Development of a real-time fluorescent quantitative PCR assay for detection of Impatiens necrotic spot virus

G Model VIRMET 12082 1–6

ARTICLE IN PRESS Journal of Virological Methods xxx (2013) xxx–xxx

Contents lists available at SciVerse ScienceDirect

Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet

Development of a real-time fluorescent quantitative PCR assay for detection of impatiens necrotic spot virus

1 2

3

Q1

Xuejiao Chen a , Xiaogang Xu a,c , Yongzhong Li b , Yating Liu a,d,∗

4

a

5

b

6

c

7

College of Agronomy and Biotechnology, Yunnan Agricultural University, Kunming 650201, China College of Tobacco Science, Yunnan Agricultural University, Kunming 650201, China College of Life Sciences, Zhejiang University, Hangzhou 310029, China d Hubei Key Laboratory of Economic Forest Germplasm Improvement and Resources Comprehensive Utilization, Huanggang 438000, China

8

a b s t r a c t 9 10 11 12 13

Article history: Received 11 April 2012 Received in revised form 15 February 2013 Accepted 21 February 2013 Available online xxx

14

Impatiens necrotic spot virus (INSV) is an important plant virus that can cause severe disease in various ornamental and agricultural crops. Several species of thrips transmit INSV, of which the western flower thrip (Frankliniella occidentalis) is the most important. In this study, primers and TaqMan probes based on INSV non-structural protein gene sequences were designed, and a technique was developed for detecting INSV using fluorescent quantitative RT-PCR. The reproducibility, specificity and sensitivity for the RT-PCR were evaluated; and the RT-PCR method was developed to detect INSV in the host plants and western flower thrips. A standard curve constructed by a series of diluted plasmid DNA gave a good linear relationship between Ct value and concentration of plasmid DNA, a low coefficient of variation and good reproducibility. The detection method not only measured quantitatively the concentration of INSV in plant hosts and western flower thrips, but also measured accurately low concentrations of the virus. The measurable concentration fell to as low as 100 copies/␮l, while RT-PCR could detect only 102 copies/␮l. The method had high specificity and could distinguish INSV from Tomato spotted wilt virus (TSWV) and Tomato zonate spot virus (TZSV), both from the same genus of viruses. This is the first report of the same method being used to detect INSV in both plant hosts and western flower thrips, and should be helpful in studies of INSV epidemiology. © 2013 Published by Elsevier B.V.

19

Keywords: Impatiens necrotic spot virus TaqManTM Real-time fluorescence quantitative RT-PCR Frankliniella occidentalis

20

1. Introduction

21

Impatiens necrotic spot virus (INSV), a member of the Tospovirus genus in the virus family Bunyaviridae, is spherical membranebound virus with a diameter of 80–120 nm. The genome consists of three single strands of L, M and S RNA. L RNA has negative polarity, but M RNA and S RNA are ambisense (Law et al., 1992; van Poelwijk et al., 1997). S RNA in viral sense encodes a non-structural protein (NSs) but encodes the nucleocapsid protein in viral complementary sense (de Haan et al., 1992). It can infect 648 species from 50 families (Wang and Guo, 2004), which includes 39 genera of ornamental plants and six genera of vegetables (Jones, 2005; OEPP/EPPO, 1999). INSV was first isolated and identified from infected Impatiens balsamina (de Avila et al., 1992; Vaira et al., 1993), but has now been found in many countries (Pappu et al., 2009). The host range of INSV is ranked second, after TSWV (Jones, 2005) in the Tospovirus

15 16 17 18

22 23 24 25 26 27 28 29 30 31 32 33 34

∗ Corresponding author at: College of Agronomy and Biotechnology, Yunnan Agri-

Q2 cultural University, Kunming 650201, China. Tel.: +86 871 5227726; fax: +86 871 5221966. E-mail addresses: [email protected], [email protected] (Y. Liu).

genus. INSV is spread mainly by three thrips: the most important is the western flower thrip (Frankliniella occidentalis; Deangelis et al., 1993, 1994; Wijkamp and Peters, 1993) and includes F. intonsa (Sakurai et al., 2004) and F. fusca (Naidu et al., 2001). INSV has caused severe losses of ornamental and agricultural crops in Europe and the USA (Daughtrey et al., 1997; Vicchi et al., 1999). In 1999, the European and Mediterranean Plant Protection Organization (EPPO) listed INSV in the A2 list of Quarantine Pests (OEPP/EPPO, 1999). Serological and molecular methods have been used widely for detection of INSV in plant tissues (Adam et al., 1993; Blockley and Mumford, 2001; Mumford et al., 1996; Okuda and Hanada, 2001; Roggero et al., 1996; Zhang et al., 2008, 2009). Other methods, such as host range (Wang and Guo, 2004) and electron microscopy (Daughtrey et al., 1997) have also been utilized. However, it is much harder to detect INSV in thrips, and ELISA is the only reported appropriate method (Deangelis et al., 1994; Sakurai et al., 2004). In general, all above methods have some disadvantages. For example, electron microscopy takes considerable time and ELISA can produce false positives results. In addition, these methods only detect the virus qualitatively not quantitatively. The real-time fluorescent quantitative RT-PCR technology is simple, fast, specific and sensitive, and can be used on a large scale.

0166-0934/$ – see front matter © 2013 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.jviromet.2013.02.012

Please cite this article in press as: Chen, X., et al., Development of a real-time fluorescent quantitative PCR assay for detection of impatiens necrotic spot virus. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.02.012

35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56

G Model VIRMET 12082 1–6

ARTICLE IN PRESS X. Chen et al. / Journal of Virological Methods xxx (2013) xxx–xxx

2 57 58 59 60 61 62 63 64 65 66

However, there is no report of the use of this method for quantitative detection of INSV. The method developed in the present study was based on a technique designed by Roberts et al. (2000), who applied TaqMan real-time fluorescent quantitative RT-PCR for the detection of TSWV in plant hosts. The method not only detected INSV content rapidly and effectively in the plant host, but also detected low copy number of INSV in thrips. Therefore, this method is suited to study INSV epidemiology and can provide a reliable detection technology for quarantine organizations to prevent the wider spread of INSV.

67

2. Materials and methods

68

2.1. Virus isolates

69

This research utilized three species from the Tospovirus genus: INSV, Tomato zonate spot virus (TZSV) and Tomato spotted wilt virus (TSWV). Three isolates of INSV were used. Isolate INSVPA-CG-1 from Phalaenopsis amabilis was collected from Chenggong County of Kunming and was supplied as fresh leaves. Isolate INSVPA-CG-2 from P. amabilis was also collected from Chenggong County, but was maintained on Emilia sonchifolia. Isolate INSVHL-YA-9 from Hymenocallis littoralis Salisb. was collected from Yun-An Conference Center of Kunming and was maintained on E. sonchifolia. Isolate TZSVIC-YAU-1 from Iris tectorum was collected from Yunnan Agricultural University in Kunming and was maintained on E. sonchifolia. Finally, isolate TSWVLS-CG-1 from Lactuca sativa was collected from Chenggong County and was maintained on E. sonchifolia. A mixed infection sample of LS-TSWV and INSV-1 – infected by both TSWV and INSV – was maintained on E. sonchifolia. All plants were kept in an insect-proof greenhouse.

70 71 72 73 74 75 76 77 78 79 80 81 82 83 84

85

2.2. Thrips infected by INSV

86

97

Western flower thrips used in this study were collected from China rose (Rosa chinensis) grown in a greenhouse in Chenggong County. They were fed with fresh pods of common bean (Phaseolus vulgaris L.) in a plastic container in an incubator maintained at approximately 25 ◦ C under a 16-h photoperiod. After 5–6 generations were grown in the above conditions, first instar larvae were placed onto infected E. sonchifolia leaves with systemic symptoms induced by isolate INSVHL-YA-9 for a 24-h acquisition access period. Then the infected thrips were transferred to plastic containers with fresh pods of common bean. The second instar larvae, pupae and adults of thrips were used for TaqMan quantitative fluorescent detection.

98

2.3. Primers and TaqMan probe design

99

NSs gene sequences of seven INSV isolates and six other species of Tospovirus were used to find the conservative and variable regions by alignment with DNAman software. Based on this INSV variable region, software Primer Premier 5.0 (http://www.premierbiosoft.com) was used to design the primers Y-F and Y-R, INSV-F and INSV-R. Then online software Primer 3.0 (http://www.frodo.wi.mit.edu/) was used to design a TaqMan probe between INSV-F and INSV-R. The fragment size amplified by Y-F and Y-R primers is 353 bp, while 182 bp is amplified by INSVF and INSV-R primers. The 5 end was FAM-labeled and 3 end TAMRA-labeled. The primers were synthesized by Biomed (Beijing, China) and probe synthesized by Takara (Dalian, China). All primers and probe are listed in Table 1. All NSs gene sequences used in the study were from GenBank: seven INSV isolates (Accession Nos. NC 003624, GU112504, EU095193, GQ336989, DQ425096, X66972 and AB109100), TZSV (NC 010489), Capsicum chlorosis

87 88 89 90 91 92 93 94 95 96

100 101 102 103 104 105 106 107 108 109 110 111 112 113 114

Table 1 Sequences of primers and TaqMan probe in the study. Name

Sequence (5 –3 )

Location on S RNA

Number of bases

INSV-F INSV-R INSV-P Y-F Y-R

CCAGACCAACAACAGGACAGTA TGAAGAACCGGCTGTATGTG TCACTGGCAATGTCTGCAACTTC ATTGAAGCTGCAAATAAAGG TCATCAGACAGGGTGAAGAA

677–698 839–858 717–739 519–538 852–871

22 20 23 20 20

virus (NC 008301), Melon yellow spot virus (NC 008300), Watermelon silver mottle virus (NC 003843), TSWV (NC 002051) and Groundnut bud necrosis virus (NC 003619).

115

2.4. RNA extraction

118

2.4.1. Total RNA extraction from plant tissue RNA was extracted from 100 mg of fresh leaf material using Universal Plant Total RNA Extraction Kit (spin-column) from Bioteke (Beijing, China) following the protocol provided by the manufacturer.

119

2.4.2. Total RNA extraction from thrips RNA extracted from thrip material was used and treated mainly as described by Boonham et al. (2002) with minor changes. Five thrips were rinsed with DEPC-treated water and ground in a 1.5ml microcentrifuge tube with 50 ␮l of extraction buffer: 200 mM Tris–HCL (pH 8.5), 250 mM NaCl, 25 mM EDTA and 0.5% (w/v) SDS. After the thrips were thoroughly ground, 25 ␮l of 3 M sodium acetate (pH 5.2) was added. Tubes were incubated at −20 ◦ C for 10 min, and centrifuged at 13,000 × g at 4 ◦ C for 5 min. The pellet was discarded and one volume of isopropanol (−20 ◦ C) was added and mixed thoroughly. After incubating the tube at room temperature for 30 min, it was centrifuged at 13,000 × g at 4 ◦ C for 30 min. The pellet was washed with 70% ethanol and centrifuged at 13,000 × g at room temperature for 1 min. The process starting with 70% ethanol washing was repeated three times. The pellet was dried, suspended with 10 ␮l of DEPC-treated water and used for reaction immediately or stored at −80 ◦ C.

124

2.5. RT-PCR amplification, cloning and sequence analysis

141

RT-PCR in the study was performed in 0.2-ml tubes in a Biometra Tprofessional Standard Gradient Thermocycler (Germany) using the Superscript Two-step RT-PCR system (Takara, Dalian, China). RNA was reverse transcribed into cDNA in a 0.2-ml centrifuge tube and cDNA was synthesized in a reaction volume of 20 ␮l. A solution was prepared: 3.5 ␮l of DEPC-treated water, 6.0 ␮l of 5 × M-MLV buffer (Takara, Dalian, China), 2.0 ␮l of 10 mM dNTP mixture (Takara, Dalian, China), 2.0 ␮l of 50 ␮M random hexamers [pd(N)6] (Qiagen, Germany), 1.0 ␮l of 40 U/␮l RNase inhibitor (Takara, Dalian, China), 0.5 ␮l of 200 U/␮l M-MLV reverse transcriptase (Takara, Dalian, China) and 5.0 ␮l of RNA. The solution was mixed well and put on ice for 9 min, and then the reaction was started. The RT protocol was 42 ◦ C for 30 min, 99 ◦ C for 5 min, 5 ◦ C for 5 min and finally kept at 4 ◦ C. Synthesized cDNA was stored at −20 ◦ C. Reaction solution of PCR assays consisted of 0.25 ␮l of Takara Ex Taq (5 U/␮l), 5 ␮l of 10× Ex Taq buffer, 4 ␮l of dNTP mixture (2.5 mM), 2 ␮l of template cDNA, 2 ␮l of primer Y-F (20 ␮M), 2 ␮l of primer Y-R (20 ␮M) and sterile water added to 50 ␮l. The reaction sequence is listed: 94 ◦ C pre-denaturing for 5 min, 94 ◦ C denaturing for 30 s, 58 ◦ C annealing for 30 s, 72 ◦ C extension for 1 min with 35 cycles, and final extension for 10 min at 72 ◦ C. PCR products (5 ␮l) were analyzed by agarose gel electrophoresis and purified based on the Bioteke protocol. The purified PCR products were ligated into

142

Please cite this article in press as: Chen, X., et al., Development of a real-time fluorescent quantitative PCR assay for detection of impatiens necrotic spot virus. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.02.012

116 117

120 121 122 123

125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140

143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165

ARTICLE IN PRESS

G Model VIRMET 12082 1–6

X. Chen et al. / Journal of Virological Methods xxx (2013) xxx–xxx Table 2 The coefficient of variation in three separate experiments for real-time PCR (CV, %). Copies of plasmid DNA 2.10 × 10

2.10 × 10

2.10 × 10

2.10 × 10

2.10 × 10

0.73 0.54 0.10

1.97 0.80 1.25

0.83 0.52 0.65

2.41 2.13 1.98

0.54 1.53 0.75

8

Expt. 1 Expt. 2 Expt. 3

7

6

5

4

170

pMD19-T vector (Takara, Dalian, China). The PCR products were also sequenced by the universal M13F and M13R primers (Bioteke, Beijing, China). The sequenced NSs fragments and GenBank INSV isolates were subject to BLAST analysis for alignment, which was determined as positive if homology reached 90%.

171

2.6. Plasmid standard

172

The recombinant plasmid was purified using the following Bioteke Plasmid Extraction Kits protocol according to the manufacturer’s instructions (Bioteke), and concentration and purity of plasmid DNA was measured by GeneQuant Ultrospc6300 Pro (England). Cycle thresholds (Ct) for a tenfold dilution series of plasmid DNA were plotted to yield a standard curve for each experiment.

166 167 168 169

173 174 175 176 177

178

2.7. Real-time PCR assay IQTM

197

The real-time PCR was carried out in an iCycler Realtime Detection System (BioRad), and the Premix Ex TaqTM protocol (Takara) was used throughout as 25-␮l reactions with minor changes. The reactions contained 12.5 ␮l of Premix Ex TaqTM (2×), 0.5 ␮l of 10 ␮M INSV-F, 0.5 ␮l of 10 ␮M INSV-R, 0.25 ␮l of 100 nM TaqMan probe INSV-P, 9.25 ␮l of sterilized deionized water and 2 ␮l of cDNA. All solutions were made on ice. The reaction conditions were: 94 ◦ C pre-denaturing for 5 min, and 40 cycles of 94 ◦ C for 1 min, 60 ◦ C for 30 s and 60 ◦ C for 15 s. Real-time assays were analyzed using the iCycler iQ version 3.1 system software (BioRad). The Ct is the cycle at which a significant increase in fluorescence occurs, hence, Ct < 40 indicates a positive result. For generation of standard quantitation curves, the Ct values were plotted proportionally to the logarithm of the input copy numbers. The coefficients of variation (CV) were calculated by dividing the standard error by the mean Ct value for two replicates of each sample from three separate experiments to evaluate reproducibility. A smaller CV indicates better reproducibility. No-template control and healthy plants were also used as checks.

198

3. Results

199

3.1. Analysis on standard curve and reproducibility

200

The extracted recombinant plasmid carrying the 353-bp NSs gene of INSV, which included the real-time PCR 182-bp target sequence, was detected on an OD260/OD280 ratio of 1.850 by spectrophotometer, and had a concentration of 2.10 × 108 copies/␮l. The recombinant plasmid was diluted in a tenfold series with the least concentration of 104 copies/␮l using sterile deionized water, and the resulting Ct values were plotted to create a standard curve (Fig. 1). Each concentration was tested twice and Ct values had a very good linear relationship with log values of initial template concentration (R2 = 0.998). Furthermore, two Ct values for each concentration had good reproducibility and its CV was in the range of 0.10–2.41%. The greatest variation was typically for the 105 -copy dilution in three separate experiments (Table 2).

179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196

201 202 203 204 205 206 207 208 209 210 211 212

3

3.2. Specificity analysis

213

Five samples (INSVPA-CG-2 , LS-TSWV & INSV-1, thrips infected by INSV, TZSVIC-YAU-1 and TSWVLS-CG-1 ) were used for TaqMan Real-time PCR testing. Only INSVPA-CG-2 , LS-TSWV and INSV-1, and INSV-infected thrip samples showed fluorescent signals; and TZSVIC-YAU-1 , TSWVLS-CG-1 , healthy plants and water checks showed no fluorescence (Fig. 2). Agarose gel electrophoresis confirmed the results (data not shown). The above results indicated clearly that the method detected effectively INSV.

214

3.3. Sensitivity analysis

222

The sensitivity between the TaqMan fluorescent quantitative method and regular RT-PCR method was tested using diluted recombinant plasmid from 108 to 100 copies/␮l. The lowest concentration detected by the TaqMan fluorescent method was 2.10 × 100 copies/␮l, while regular RT-PCR could only detect 2.10 × 102 copies/␮l (Fig. 3B).

223

3.4. Detection of INSV in total thrip RNA extracts and plant hosts

229

The different stages of infected thrips, first instar larvae, second instar larvae, pupae and adult insects had INSV concentrations of 5.52, 3.10 × 101 , 2.41 × 102 and 5.53 × 102 copies/␮l, respectively, according to the TaqMan fluorescent quantitative method. Plant samples infected with INSVPA-CG-1 , INSVHL-YA-9 and INSVPA-CG-2 had average concentrations of 9.56 × 105 , 8.60 × 105 and 8.25 × 105 copies/␮l, respectively (data not shown).

230

4. Discussion

237

There are a few adopted widely methods to detect INSV, such as serological and molecular technologies. Serological methods include ImmunoStrip and ELISA. Molecular technology utilizes mainly specific primers or degenerate primers of tospoviruses to conduct RT-PCR (Mumford et al., 1996; Okuda and Hanada, 2001) and comparisons after cloning, sequencing and alignment procedures. These methods, including biological measurement and electron microscopy have their practical uses. For example, ImmunoStrip can quickly detect INSV during field investigations. However, they also have disadvantages. Zhang et al. (2008) found that the healthy part from INSV-infected Oncidium luridum showed negative with ELISA but had a weak band with RT-PCR – possibly due to uneven distribution of INSV in the infected plant. This indicated that ELISA is not sensitive enough to detect low concentrations of INSV. RT-PCR is more sensitive, but requires the virus sequence to identify accurately the species (Perry et al., 2005; Tanina et al., 2001). Detection of INSV in thrips has only been reported using ELISA (Deangelis et al., 1994; Sakurai et al., 2004), but false positive results are frequent due to the small size of thrips, low concentration of virus in thrips and interference of insect tissue with the immune reaction. Furthermore, all these methods only detect INSV qualitatively not quantitatively. The TaqMan fluorescent quantitative RT-PCR method constructed in the present study can not only detect INSV specifically in plant hosts and thrips, but also accurately detect low concentrations of INSV. This will aid research on the function of thrips in the spread of INSV. This system using two-labeled TaqMan probe and specific primers in the PCR reaction enhances sensitivity and specificity. Therefore, it has many advantages compared with ordinary PCR. First, the real-time fluorescent PCR uses a new temperature control mechanism that reduces significantly amplification time. The steps of electrophoresis and dying after the regular PCR are time consuming, and are environmentally polluting and harmful to human health due to the dye ethidium bromide, therefore they were

238

Please cite this article in press as: Chen, X., et al., Development of a real-time fluorescent quantitative PCR assay for detection of impatiens necrotic spot virus. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.02.012

215 216 217 218 219 220 221

224 225 226 227 228

231 232 233 234 235 236

239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271

G Model VIRMET 12082 1–6

ARTICLE IN PRESS X. Chen et al. / Journal of Virological Methods xxx (2013) xxx–xxx

4

Fig. 1. Quantification of tenfold diluted serially plasmid DNA by TaqManTM amplification. (A) Amplification plots obtained at different concentrations of plasmid DNA (from 2.10 × 108 to 2.10 × 104 copies/␮l). (B) Standard curve obtained from (A).

272 273 274 275 276 277 278 279 280

removed from our method. By examining the RT-PCR product in a contained tube, the risks of cross-contamination and false positives are reduced. Second, data analysis for the TaqMan method is rapid and has good reproducibility. The data analysis for 96 samples in a standard format can be performed simultaneously. Finally, TaqMan not only examines samples qualitatively, but also quantitatively. Collecting the real-time fluorescent signal gives the Ct value for the unknown sample so that the initial sample copy can be calculated automatically from the standard curve. Furthermore,

just changing the probe and primer concentrations can optimize the TaqMan system. However, the cost of the TaqMan method is higher than for the other methods. There are more advantages for TaqMan fluorescent RT-PCR than for other methods due to its good reproducibility and better meeting the scientific requirements of quick, effective and accurate measurement. Real-time fluorescent PCR has been used for detection of tospoviruses, such as TSWV (Boonham et al., 2002; Debreczeni et al., 2011; Roberts et al., 2000); but no method for INSV testing has

Fig. 2. Quantification curves of INSV in infected plants and western flower thrips. Plant positive sample infected by INSVPA-CG-2 (), the sample infected by LS-TSWV AND

Q3 INSV-1 (), the positive thrip sample infected by INSVPA-CG-2 (), the plant sample infected by TZSV (–), the plant sample infected by TSWV (—) and healthy and no-template controls (—).

Please cite this article in press as: Chen, X., et al., Development of a real-time fluorescent quantitative PCR assay for detection of impatiens necrotic spot virus. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.02.012

281 282 283 284 285 286 287 288 289

G Model VIRMET 12082 1–6

ARTICLE IN PRESS X. Chen et al. / Journal of Virological Methods xxx (2013) xxx–xxx

5

Fig. 3. Sensitivity of the TaqMan assay compared with the regular RT-PCR assay. (A) Quantification of tenfold serially diluted plasmid DNA by TaqManTM amplification (from 2.10 × 108 to 2.10 × 100 copies/␮l). (B) Detection of endpoint PCR products by electrophoresis in 1.5% agarose/TBE. Lane 1, 2.10 × 100 copies/␮l; lane 2, 2.10 × 101 copies/␮l; lane 3, 2.10 × 102 copies/␮l; lane 4, 2.10 × 103 copies/␮l; lane 5, 2.10 × 104 copies/␮l; lane 6, 2.10 × 105 copies/␮l; lane 7, 2.10 × 106 copies/␮l; lane 8, 2.10 × 107 copies/␮l; lane 9, 2.10 × 108 copies/␮l; lane 10, healthy plant control; M, 2000 bp DNA marker (Bioteke). 290 291 292 293 294 295

been reported. Due to its high sensitivity, specificity and quantitative measurement, the TaqMan real-time INSV detection method constructed in the present study can quantify low copy numbers of INSV in early infection stages showing no obvious symptoms. This will provide quarantine organizations with a quick and effective method to aid the control of INSV spread.

296

Acknowledgments

297

This work was supported by the National Natural Science Foundation of China (30960224 and 31260451) and Hubei Key Laboratory of Economic Forest Germplasm Improvement and Resources Comprehensive Utilization (20011BLK244).

298 299 300

301

References

302

Adam, G., Yeh, S.D., Reddy, D.V.R., Green, S.K., 1993. Serological comparison of tospovirus isolates from Taiwan and India with impatiens necrotic spot virus and different tomato spotted wilt virus isolates. Arch. Virol. 130, 237–250. Blockley, A.L., Mumford, R.A., 2001. Identification and isolation of Impatiens necrotic spot virus from prickly pear cactus (Opuntia microdasys). Plant Pathol. 50, 805. Boonham, N., Smith, P., Walsh, K., Tame, J., Morris, J., Spence, N., Bennison, J., Barker, I., 2002. The detection of Tomato spotted wilt virus (TSWV) in individual thrips using real time fluorescent RT-PCR (TaqMan). J. Virol. Methods 101, 37–48. Daughtrey, M.L., Jones, R.K., Moyer, J.W., Daub, M.E., Baker, J.R., 1997. Tospoviruses strike the greenhouse industry: INSV has become a major pathogen on flower crops. Plant Dis. 81, 1220–1230. Deangelis, J.D., Sether, D.M., Rossignol, P.A., 1993. Survival, development and reproduction in western flower thrips (Thysanoptera: Thripidae) exposed to impatiens necrotic spot virus. Environ. Entomol. 22, 1308–1312. Deangelis, J.D., Sether, D.M., Rossignol, P.A., 1994. Transmission of Impatiens Necrotic Spot Virus in peppermint by western flower thrips (Thysanoptera: Thripidae). J. Econ. Entomol. 87, 197–201. de Avila, A.C., de Haan, P., Kitajima, E.W., Kormelink, R., Resende, R., de, O., Goldbach, R.W., Peters, D., 1992. Characterization of a distinct isolate of tomato spotted wilt virus (TSWV) from Impatiens sp. in the Netherlands. J. Phytopathol. 134, 133–151.

303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321

Debreczeni, D.E., Ruiz-Ruiz, S., Aramburu, J., Lopez, C., Belliure, B., Galipienso, L., Soler, S., Rubio, L., 2011. Detection, discrimination and absolute quantitation of Tomato spotted wilt virus isolates using real time RT-PCR with TaqMan MGB probes. J. Virol. Methods 176, 32–37. de Haan, P., de Avila, A.C., Kormelink, R., Westerbroek, A., Gielen, J.J.L., Peters, D., Goldbach, R., 1992. The nucleotide sequence of the S RNA of Impatiens necrotic spot virus, a novel tospovirus. FEBS Lett. 306, 27–32. Jones, D.R., 2005. Plant viruses transmitted by thrips. Eur. J. Plant Pathol. 113, 119–157. Law, M.D., Speck, J., Moyer, J.W., 1992. The M RNA of Impatiens necrotic spot tospovirus (Bunyaviridae) has an ambisense genomic organization. Virology 188, 732–741. Mumford, R.A., Barker, I., Wood, K.R., 1996. An improved method for the detection of Tospoviruses using the polymerase chain reaction. J. Virol. Methods 57, 109–115. Naidu, R.A., Deom, C.M., Sherwood, J.L., 2001. First report of Frankliniella fusca as a vector of Impatiens necrotic spot tospovirus. Plant Dis. 85, 1211. OEPP/EPPO, 1999. EPPO data sheets on quarantine pests: Impatiens necrotic spot tospovirus. Bull. OEPP/EPPO Bull. 29, 473–476. Okuda, M., Hanada, K., 2001. RT-PCR for detecting five distinct Tospovirus species using degenerate primers and dsRNA template. J. Virol. Methods 96, 149–156. Pappu, H.R., Jones, R.A.C., Jain, R.K., 2009. Global status of tospovirus epidemics in diverse cropping systems: successes achieved and challenges ahead. Virus Res. 141, 219–236. Perry, K.L., Miller, L., Williams, L., 2005. Impatiens necrotic spot virus in greenhouse grown potatoes in New York State. Plant Dis. 89, 340. Roberts, C.A., Dietzgen, R.G., Heelan, L.A., Maclean, D.J., 2000. Real-time RT-PCR fluorescent detection of Tomato spotted wilt virus. J. Virol. Methods 88, 1–8. Roggero, P., Adam, G., Milne, R.G., Lisa, V., 1996. Purification and serology of virions of Impatiens necrotic spot tospovirus. Eur. J. Plant Pathol. 102, 563–568. Sakurai, T., Inoue, T., Tsuda, S., 2004. Distinct efficiencies of impatiens necrotic spot virus transmission by five thrips vector species (Thysanoptera: Thripidae) of tospoviruses in Japan. Appl. Entomol. Zool. 39, 71–78. Tanina, K., Inoue, K., Date, H., Okuda, M., Hanada, K., Nasu, H., Kasuyama, S., 2001. Necrotic spot disease of cineraria caused by impatiens necrotic spot virus. Ann. Phytopathol. Soc. Jpn. 67, 42–45. Vaira, A.M., Roggero, P., Luisoni, E., Masenga, V., Milne, R.G., Lisa, V., 1993. Characterization of two tospoviruses in Italy: tomato spotted wilt and impatiens necrotic spot. Plant Pathol. 42, 530–542. van Poelwijk, F., Prins, M., Goldbach, R., 1997. Completion of the impatiens necrotic spot virus genome sequence and genetic comparison of the L proteins within the family Bunyaviridae. J. Gen. Virol. 78, 543–546.

Please cite this article in press as: Chen, X., et al., Development of a real-time fluorescent quantitative PCR assay for detection of impatiens necrotic spot virus. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.02.012

322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363

G Model VIRMET 12082 1–6 6 364 365 366 367 368 369 370

ARTICLE IN PRESS X. Chen et al. / Journal of Virological Methods xxx (2013) xxx–xxx

Vicchi, V., Fini, P., Cardoni, M., 1999. Presence of impatiens necrotic spot tospovirus (INSV) on vegetable crops in Emilia-Romagna region. Inform. Fitopatol. 49, 53–55. Wang, X., Guo, J.Z., 2004. Impatiens necrotic spot virus and its control. Plant Quar. 18, 86–87. Wijkamp, I., Peters, D., 1993. Determination of the median latent period of two tospoviruses in Frankliniella occidentalis, using a novel leaf disk assay. Phytopathology 83, 986–991.

Zhang, Q.P., Ding, Y.M., Li, M., Zhou, J., Bai, Y.H., Cun, D.Y., Cao, Y.H., 2008. Detection and molecular identification of Impatiens necrotic spot virus isolated from potted Oncidium. Plant Quar. 22, 348–351. Zhang, Q.P., Ding, Y.M., Wang, Y.Y., Li, M., Zhou, J., Duan, L.H., Bai, Y.H., Sun, B.S., 2009. Detection of Impatiens necrotic spot tospovirus (INSV) by RT-PCR and Nested PCR. J. Huazhong Agric. Univ. 28, 23–26.

Please cite this article in press as: Chen, X., et al., Development of a real-time fluorescent quantitative PCR assay for detection of impatiens necrotic spot virus. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.02.012

371 372 373 374 375 376