Hirose et al., 2002) where the diagnosis is often based on sequence polymorphisms or differences rather than the absence or presence of genes. Here we report the development of an mPCR assay that targets novel serovarspecific genes for the differentiation between serovars Typhi and Paratyphi A. For the specific detection of serovar Typhi, the first gene of the fimbrial operon gene (stgA) was targeted, whilst in serovar Paratyphi A, the intergenic region between genes SSPA1723a and SSPA1724 was used. The STY4220 loci which encodes a putative regulatory protein was
indicative of the presence of both serovars Typhi and Paratyphi A. Finally, outer membrane protein gene (ompC ) was used for pan-Salmonella detection. Hence this assay enabled detection of bacterial isolates of the Salmonella genus with discrimination between serovars Typhi and Paratyphi A. 2. Materials and methods 2.1. Bacterial isolates and genomic DNA extraction A total of 124 Salmonella strains (clinical and reference strains) and 8 non-Salmonella Gram-negative bacteria strains were obtained from the microbiology laboratory at the National University Hospital, Singapore and the National Public Health Laboratory, Singapore (Table 1). The period of
Table 1 Bacterial strains used for the evaluation of primer specificity in the mPCR assay and mPCR results. Salmonella enterica strains
No. of isolates
Antigenic
Structure
mPCR
positive
for
O antigen
H-1
1,2,12 4,5,12 4,5,12 4,5,12
a b d i
H-2
ompC
STY4220
stgA
SSPAI
e 1,2 1,2 1,2
þ þ þ þ
þ
þ
8 6,7 6,7 6,7 8,20 6,8 8 8,20 6,8 6,8 6,7 7 6,7 6,7 6,7
z4,z24 i y e,h z4, z23 z10 z10 z10 d e,h a f,g r c c
e 1,2 1,5 e,n,z15 e e,n,x e,n,x Z6 1,2 1,2 e,n,x e 1,2 1,5 1,5
þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ
Serogroup
Serovar
A B
Paratyphi A Paratyphi B Stanley Typhimurium
7 3 4 10
C
Albany Augustenborg Bareilly Braenderup Corvallis Hadar Istanbul Molade Muenchen Newport Oslo Rissen Virchow Choleraesuis Paratyphi C
2 2 4 4 6 2 1 1 1 2 2 1 1 1 1
D
Typhi Enteritidis Javiana Sendai Panama
14 29 2 1 1
9,12 [Vi] 1,9,12 1,9,12 1,9,12 1,9,12
d g,m l,z28 a l,v
e e 1,5 1,5 1,5
þ þ þ þ þ
þ
þ
E
Senftenberg Weltevreden Gaminara Hvittingfoss Minnesota subsp.diarizonae
1 17 1 1 1 1
1,3,19 3,10 16 16 21 (6),14
g,s,t r d b b 10
e z6 1,7 e,n,x e,n,x z
þ þ þ þ þ þ
e e e e e e e e
e e e e e e e e
e e e e e e e e
e e e e e e e e
I L Others
Non-Salmonella strains Providencia spp. Pseudomonas aeruginosa Citrobacter freundii Shigella dysenteriae Serratia marcescens Proteus mirabilis Escherichia coli Enterobacter cloacae Total
1 1 1 1 1 1 1 1 132
G.J. Yin Ngan et al. / Research in Microbiology 161 (2010) 243e248
245
collection was between the years 2007e2009. The 7 reference Salmonella enterica serovars from the American Type Culture Collection (ATCC) were: Paratyphi A (ATCC 9150), Paratyphi B (ATCC 10719), Paratyphi C (ATCC 13428), Choleraesuis (ATCC 13312), Enteritidis (ATCC 13076), Typhimurium (ATCC 700720), and Sendai (ATCC 1586). The serotypes of all clinical Salmonella strains were identified based on the White-Kauffmann-Le Minor Scheme (Table 1). Genomic DNA of all bacterial strains was extracted using the QiagenÒ DNeasy blood & tissue kit (Qiagen, Hilden, Germany), following the protocol for Gram-negative bacteria supplied by the manufacturer. The concentration of DNA samples was determined using a Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE). DNA samples were stored at 20 C until required for PCR analysis.
Clp protease ATP-binding subunit SSPA1724 of serovar Paratyphi A was chosen for PCR analysis, as BLAST database searches showed the region to be unique to serovar Paratyphi A. Primers for pan-Salmonella detection based on the ompC gene have been described by Alvarez et al. (2004).
2.2. Genomic PCR targets and primers
2.4. mPCR amplification and analysis of PCR products
The mPCR assay in this study contained primers for the detection of the Salmonella genus as well as serovar-specific genes (Table 2). The serovar-specific PCR targets were selected based on comparative genomic analysis that provided information on the regions of difference between the genomes. For the combined detection of both serovars Typhi and Paratyphi A, the STY4220 locus encoding a putative regulatory protein was targeted. This was based on comparative genomic data that indicated the gene was present in both serovars (Tracz et al., 2006). The first gene of the stg fimbrial operon, stgA, was reported to be unique to the S. enterica serovar Typhi genome (Edwards et al., 2002) and hence targeted for PCR detection. In order to obtain a region suitable for distinguishing between serovars Typhi and Paratyphi A, the two genomes were compared using the WebACT online resource freely available at http://www.webact.org/WebACT/home. Reference genomes for S. enterica serovars Typhi CT18 and Paratyphi A ATCC 9150 were used for comparison purposes. Several regions of difference were generated; however, the intergenic region (designated as SSPAI) between genes encoding hypothetical protein SSPA1723 and ATP-dependent
mPCR was performed using the Qiagen Multiplex PCR kit in 20 mL (genomic DNA testing) or 35 mL (spiked stool/blood sample testing) PCR reaction mixtures. Each reaction mix contained 1X Multiplex Master Mix, 0.5X Q-Solution, Salmonella genus and serovar-specific primers, IAC primers and IAC plasmid at a final concentration of 100 pg/mL. The primer pair concentrations in the PCR reaction mix were as follows: 0.15 mM of STGA-F and R; 0.15 mM of OMPC-F and R; 0.30 mM SSPAI-F2 and R2; 0.174 mM STY4220-F1 and R1; 0.05 mM of GFP-F and R. For genomic DNA PCR assays, 1 mL of bacterial genomic DNA was used, whilst 2 mL of bacterial suspension was used for spiked stool and blood sample (see section 2.6). PCR amplification reaction was performed using the Biometra TProfessional Basic Thermocycler with an initial denaturation at 95 C for 15 min, followed by 35 temperature cycles of heat denaturation at 94 C for 30 s, primer annealing at 60 C for 90 s and extension at 72 C for 60 s and a final step of extension at 72 C for 10 min. PCR products were separated by electrophoresis in 1.8% agarose gel, stained with ethidium bromide and visualized by UV transillumination.
2.3. Internal amplification control (IAC) The IAC which was used in each PCR reaction was a chimeric plasmid and its construction is briefly described. A 433 bp fragment from the green fluorescent protein gene of pGLO plasmid (Bio-Rad, Hercules, CA) was amplified using GFP-F and R primers (Table 2). The PCR products were TAcloned into a pDrive cloning vector (Qiagen). The cloned insert from a recombinant plasmid was sequenced to confirm its identity.
Table 2 Primers used in the multiplex PCR. Primer name
Primer sequence (50 -30 )
Target gene
Target serovar
Amplicon size (bp)
Source
OMPC-F
ATCGCTGACTTATGCAATCG
ompC
Salmonella genus
204
Alvarez et al., 2004
OMPC-R STY4220-F1 STY4220-R1 STGA-F STGA-R SSPAI-F2
CGGGTTGCGTTATAGGTCTG AGTATCACCGCCTGCCATCT CGGCAGCAATTGGCTCATAC TGCCAGGTTACGCCACAAACC CGCTGTGGTATCAATCGTGC TGATCTTCAAGGAATTGATAAAGTG
STY4220
Typhi & Paratyphi A
176
This study
stgA
Typhi
354
This study
Serovar Paratyphi A unique intergenic region between SSPA1723a and SSPA1724
Paratyphi A
300
This study
SSPAI-R2 GFP-F
CTCTGCCATCATGAAACTGAA ATGAATTCGCCGAAGGTTATGTACAGG
Cloned green fluorescent protein of the IAC
e
433
This study
GFP-R
AGGAATTCGCCATGTGTAATCCCAGCA
246
G.J. Yin Ngan et al. / Research in Microbiology 161 (2010) 243e248
2.5. Specificity of the mPCR The specificity of primer sets in the mPCR was assessed using genomic DNA from 124 Salmonella serovars and 8 nonSalmonella Gram-negative bacterial strains (Table 2) using the same PCR conditions described above. 2.6. Sensitivity of the mPCR Genomic DNA from S. enterica serovars Typhi, Paratyphi A and Paratyphi B (non-Typhi, non-Paratyphi A serovar) was serially diluted from 10 ng/mL to 0.1 fg/mL with 1 mL from each dilution used for mPCR. Analytical sensitivity was defined as the lowest concentration of genomic DNA that was able to produce a clearly visible band upon gel electrophoresis. The preparation of spiked blood and stool samples was similar to that described by Pathmanathan et al. (2003). Blood or fecal samples obtained from a healthy volunteer were diluted 10-fold in Gram-negative (GN) broth (Difco, Fraklin Lakes, NJ) so as to minimize PCR inhibition. Overnight cultures of S. enterica serovar Typhi and Paratyphi A were serially diluted 10-fold in GN broth and 10 mL from each bacterial dilution was spiked into an equal volume of diluted blood-GN broth or feces-GN broth mix. For enrichment studies, the diluted bacterial mix was further incubated at 37 C for 8 h. For mPCR assays, 2 ml of the bacterial mix was used for PCR. Colony forming unit (CFU) counts were determined for each bacterial dilution. Analytical sensitivity was defined as the lowest number of bacteria cells which yielded a positive result upon visualization after gel electrophoresis. 3. Results 3.1. Detection of Salmonella spp., serovars Typhi and Paratyphi A by mPCR assay mPCR comprises a total of 5 primer pairs, 4 of which detect Salmonella spp. and provide differentiation between serovars Typhi and Paratyphi A. The fifth primer set was used for amplification of the IAC (Table 2). The ompC gene, which is described as a Salmonella-genus-specific outer membrane protein (Alvarez
et al., 2004) was used for pan-Salmonella detection. All 124 Salmonella serovars tested amplified the 204 bp fragment for ompC (Table 2, Fig. 1). The sty4220-F1 and R1 primers targeted the sty4220 gene which encoded a putative regulatory protein. This set of primers was specific for both serovars Typhi and Paratyphi A and, in all the Typhi and Paratyphi A serovars tested, an amplicon of 176 bp was produced (Fig. 1, Table 2). S. enterica serovar Typhi was distinguished from the other serovars by amplification of a 354 bp fragment of the stgA gene, the first gene of the stgABCD fimbrial operon. All 14 Typhi serovars tested were positive for stgA. For differentiation and detection of serovar Paratyphi A, the unique intergenic region (SSPAI) between genes SPPA1723 and SSPA1724 was targeted and amplification of the 300 bp band was observed only in Paratyphi A strains (Table 1, Fig. 1). The mPCR assay showed 100% specificity when tested against 132 strains (Salmonella spp. and non-Salmonella spp.), correctly identifying serovars Typhi and Paratyphi A with common bands of 204 bp and 176 bp corresponding to ompC and sty4220 amplicons, respectively. Additionally, serovars Typhi and Paratyphi A were differentiated from each other through a 300 bp band specific for serovar Paratyphi A and a 354 bp stgA band unique to serovar Typhi (Fig. 1, Table 2). The assay also incorporates an IAC, a chimerically constructed recombinant plasmid, which is co-amplified as a 433 bp band (Fig. 1). The IAC was used as an indicator for PCR inhibitory substances that may be present in clinical samples or a PCR reaction failure. 3.2. Specificity of the mPCR Each of the primers in the assay were tested individually and in combination using all Salmonella serovars available for this study together with non-Salmonella strains (Table 1). Non-Salmonella bacteria and non-targeted Salmonella strains did not produce any amplicons, indicating there was no crossreactivity and the assay had 100% specificity (data not shown). 3.3. Sensitivity of the mPCR assay 3.3.1. Extracted genomic DNA When tested on serially diluted bacterial genomic DNA, the limit of detection of the mPCR assay for S. enterica serovars
Fig. 1. Representative agarose gel of amplified mPCR products using genomic DNA from various Salmonella enterica subsp. Lane M, 100 bp DNA ladder (New England Biolabs, Ipswich, MA); lane N, negative control; lane P, positive control; lane 1, serovar Paratyphi A; lane 2, serovar Paratyphi B; lane 3, serovar Stanley; lane 4, serovar Typhimurium; lane 5, serovar Albany; lane 6, serovar Augustenborg; lane 7, serovar Bareilly; lane 8, serovar Braenderup; lane 9, serovar Corvallis; lane 10, serovar Hadar; lane 11, serovar Istanbul; lane 12, serovar Molade; lane 13, serovar Muenchen; lane 14, serovar Newport; lane 15, serovar Oslo; lane 16, serovar Rissen; lane 17, serovar Virchow; lane 18, serovar Enteritidis; lane 19, serovar Javiana; lane 20, serovar Panama; lane 21, serovar Typhi; lane 22, serovar Seftenberg; lane 23, serovar Weltevreden; lane 24, serovar Hvittingfoss; lane 25, serovar Gaminara; lane 26, serovar Minessota; lane 27, diarizonae. The individual gene targets are described in Table 1.
G.J. Yin Ngan et al. / Research in Microbiology 161 (2010) 243e248
Typhi and Paratyphi A was 1 pg/mL, which was approximately equivalent to 200 genome copies (Fig. 2a and b). The assay was observed to be 10-fold more sensitive when detecting nonTyphi, non-Salmonella Paratyphi A serovars, with a detection limit of 100 fg/mL (data not shown). This was expected, as only two amplicons (ompC and IAC) needed to be amplified instead of all four amplicons. 3.3.2. Spiked blood and fecal samples The detection limit of spiked blood samples for S. enterica serovars Typhi and Paratyphi A was approximately 1 105 CFU/ml (200 cells per PCR reaction) and 2 105 CFU/ml (400 cells per reaction), respectively (data not shown). After 8 h enrichment at 37 C in GN broth, the sensitivity of the assay for serovars Typhi and Paratyphi A increased to 4.5 104 CFU/ml (90 cells per PCR reaction) and 5.5 104 CFU/ml (110 cells per PCR reaction), respectively (data not shown). In spiked fecal samples, the detection limit of the mPCR assay for serovars Typhi and Paratyphi A was approximately 1 106 CFU/ml (2000 cells per PCR reaction) and 2 106 CFU/ml (4000 cells per PCR reaction), respectively (data not shown). Following the 8 h enrichment step, the assay detected serovars Typhi and Paratyphi A in spiked fecal samples at 5 104 CFU/ml (100 cells per PCR reaction) and 6 104 CFU/ml (120 cells per PCR reaction), respectively (data not shown). 4. Discussion In this study, we adopted the ‘translational genomics’ approach, similar to that described by Ou et al. (2007) and
247
Nagarajan et al. (2009), for the selection of novel targets that were unique to the genomes of S. enterica serovars Typhi and Paratyphi A. Here, published comparative genomics data (Tracz et al., 2006; Edwards et al., 2002) and genomic databases such those available at the Sanger Institute provided information on the absence and presence of genes in the serovars. Tracz et al. (2006) demonstrated that the STY4220 locus was present in serovars Typhi and Paratyphi A, and our PCR results were in agreement with their observation. Similarly, the stg fimbrial operon was proposed to be present only in serovar Typhi (Edwards et al., 2002) and the PCR screen of our Salmonella collection also demonstrated likewise. Online tool WebACT enabled comparisons between Typhi and Paratyphi A genomes with the SSPAI section generated as a region of difference from the comparison which proved to be a useful PCR marker for serovar Paratyphi A detection. The ompCtargeted primers used for paneSalmonella detection had been previously utilized by Alvarez et al. (2004) and our PCR results were in agreement with that study. The clinical utility of this assay was demonstrated, since bacterial-spiked blood and fecal samples could be used for amplification allowing the omission of a genomic DNA purification step. However, the PCR did require a further dilution of the bacteria-fecal/bacteria-blood sample in GN broth and the inclusion of an enrichment step for improved sensitivity (Chiu and Ou, 1996). In our study, we validated the analytical performance of our mPCR approach for the detection and differentiation between serovars Typhi and Paratyphi A based on novel targets stgA, STY4220, and SSPAI. The results show that the assay was both specific and sensitive, suggesting that these genetic loci
Fig. 2. Analytical sensitivity of the mPCR assay on serially diluted S. enterica serovar Typhi genomic DNA (A) and serovar Paratyphi A genomic DNA (B). Lane M, 100 bp DNA ladder size marker (New England Biolabs, Ipswich, MA); lane N, negative control; lane P, positive control. (A) lanes 1-10 represent different concentrations of serovar Typhi genomic DNA; lane 1, 173 ng/ml; lane 2- 10, serially diluted DNA from 10 ng/ml to 0.1 fg/ul. The 354 bp amplicon from stgA is indicative of the presence of S. enterica serovar Typhi. (B) lanes 1e10 represent different concentrations of S. enterica serovar Paratyphi A genomic DNA; lane 1, 173 ng/ml; lane 2- 10, serially diluted DNA from 10 ng/ml to 0.1 fg/ul. The 300 bp amplicon from SSPAI is indicative of the presence of S. enterica Paratyphi A.
248
G.J. Yin Ngan et al. / Research in Microbiology 161 (2010) 243e248
were potentially useful diagnostic markers. To further build on this data, we intend to perform a clinical comparison and validation of our mPCR assay by screening stool samples of suspected typhoid patients and correlating the results with conventional culture and identification. We are also looking at other serovar-specific targets in clinically important serovars such as Enteritidis and Typhimurium to be included in our mPCR assay, thereby expanding the test’s diagnostic utility, particularly in instances of Salmonella outbreaks.
Acknowledgements This study was supported by a grant from the Ministry of Health, Singapore (grant number HSDPX06/X04). We thank Qin Wang, Hock Wan Khor, Isyraf Bin Ismail and Charlotte Cheang for their technical assistance and Siti Zuliani for her help in serotyping the Salmonella strains.
References Alvarez, J., Sota, M., Vivanco, A.B., Perales, I., Cisterna, R., Rementeria, A., Garaizar, J., 2004. Development of a multiplex PCR technique for detection and epidemiological typing of Salmonella in human clinical samples. J. Clin. Microbiol. 42, 1734e1738. Chiu, C.H., Ou, J.T., 1996. Rapid identification of Salmonella Serovars in feces by specific detection of virulence genes, invA and spvC, by an enrichment broth culture-multiplex PCR combination assay. J. Clin. Microbiol. 34, 2619e2622. Crump, J.A., Luby, S.P., Mintz, E.D., 2004. The global burden of typhoid fever. Bull. World Health Organ. 5, 346e353. Edwards, R.A., Olsen, G.J., Maloy, S.R., 2002. Comparative genomics of closely related salmonellae. Trends Microbiol. 10, 94e99. Hirose, K., Itoh, K.I., Nakajima, H., Kurozono, T., Yamaguchi, M., Moriya, K. , Ezaki, T., Kawamura, Y., Tamura, K., Watanabe, H., 2002. Selective Amplification of tyv (rfbE), prt (rfbS), viaB and fliC Genes by Multiplex PCR for Identification of Salmonella enterica Serovars Typhi and Paratyphi A. J. Clin. Microbiol. 40, 633e636. Kumar, S., Blakrishna, K., Batra, H.V., 2005. Detection of Salmonella enterica serovar Typhi (S. Typhi) by selective amplification of invA, viaB, fliC-d and prt genes by polymerase chain reaction in multiplex format. Lett. Appl. Microbiol. 42, 149e154.
Maskey, A.P., Basnyat, B., Thwaites, G.E., Campbell, J.I., Farrar, J.J., 2008. Emerging trends in enteric fever in Nepal:9124 cases confirmed by blood culture 1993e2003. Trans. R. Soc. Trop. Med. Hyg. 102, 91e95. Mcquiston, J.R., Parrenas, R., Ortiz-Rivera, M., Gheesling, L., Brenner, F., Fields, P.I., 2004. Sequencing and comparative analysis of Flagellin Genes fliC, fliB, and flpA from Salmonella. J. Clin. Microbiol. 42, 1923e1932. Nagarajan, A.G., Karnam, G., Lahiri, A., Allam, U.S., Chakravortty, D., 2009. Reliable means of diagnosis and serovar determination of blood-borne Salmonella strains: quick PCR amplification of unique genomic loci by novel primer sets. J. Clin. Microbiol. 47, 2435e2441. Ochiai, R.L., Wang, X., von Seidlein, L., Yang, J., Bhutta, Z.A., Bhattacharya, S.K., Agtini, M., Deen, J.L., Wain, J., Kim, Dr., Ali, M., Acosta, C.J., Jodar, L., Clemens, J.D., 2005. Salmonella Paratyphi A rates, Asia. Chin. J. Antibiot. 11, 1764e1766. Ou, H.Y., Ju, C.T., Thong, K.L., Ahmad, N., Deng, Z., Barer, M.R., Rajakumar, K.J., 2007. Translational genomics to develop a Salmonella enterica serovar Paratyphi A multiplex polymerase chain reaction assay. J. Mol. Diagn. 9, 624e630. Pathmanathan, S.G., Cardona-Castro, N., Sa´nchez-Jime´nez, M.M., CorreaOchoa, M.M., Puthucheary, S.D., Thong, K.L., 2003. Simple and rapid detection of Salmonella strains by direct PCR amplification of the hilA gene. J. Med. Microbiol. 52, 773e776. Parry, C.M., Hien, T.T., Dougan, G., White, N.J., Farrar, J.J., 2002. Typhoid fever. N. Engl. J. Med. 22, 1770e1782. Pokheral, B.M., Koirala, J., Dahal, R.K., Mishra, S.K., Khadga, P.K., Tuladhar, N.R., 2006. Multidrug-resistant and extended-spectrum betalactamase (ESBL)-producing Salmonella enterica (serotypes Typhi and Paratyphi A) from blood isolates in Nepal: surveillance of resistance and a search for newer alternatives. Int. J. Infect. Dis. 10, 434e438. Tankhiwale, S.S., Agrawal, G., Jalgoankar, S.V., 2003. An unusually high occurrence of Salmonella enterica serotype Paratyphi A in patients with enteric fever. Indian Med. Res. 117, 10e12. Teh, C.S.J., Chua, K.H., Savithri, D.P., Thong, K.L., 2008. Further evaluation of a multiplex PCR for differentiation of Salmonella Paratyphi A from Other Salmonellae. Jpn. J. Infect. Dis. 61, 313e314. Tracz, D.M., Tabor, H., Jerome, M., Ng, L.K., Gilmour, M.W., 2006. Genetic determinants and polymorphisms specific for human-adapted serovars of Salmonella enterica that cause enteric fever. J. Clin. Microbiol. 44, 2007e2018. Woods, C.W., Murdoch, D.R., Zimmerman, M.D., Glover, W.A., Basnyat, B., Wolf, L., Belbase, R.H., Reller, L.B., 2006. Emergence of Salmonella enterica serotype Paratyphi A as a major cause of enteric fever in Kathmandu, Nepal. Trans. R. Soc. Trop. Med. Hyg. 100, 1063e1067. Zhang, Z.K., Huang, Y.N., Guo, B.C., Deng, M.L., Yuan, R.Z., Wang, Q.S., 2004. Surveillance of the antibiotic-resistance and plasmid of Salmonella paratyphoid. Chin. J. Antibiot. 29, 6e10.