- Email: [email protected]
Development of a universal chemiluminometric genotyping method for high-throughput detection of 7 LDLR gene mutations in greek population
Available online at www.sciencedirect.com
Clinical Biochemistry 41 (2008) 335 – 342
Development of a universal chemiluminometric genotyping method for high-throughput detection of 7 LDLR gene mutations in greek population Kyriaki Glynou a,⁎, Eleftheria Laios b , Euridiki Drogari b , Vassilis Tsaoussis a a
b
Medicon Hellas S.A., R&D Department, 5-7 Melitona St., Gerakas 15344, Greece Unit of Metabolic Diseases, Choremio Research Laboratory, University of Athens, 1st Department of Pediatrics, “Aghia Sophia” Children's Hospital, Athens 11527, Greece Received 26 July 2007; received in revised form 12 December 2007; accepted 12 December 2007 Available online 3 January 2008
Abstract Objectives: Familial hypercholesterolemia (FH) is caused by mutations in the LDL receptor (LDLR) gene. We report the application of a universal method with high allele discrimination properties to the simultaneous genotyping of 7 LDLR mutations in Greeks, in dry-reagent format. Design and methods: We genotyped mutations C858A, C939A, G1285A, T1352C, G1646A, G1775A, C/T81G. Unpurified amplicons from a multiplex PCR that produced fragments encompassing all 7 mutations were subjected to probe extension reactions in the presence of fluoresceinmodified dCTP, and a microtiter well-based assay of extension products with a peroxidase–antifluorescein conjugate and a chemiluminogenic substrate. We used lyophilized dry reagents and assigned genotypes by the signal ratio of normal-to-mutant-specific probe. Results: We standardized the method and optimised all steps for specificity. The method was validated by genotyping blindly 119 (833 genotypings). Results were fully concordant with other methods used as standards. Conclusions: This method is accurate, simple, rapid and robust. The microtiter well format allows genotyping of a large number of samples in parallel for several mutations. © 2007 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved. Keywords: Chemiluminometric genotyping; Mutation detection; Familial hypercholesterolemia; LDLR
Introduction Familial hypercholesterolemia (FH) is a monogenic autosomal dominant disorder characterized by elevated low density lipoprotein (LDL) cholesterol, tendon xanthomas, and premature coronary heart disease [1]. FH is caused by mutations in the LDL receptor (LDLR) gene, with more than 800 mutations known worldwide [2]. The frequency of heterozygous FH is 1:500 and 1:1,000,000 for homozygous FH. In Greeks and Greek-Cypriots, a total of 27 mutations have been reported [3– 10]. According to one representative study, six LDLR mutations account for 60% of cases while the three most common mutations account for 49% of cases [4]. Traditionally, FH clinical diagnosis is based on family history, elevated LDL cholesterol, and tendon xanthomas. A serious problem in clinical diagnosis is that absolute total or ⁎ Corresponding author. Fax: +30 2106 612 666. E-mail address: [email protected] (K. Glynou).
LDL cholesterol cut-off points cannot be applied. In addition, total and LDL cholesterol do not allow unequivocal diagnosis of FH in patients with borderline lipid profiles, and partial or early clinical features of FH, especially children [11–13]. Mutation detection provides the only definite diagnosis and is also important in prevention and early treatment during the asymptomatic stage of the disease since atherosclerosis begins in childhood. Although the ability to perform DNA genotyping of the LDLR gene has become an important requirement, not many diagnostic assays exist, mainly because of the size of the LDLR gene which spans 45 kb and contains 18 exons [14]. Molecular diagnosis is currently accomplished by two approaches: screening of the LDLR gene for any possible mutations or screening of the gene for specific reported mutations. The former is useful in heterogeneous populations and may be accomplished using single-strand conformation polymorphism (SSCP) analysis [15–18], denaturing gradient gel electrophoresis (DGGE) [19,20], and denaturing HPLC [21,22]. More recently developed methods include sequencing of the LDLR
0009-9120/$ - see front matter © 2007 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved. doi:10.1016/j.clinbiochem.2007.12.016
336
K. Glynou et al. / Clinical Biochemistry 41 (2008) 335–342
cDNA region [23], a SSCP/heteroduplex method followed by capillary electrophoresis [24], and melt-microplate array diagonal gel electrophoresis [25]. Some of the above methods have been applied to genetic screening in heterogeneous populations [26] as has sequencing [27–30]. The second approach in molecular diagnosis of FH involves detection of specific reported mutations known to occur in a particular population. For example, in Spain, a DNA array for identification of 117 known LDLR mutations was recently developed [31]. Diagnosis is even simpler in populations in which a limited number of mutations (1 to 3) is responsible for a large percentage of cases [32,33]. Accordingly, since a small number of mutations are found in Greece, a strategy tailored to specific mutations is more efficient than screening the entire gene. Recently, a method to detect the three most common mutations using the NanoChip® microelectronic array technology system was developed [34]. In this study we developed a rapid and simple method for the simultaneous detection of 7 LDLR mutations in the Greek population that uses microtiter wells which are already adopted by clinical laboratories and requires only 70 min for completion. The method comprises (a) a multiplex PCR to simultaneously amplify 5 fragments spanning all 7 mutations of the LDLR gene (b) a probe extension (PE) reaction of the amplified products in the presence of a fluorescein-modified nucleotide, without prior purification of the PCR product and (c) detection of PE products on streptavidin-coated microtiter wells by use of a horseradish peroxidase (HRP)-labeled antifluorescein antibody in combination with a chemiluminogenic substrate, which provides high sensititvity of the whole assay thus allowing only 4 cycles of the PE reaction at previous step. The method was validated by analyzing 119 samples, corresponding to 833 genotypings. Materials and methods Instrumentation Lyophilization of PCR and PE reaction mixtures was carried out using the Lyophlex 0.8 lyophiliser from BOC Edwards. PCR amplification reactions were performed in either a 96-well GeneAmp® PCR system 9700 from Applied Biosystems or in the Mastercycler gradient from Eppendorf. PE reaction was also performed in the Mastercycler gradient. Microtiter well-based chemiluminometric genotyping assays were performed using the Stat Fax 2200 shaker and automated washer Stat Fax 2600 from Awareness Technology. Chemiluminescence measurements were carried out using the PhL microplate luminometer from Aureon Biosystems GmbH. A digital camera, Kodak DC 120 and the Gel Analyser Software were from Kodak. Materials All oligonucleotides, used as primers for amplification of the 5 regions of the LDLR gene, as well as biotinylated genotyping probes for PE reactions, were from ThermoElectron. The sequences of all oligonucleotides and their respective functions are given in Table 1. Deoxynucleotide triphosphates (dNTPs)
Table 1 Primers and biotinylated oligonucleotides used in PCR and probe extension reactions, respectively Name
Sequence (5′→3′)
Mutation detected
2_up 2_dn 6_up 6_dn 9_up 9_dn 11_up 11_dn 12_up 12_dn 858_N 858_M 939_N 939_M 1285_N 1285_M 1352_N 1352_M 1646_N 1646_M 1775_N 1775_M C81_N T81_N 81_M
GGGAATCAGACTGTTCCTGATCGGATG ACGTCTCCTGGGACTCATCAGAGCCA CAAGCAAACTGAGGCTCAGACACA CGCCCAGCATCGCTTCATTTTTT TGCAGGATGACACAAGGGGATGG CTCTGTCAAGCTGGGTGCTGAGGCA CCACCAGCTTCATGTACTGGACTGA ATTAGTCTGCCGTGGTGGCACGTGT CAGCACGTGACCTCTCCTTATCCA TGCATCTCGTACGTAAGCCACACCTC CCCAACAAGTTCAAGTGTCACAGC CCCAACAAGTTCAAGTGTCACAGA GGTCAGATGAACCCATCAAAGAGTGC GGTCAGATGAACCCATCAAAGAGTGA ACCTCCGTGTCCAGAGCGACCAC ACCTCCGTGTCCAGAGCGACCAT GGTCTGACCTGTCCCAGAGAATGAT GGTCTGACCTGTCCCAGAGAATGAC TCAAGAAAGGGGGCCTGAATGG TCAAGAAAGGGGGCCTGAATGA TCCAAGATGGTCTTCCGGTTGCCCC TCCAAGATGGTCTTCCGGTTGCCCT GGCACTGGAACTCGTTTCTTTCG GGCACTGGAACTCGTTTCTTTCA GGCACTGGAACTCGTTTCTTTCC
– – – – – – – – – – C858A C939A G1285A T1352C G1646A G1775A C/T81G
were from Promega. White, flat bottomed Maxisorp microtiter wells were from Nunc and streptavidin was from Roche. Tth DNA polymerase was purchased from Biotools, SmarTaq was from HyTest and Vent exo− DNA polymerase was from New England Biolabs. Fluorescein-ΟΒΕΑ-dCTP (F-dCTP) was from Millipore. Antifluorescein antibody conjugated to horseradish peroxidase (antiF-HRP) was from Biodesign and the chemiluminogenic substrate for horseradish peroxidase (CHMI) was obtained from BioFX. Samples 161 genomic DNA samples from individuals were included in this study. Blood collections were performed with informed oral consent of the participants. Genomic DNA was isolated by use of the QIAamp DNA Blood Mini Kit (Qiagen). Chemiluminometric genotyping by probe extension Polymerase chain reaction PCR mixture containing 3 mM MgCl2, 300 μM deoxynucleotide triphosphates, 5 pmol each of primers 2_up and 2_dn, 30 pmol of primers 6_up and 6_dn, 7.5 pmol of primers 9_up and 9_dn, 12 pmol of primers 11_up and 11_dn, 13.5 pmol of 12_up and 12_dn and stabilizers in a total volume of 20 μL, was lyophilized overnight. Lyophilized mixtures were reconstituted just before use by the addition of 30 μL of a solution containing DNA polymerase buffer, DNA polymerase and DNA template. After reconstitution the mixture contained 75 mM Tris–HCl (pH 9.0), 50 mM KCl, 20 mM (NH4)2SO4, 2 mM MgCl2,
K. Glynou et al. / Clinical Biochemistry 41 (2008) 335–342
337
Fig. 1. Schematic presentation of the LDLR gene and the relative positions of the mutation sites.
200 μM deoxynucleotide triphosphates, 2 U of thermostable Tth polymerase or SmarTaq polymerase, the primers, stabilisers and 100–300 ng template DNA. Amplification was carried out as follows: 1 cycle at 95 °C for 2 min, followed by 40 cycles at 95 °C for 10 s, 59 °C for 20 s and 72 °C for 20 s, and 1 final cycle at 72 °C for 5 min. Probe extension reaction Probe extension (PE) reaction mixture containing 5 μΜ dATP, 5 μΜ dTTP, 5 μΜ dGTP, 3.5 μΜ dCTP, 1.5 μΜ F-dCTP, 1.5 pmol biotinylated probe and stabilisers in a total volume of 10 μL was lyophilized overnight. The mixture was stored at 4 °C with desiccant and reconstituted just before use by the addition of a solution containing DNA polymerase buffer, Vent exo− DNA polymerase, and PCR-amplified product. The final mixture contained 75 mM Tris–HCl (pH 9.0), 50 mM KCl, 20 mM (NH4)2SO4, 2 mM MgCl2, except for the detection of G1646A mutation where the mixture contained 1.5 mM MgCl2, 5 μΜ dATP, 5 μΜ dTTP, 5 μΜ dGTP, 3.5 μΜ dCTP, 1.5 μΜ FdCTP, stabilisers, 1.5 pmol biotinylated probe, 0.5 U Vent exo− DNA polymerase and 1.5 μL of the PCR product (total volume 20 μL). The PE reactions were performed in a thermal cycler as follows: 1 cycle at 95 °C for 2 min followed by 4 cycles of denaturation at 95 °C for 20 s, annealing at 60 °C for 10 s and extension at 72 °C for 10 s. For each mutation, two PE reactions were performed, one using a probe complementary to the normal allele and the other with a probe complementary to the mutant allele. Probes were 5′-biotinylated whereas their 3′-end was complementary to the allelic nucleotide.
Fig. 2. Agarose gel (3%) electrophoresis of the products of multiplex PCR, followed by ethidium bromide staining. Lane 1 contains DNA ladder 50 bp, and lanes 2 and 3 contain amplicons produced from PCR reactions using Tth DNA polymerase and SmarTaq DNA polymerase, respectively. The lengths of PCR products are 200 bp, 251 bp, 363 bp, 414 bp and 616 bp.
Chemiluminometric assay of extension products and interpretation of results After the PE reaction was completed, 30 μL of wash buffer consisting of 100 mM Tris (pH 7.6), 150 mM NaCl and 1 mL/L Tween-20 were added to each PE product. A 50-μL aliquot of the PE reaction was transferred into streptavidin coated wells, prepared as previously reported [35], and the mixture was incubated at ambient temperature under gentle mechanical shaking for 10 min. The wells were washed three times with 300 μL wash buffer. Then, 50 μL of 0.11–0.22 mg/L antifluorescein-HRP diluted in wash buffer were added and the mixture was allowed to react for 20 min. The wells were washed as above and the activity of bound HRP was measured in the microplate luminometer by adding 50 μL chemiluminogenic
Fig. 3. Principle of probe extension reactions and the chemiluminometric detection of PE products. For each mutation two biotinylated probes are extended in two separate reactions. The 3′-end of the probes is complementary to the allelic nucleotide and only the probe which is perfectly hybridized to the PCR product will be extended by DNA polymerase leading to the incorporation of F-dCTP. Biotinylated PE products are captured onto streptavidin coated wells and horseradish peroxidase (HRP) labeled anti-fluorescein antibody (anti-F-HRP) is added. Anti-F-HRP binds only to the extended product. The activity of bound HRP is measured by adding a chemiluminogenic substrate.
338
K. Glynou et al. / Clinical Biochemistry 41 (2008) 335–342
Results
than when Tth was used. Under optimised conditions, 5 specific products of comparable intensity are generated with both polymerases (Fig. 2). Therefore both polymerases could be used. We chose Tth polymerase for the present study. Quality of template DNA affected the performance of PCR. DNA extracted using commercial kits (spin columns) and subsequently subjected to repeated freezing–thawing failed to amplify. Interestingly, DNA extracted more than 4 years ago using the salting-out procedure [36], gave all five amplicons with no loss of sensitivity of the multiplex amplification reaction. However, the quantity of DNA was not crucial for the amplification reaction, which was successful when the amount of template DNA ranged from 30 to 400 ng, while less than 30 ng or more than 400 ng has not been tested.
Polymerase chain reaction
Probe extension reaction/Chemiluminometric assay
Multiplex PCR produces 5 fragments of the LDLR gene, with sizes 200 bp, 251 bp, 363 bp, 414 bp and 616 bp. Each amplicon corresponds to a different exon carrying one or more of the mutations analysed (Fig. 1). PCR conditions and concentrations of the components were optimised in order to produce amplicons of comparable concentrations in the multiplex PCR. A common DNA polymerase (Tth polymerase) and a hot start type DNA polymerase (SmarTaq) were compared for their yield in PCR and for the formation of primer dimers. When SmarTaq was used less primer dimers were formed and as a consequence the PCR yield was slightly higher
The method described here, schematically presented in Fig. 3, was developed to detect 7 mutations in the LDLR gene in a single run. All probes used for the PE reactions were 5′-biotinylated to enable capture of PE products onto streptavidin-coated wells, and their 3′ end was complementary to the polymorphic nucleotide. PE probes were checked for their specificity by analyzing 8 individual PCR products amplified from heterozygous samples, each carrying one mutation. Primers were hybridized to the specific sequences and extended only in cases where the hybridization was perfect, except in the case of the primers used for the discrimination of the polymorphism C/T at nucleotide 81
substrate into each well and incubating under gentle shaking for 3 min at ambient temperature. Genotypes were assigned for each mutation by determining the signal ratio of specific to non specific probe extension reaction products. The signal ratio was calculated by dividing the Relative Luminescence Units (RLU) measured for the reaction of the probe (N) complementary to the wild type allele to the RLU measured for the reaction of the probe (M) complementary to the mutant allele. If N/M N 10 the sample was assigned as normal for the specific mutation, if N/M b 0.1 the sample was considered homozygous and if 0.5 b N/M b 4 the sample was considered heterozygous for the specific mutation.
Fig. 4. 8 individual PCR products from heterozygous samples each carrying one mutation were each subjected to 15 probe extension reactions with all biotinylated probes followed by chemiluminometric assay. Only probes that perfectly hybridize to the amplicons are extended and the RLU measured for individual amplicons with each probe is shown.
K. Glynou et al. / Clinical Biochemistry 41 (2008) 335–342
of exon 2. Although both primers were extended in the PE reaction of this individual amplicon, when products of the multiplex PCR were used as templates only the primer which was perfectly hybridized was extended. This was attributed to the different amount of PCR products used as substrate in the PE reaction. The concentration of each amplicon of the multiplex PCR is reduced compared to the concentration of the corresponding single PCR, so when the template is limited the specific extension is favoured. The RLU generated for each individual amplicon with each of the 15 biotinylated primers are shown in Fig. 4. The annealing temperature of the probes to the PCR product was studied in the range of 54–65 °C to select the temperature at which the extension of the non-complementary probe would be insignificant. The annealing temperature of 60 °C gave the highest N/M ratios for a normal sample. The incubation time needed for streptavidin to bind the biotinylated PE products, as well as the time needed for the binding of the anti-F-HRP to the F-dCTP that had been
339
Table 2 Patient genotypes analyzed in a blinded study Genotype
Number of samples studied
Heterozygous C858A Heterozygous C939A Heterozygous G1285A Homozygous G1285A Heterozygous T1352C Heterozygous G1646A Homozygous G1646A Heterozygous G1775A Heterozygous C/T81G Normal
36 2 28 3 1 40 1 4 3 1
introduced to the PE product were studied in the range of 10– 30 min, by analysing a normal sample for all mutations. At increased incubation times the RLU signals for the wild type probe increased, while the ratio N/M decreased because of the rise of the signals for the mutant probes. The incubation time needed for streptavidin–biotin binding was 10 min, while for the antibody–antigen binding 20 min were necessary in order to obtain the maximum N/M ratios. The effect of incubation time on the signal for the N probe and on the N/M ratio for the mutation G1646A is presented in Fig. 5. The effect was the same for the remaining 6 mutations. Patient study
Fig. 5. Effect of incubation time of each stage of the chemiluminometric assay on the signal of the N probe and the N/M ratio for mutation G1646A. A. Incubation time for binding of biotinylated PE products to streptavidin wells. B. Incubation time for binding of anti-F-HRP to the F-dCTP introduced to the PE product.
The method was developed for the detection of 7 LDLR mutations in the Greek population. Initial experiments to optimise the method were performed using 42 samples with known genotypes. Old DNA samples that had been freeze– thawed repeatedly gave no PCR products or faint products that failed to give a signal over blank measurement N 10 (S/B). Following the optimisations, 118 DNA samples from patients with a clinical diagnosis of FH and a normal sample (without LDLR mutations) were analysed by the proposed assay in a blind study. Genotypes of samples as well as the number of samples of each genotype analysed are shown in Table 2. 113 samples were genotyped on the first attempt, while the remaining 6 samples required repetition. Specifically, 2 samples failed because the signals for one mutation were less than 10 times the blank measurement and 4 samples failed because one or more mutations were in the gray zone. The above 6 samples were reanalysed and correctly genotyped on the second attempt. All 119 samples, corresponding to 833 genotypings, were in full concordance with mutation detection using other methods. For mutations G1646A, G1285A, and C858A the results of the present study were compared to analysis of LDLR mutations by use of the NanoChip® microelectronic array technology [34]. For mutation C939A, genotyping was compared to single-strand conformation polymorphism analysis (SSCP) followed by allele-specific oligonucleotide hybridization [4]. For G1775A, T1352C, C81G, and T81G genotypings were compared to sequencing results. According to the SNP database, nucleotide 81 of exon 2 has a single nucleotide polymorphism (SNP) with 2 possible wildtype alleles (C or T). In addition, the mutant 81G allele has been
340
K. Glynou et al. / Clinical Biochemistry 41 (2008) 335–342
Fig. 6. Genotyping of samples according to the N/M ratios. N/M ratio is plotted versus the number of the sample. N/M ratios range between 0.5–4 for heterozygous samples, greater than 10 in normal samples and lower than 0.1 in homozygous samples.
reported in the Greek population [7,9] as well as other populations. In the present study, the assay detects both the C/ T SNPs as well the 81G mutation. If, for example, the method detected only the T and G alleles, then in the case of a sample with a wild-type C allele and a mutant G allele, the biotinylated primer with T at the 3′ end would not be extended and the diagnosis would falsely be homozygous for the mutant G allele. Similarly, in the case of a sample with 2 wild-type C alleles, the assay would seem to fail giving S/B less than 10. Out of the 119 samples analysed, 3 samples were heterozygous for mutation 81G (2 genotypes were C/G and 1 was T/G). In the remaining 116 samples which were wild-type at position 81, we detected 213 wild-type C alleles and 19 wild-type T alleles (19 genotypes were C/T and 97 were C/C). The number of homozygous samples available for the study was limited (frequency of homozygous FH is 1:1,000,000), especially for the less common mutations for which homozygotes were not available. Also, only one compound heterozygous sample was found. However, the described assay as shown in Fig. 6 was able to discriminate between the 3 genotypes, wild-type, heterozygous and homozygous. Discussion In the present study we developed a method for the simultaneous genotyping of 7 mutations of the LDLR gene found in the Greek population. FH clinical diagnosis is based on family history and clinical phenotype, which does not always allow unequivocal diagnosis of FH in patients, especially children. Definitive diagnosis is only provided by mutation detection,
which is also important in prevention and early treatment during the asymptomatic stage of the disease since atherosclerosis begins in childhood. Although, the FH-causing mutations in Greek patients present a low heterogeneity compared to other European populations [4,9], there is a lack of high-throughput genotyping methods for routine use by molecular diagnostic laboratories. Most reports concerning Greek population present the characterization of the mutations [3–10] and only one [34] presents a diagnostic assay detecting the three most common mutations in Greece. The proposed method is composed of three steps (a) multiplex PCR to amplify the genomic regions of interest, (b) probe extension reaction of the amplified product in the presence of FdCTP and a DNA polymerase lacking 3′→5′ exonuclease activity, and (c) immobilization of the probe extension products in streptavidin-coated wells and chemiluminometric detection of the bound DNA. High specificity of the present method was achieved by optimizing the conditions of each step of the procedure. A multiplex PCR was optimised to produce 5 fragments of the LDLR gene, ranging in size from 200 bp to 616 bp. PCR primers were highly specific (Fig. 2), and were designed to bind at sites in the LDLR gene without polymorphisms, in order to exclude phenomena such as preferential amplification of one allele over the other, or allele drop-out, that would probably lead to misdiagnosis [37]. Following PCR the analysis proceeded with a few cycles of allele-specific probe extension without prior amplicon purification [35]. The biotinylated primers used in the PE reaction were
K. Glynou et al. / Clinical Biochemistry 41 (2008) 335–342
highly specific under the optimised reaction conditions, because each of the 8 PCR products reacted only with its designated primer (Fig. 4). Primer extension has been reported to be robust and to provide specific allele distinction [38] and this was observed in the present study by the clustering of the signal ratios from different samples, as well as the distance between the clusters for the different states of a given mutation (Fig. 6). The described method is rapid, requiring a total of 2 h to complete genotyping; 70 min for PCR, 10 min for PE and 40 min for detection. The use of preprepared lyophilized and dried reagents in a microtiter plate format makes the whole procedure easily executed by non experienced personnel. Microtiter plate format has been well established in many clinical laboratories, making the proposed assay practical and advantageous over microarrays that are currently being used mainly for research purposes. Microarrays are ideal for the detection of a large number of mutations in a few patients or for the detection of few mutations in many patients. The latter approach is useful for the Greek population but is only applicable in large hospital laboratory centers with an analogous work flow and experienced personnel. Chemiluminometric genotyping assays have already proven very useful in the genotyping of 15 HBB mutations responsible for causing beta-thalassaemia, another common monogenic disorder [35]. 119 patient DNA samples were analysed by the proposed method for 7 mutations of the LDLR gene responsible for causing familial hypercholesterolemia. Although each sample could be analysed in duplicate on two different primer extension and streptavidin microtiter plates in order to avoid miscalls due to mishandling during the assay, this is not recommended because of the higher cost and greater time of analysis. Instead, criteria for accepting a sample have been defined (S/B N 10). In addition, genotyping results should be evaluated in the light of clinical findings. Those samples that did not meet these criteria were reanalysed. After reanalysis of 6 samples that either failed to give S/B N 10 for one or more mutations or fell in the gray zones, the results for 833 SNP calls were in full agreement with either Nanochip microelectronic analysis or sequencing. The 7 mutations detected in the present study account for at least 50% of the mutations found in the Greek population. It is not possible to provide a more accurate estimate because a limited number of Greek patients have been screened for LDLR mutations. According to a representative sample of Greek FH heterozygotes, G1646A, G1285A, C939A, and C858A account for 51% of cases with the FH phenotype [4]. However, mutations G1775A, T1352C, and T/C81G were not part of the aforementioned study. The latter mutations were detected in Northwestern Greece [7], while G1775A and 81G were also detected in other Greeks [9]. A more systematic study is required to establish the molecular basis of FH in Greeks, as well as the overall frequency and geographical distribution of the LDLR mutations. Such a study could be accomplished by a combination of sequencing and of microarrays extended to cover not only the 3 most common mutations but also less common ones. Our system is suitable for routine use in the clinical laboratory, especially since the required instrumentation is affordable even for medium-sized laboratories as opposed to
341
the initial costly investment required for the Nanochip microelectronic array system (only one is available in Greece). In conclusion, we have developed a chemiluminometric method for the detection of mutations causing familial hypercholesterolemia. A diagnostic reagent set based on the proposed method has been manufactured and is accompanied by software that calculates the N/M ratios for each mutation immediately following measurement. The ratio provides the characterisation normal, heterozygous or homozygous for each single mutation detected. Additional LDLR mutations (occurring in the Greek population or in others) could be included in a different version of the assay by simply adding to the multiplex PCR additional regions of interest and by designing biotinylated primers for the primer extension reaction. This expansion will be enabled by PCR plates and microtiter plates of 384 wells, as well as by pipetting stations that facilitate automation of microtiter well-based assays. Acknowledgments The authors thank Dr. M.A. Carioulou and Dr. S. Xenophontos from the Molecular Genetics Department B and the Laboratory of Forensic Genetics at the Cyprus Institute of Neurology and Genetics for providing the heterozygous 1352 sample. References [1] Goldstein JL, Hobbs HH, Brown MS. Familial hypercholesterolemia. In: Scriver CR, Beaudet AL, Sly WS, Valle D, editors. The Metabolic and Molecular Bases of Inherited Disease. 8th ed. New York: McGraw Hill; 1995. p. 1981–2030. [2] Villeger L, Abifadel M, Allard D, Rabes JP, Thiart R, Kotze MJ, et al. The UMD-LDLR database: additions to the software and 490 new entries to the database. Hum Mutat 2002;20:81–7. [3] Mavroidis N, Traeger-Synodinos J, Kanavakis E, Drogari E, Matsaniotis N, Humphries SE, et al. A high incidence of mutations in exon 6 of the low-density lipoprotein receptor gene in Greek familial hypercholesterolemia patients, including a novel mutation. Hum Mutat 1997;9:274–6. [4] Traeger-Synodinos J, Mavroidis N, Kanavakis E, Drogari E, Humphries SE, Day INM, et al. Analysis of low density lipoprotein receptor gene mutations and microsatellite haplotypes in Greek FH heterozygous children: six independent ancestors account for 60% of probands. Hum Genet 1998;102:343–7. [5] Miltiadous G, Elisaf M, Xenophontos S, Manoli P, Cariolou MA. Segregation of a novel LDLR gene mutation (I430T) with familial hypercholesterolaemia in a Greek pedigree. Hum Mutat 2000;16:277. [6] Xenophontos SL, Pierides A, Demetriou K, Avraamides P, Manoli P, Ayton N, et al. Geographical clustering of low density lipoprotein receptor gene mutations (C292X; Q363X; D365E & C660X) in Cyprus. Hum Mutat 2000;15:380. [7] Miltiadous G, Elisaf M, Bairaktari H, Xenophontos SL, Manoli P, Cariolou MA. Characterization and geographic distribution of the low density lipoprotein receptor (LDLR) gene mutations in northwestern Greece. Hum Mutat 2001;17:432–3. [8] Dedoussis GV, Pitsavos C, Kelberman D, Skoumas J, Prassa ME, Choumerianou DM, et al. FH-Pyrgos: a novel mutation in the promoter (−45delT) of the low-density lipoprotein receptor gene associated with familial hypercholesterolemia. Clin Genet 2003;64:414–9. [9] Dedoussis GV, Genschel J, Bochow B, Pitsavos C, Skoumas J, Prassa M, et al. Molecular characterization of familial hypercholesterolemia in German and Greek patients. Hum Mutat 2004;23:285–6. [10] Dedoussis GV, Skoumas J, Pitsavos C, et al. FH clinical phenotype in Greek patients with LDL-R defective vs. negative mutations. Eur J Clin Invest 2004;34:402–9.
342
K. Glynou et al. / Clinical Biochemistry 41 (2008) 335–342
[11] Leonard JV, Whitelaw AG, Wolff OH, Lloyd JK, Slack J. Diagnosing familial hypercholesterolaemia in childhood by measuring serum cholesterol. Br Med J 1977;1:1566–8. [12] Kwiterovich Jr PO, Fredrickson DS, Levy RI. Familial hypercholesterolemia (one form of familial type II hyperlipoproteinemia). A study of its biochemical, genetic and clinical presentation in childhood. J Clin Invest 1974;53:1237–49. [13] Kastelein JJ. Screening for familial hypercholesterolaemia. Effective, safe treatments and DNA testing make screening attractive [Editorial]. BMJ 2000;321(7275):1483–4. [14] Sudhof TC, Goldstein JL, Brown MS, Russell DW. The LDL receptor gene: a mosaic of exons shared with different proteins. Science 1985;228: 815–22. [15] Humphries SE, Gudnason V, Whittall R, Day IN. Single-strand conformation polymorphism analysis with high throughput modifications, and its use in mutation detection in familial hypercholesterolemia. International Federation of Clinical Chemistry Scientific Division: Committee on Molecular Biology Techniques. Clin Chem 1997;43: 427–35. [16] Whittall R, Gudnason V, Weavind GP, Day LB, Humphries SE, Day IN. Utilities for high throughput use of the single strand conformational polymorphism method: screening of 791 patients with familial hypercholesterolaemia for mutations in exon 3 of the low density lipoprotein receptor gene. J Med Genet 1995;32:509–15. [17] Reshef A, Nissen H, Triger L, Hensen TS, Eliav O, Schurr D, et al. Molecular genetics of familial hypercholesterolemia in Israel. Hum Genet 1996;98:581–6. [18] Day IN, Whittall RA, O'Dell SD, et al. Spectrum of LDL receptor gene mutations in heterozygous familial hypercholesterolemia. Hum Mutat 1997;10:116–27. [19] Nissen H, Guldberg P, Hansen AB, Petersen NE, Horder M. Clinically applicable mutation screening in familial hypercholesterolemia. Hum Mutat 1996;8:168–77. [20] Ekstrom U, Abrahamson M, Sveger T, Lombardi P, Nilsson-Ehle P. An efficient screening procedure detecting six novel mutations in the LDL receptor gene in Swedish children with hypercholesterolemia. Hum Genet 1995;96:147–50. [21] Bodamer OA, Bercovich D, Schlabach M, Ballantyne C, Zoch D, Beaudet AL. Use of denaturing HPLC to provide efficient detection of mutations causing familial hypercholesterolemia. Clin Chem 2002;48:1913–8. [22] Naoumova RP, Neuwirth C, Pottinger B, Whittal R, Humphries SE, Soutar AK. Genetic diagnosis of familial hypercholesterolaemia: a mutation and a rare non-pathogenic amino acid variant in the same family. Atherosclerosis 2004;174:67–71. [23] Liguori R, Argiriou A, Simone VD. A rapid method for detecting mutations of the human LDL receptor gene by complete cDNA sequencing. Mol Cell Probes 2003;17:15–20. [24] Sozen M, Whittall R, Humphries SE. Mutation detection in patients with familial hypercholesterolaemia using heteroduplex and single strand
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33]
[34]
[35]
[36]
[37] [38]
conformation polymorphism analysis by capillary electrophoresis. Atheroscler Suppl 2004;5:7–11. Alharbi KK, Aldahmesh MA, Spanakis E, Haddad L, Whittall RA, Chen XH, et al. Mutation scanning by meltMADGE: validations using BRCA1 and LDLR, and demonstration of the potential to identify severe, moderate, silent, rare, and paucimorphic mutations in the general population. Genome Res 2005;15:967–77. Heath KE, Humphries SE, Middleton-Price H, Boxer M. A molecular genetic service for diagnosing individuals with familial hypercholesterolaemia (FH) in the United Kingdom. Eur J Hum Genet 2001;9:244–52. Fouchier SW, Defesche JC, Umans-Eckenhausen MW, Kastelein JP. The molecular basis of familial hypercholesterolemia in The Netherlands. Hum Genet 2001;109:602–15. Umans-Eckenhausen MA, Defesche JC, Sijbrands EJ, Scheerder RL, Kastelein JJ. Review of first 5 years of screening for familial hypercholesterolaemia in the Netherlands. Lancet 2001;357(9251):165–8. Umans-Eckenhausen MA, Sijbrands EJ, Kastelein JJ, Defesche JC. Low-density lipoprotein receptor gene mutations and cardiovascular risk in a large genetic cascade screening population. Circulation 2002;106:3031–6. Fouchier SW, Kastelein JP, Defesche JC. Update of the molecular basis of familial hypercholesterolemia in the Netherlands. Hum Mutat 2005;26: 550–6. Tejedor D, Castillo S, Mozas P, Jimenez E, Lopez M, Tejedor MT, et al. Reliable low-density DNA array based on allele-specific probes for detection of 118 mutations causing familial hypercholesterolemia. Clin Chem 2005;51:1137–44. Leitersdorf E, Tobin EJ, Davignon J, Hobbs HH. Common low-density lipoprotein receptor mutations in the French Canadian population. J Clin Invest 1990;85:1014–23. Kotze MJ, Langenhoven E, Warnich L, du Plessis L, Retief AE. The molecular basis and diagnosis of familial hypercholesterolaemia in South African Afrikaners. Ann Hum Genet 1991;55:115–21. Laios E, Drogari E. Analysis of LDLR mutations in familial hypercholesterolemia patients in Greece by use of the NanoChip microelectronic array technology. Clin Chim Acta 2006;374:93–9. Glynou K, Kastanis P, Boukouvala S, Tsaoussis V, Ioannou PC, Christopoulos TK, et al. High-throughput microtiter well-based chemiluminometric genotyping of 15 HBB gene mutations in a dry-reagent format. Clin Chem 2007;53:384–91. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16 (3):1215. Laios E, Glynou K. Allelic drop-out in the LDLR gene affects mutation detection in familial hypercholesterolemia. Clin Biochem 2008;41:38–40. Syvanen AC. Accessing genetic variation: genotyping single nucleotide polymorphisms. Nat Genet Rev 2001;2:930–42.
Clinical Biochemistry 41 (2008) 335 – 342
Development of a universal chemiluminometric genotyping method for high-throughput detection of 7 LDLR gene mutations in greek population Kyriaki Glynou a,⁎, Eleftheria Laios b , Euridiki Drogari b , Vassilis Tsaoussis a a
b
Medicon Hellas S.A., R&D Department, 5-7 Melitona St., Gerakas 15344, Greece Unit of Metabolic Diseases, Choremio Research Laboratory, University of Athens, 1st Department of Pediatrics, “Aghia Sophia” Children's Hospital, Athens 11527, Greece Received 26 July 2007; received in revised form 12 December 2007; accepted 12 December 2007 Available online 3 January 2008
Abstract Objectives: Familial hypercholesterolemia (FH) is caused by mutations in the LDL receptor (LDLR) gene. We report the application of a universal method with high allele discrimination properties to the simultaneous genotyping of 7 LDLR mutations in Greeks, in dry-reagent format. Design and methods: We genotyped mutations C858A, C939A, G1285A, T1352C, G1646A, G1775A, C/T81G. Unpurified amplicons from a multiplex PCR that produced fragments encompassing all 7 mutations were subjected to probe extension reactions in the presence of fluoresceinmodified dCTP, and a microtiter well-based assay of extension products with a peroxidase–antifluorescein conjugate and a chemiluminogenic substrate. We used lyophilized dry reagents and assigned genotypes by the signal ratio of normal-to-mutant-specific probe. Results: We standardized the method and optimised all steps for specificity. The method was validated by genotyping blindly 119 (833 genotypings). Results were fully concordant with other methods used as standards. Conclusions: This method is accurate, simple, rapid and robust. The microtiter well format allows genotyping of a large number of samples in parallel for several mutations. © 2007 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved. Keywords: Chemiluminometric genotyping; Mutation detection; Familial hypercholesterolemia; LDLR
Introduction Familial hypercholesterolemia (FH) is a monogenic autosomal dominant disorder characterized by elevated low density lipoprotein (LDL) cholesterol, tendon xanthomas, and premature coronary heart disease [1]. FH is caused by mutations in the LDL receptor (LDLR) gene, with more than 800 mutations known worldwide [2]. The frequency of heterozygous FH is 1:500 and 1:1,000,000 for homozygous FH. In Greeks and Greek-Cypriots, a total of 27 mutations have been reported [3– 10]. According to one representative study, six LDLR mutations account for 60% of cases while the three most common mutations account for 49% of cases [4]. Traditionally, FH clinical diagnosis is based on family history, elevated LDL cholesterol, and tendon xanthomas. A serious problem in clinical diagnosis is that absolute total or ⁎ Corresponding author. Fax: +30 2106 612 666. E-mail address: [email protected] (K. Glynou).
LDL cholesterol cut-off points cannot be applied. In addition, total and LDL cholesterol do not allow unequivocal diagnosis of FH in patients with borderline lipid profiles, and partial or early clinical features of FH, especially children [11–13]. Mutation detection provides the only definite diagnosis and is also important in prevention and early treatment during the asymptomatic stage of the disease since atherosclerosis begins in childhood. Although the ability to perform DNA genotyping of the LDLR gene has become an important requirement, not many diagnostic assays exist, mainly because of the size of the LDLR gene which spans 45 kb and contains 18 exons [14]. Molecular diagnosis is currently accomplished by two approaches: screening of the LDLR gene for any possible mutations or screening of the gene for specific reported mutations. The former is useful in heterogeneous populations and may be accomplished using single-strand conformation polymorphism (SSCP) analysis [15–18], denaturing gradient gel electrophoresis (DGGE) [19,20], and denaturing HPLC [21,22]. More recently developed methods include sequencing of the LDLR
0009-9120/$ - see front matter © 2007 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved. doi:10.1016/j.clinbiochem.2007.12.016
336
K. Glynou et al. / Clinical Biochemistry 41 (2008) 335–342
cDNA region [23], a SSCP/heteroduplex method followed by capillary electrophoresis [24], and melt-microplate array diagonal gel electrophoresis [25]. Some of the above methods have been applied to genetic screening in heterogeneous populations [26] as has sequencing [27–30]. The second approach in molecular diagnosis of FH involves detection of specific reported mutations known to occur in a particular population. For example, in Spain, a DNA array for identification of 117 known LDLR mutations was recently developed [31]. Diagnosis is even simpler in populations in which a limited number of mutations (1 to 3) is responsible for a large percentage of cases [32,33]. Accordingly, since a small number of mutations are found in Greece, a strategy tailored to specific mutations is more efficient than screening the entire gene. Recently, a method to detect the three most common mutations using the NanoChip® microelectronic array technology system was developed [34]. In this study we developed a rapid and simple method for the simultaneous detection of 7 LDLR mutations in the Greek population that uses microtiter wells which are already adopted by clinical laboratories and requires only 70 min for completion. The method comprises (a) a multiplex PCR to simultaneously amplify 5 fragments spanning all 7 mutations of the LDLR gene (b) a probe extension (PE) reaction of the amplified products in the presence of a fluorescein-modified nucleotide, without prior purification of the PCR product and (c) detection of PE products on streptavidin-coated microtiter wells by use of a horseradish peroxidase (HRP)-labeled antifluorescein antibody in combination with a chemiluminogenic substrate, which provides high sensititvity of the whole assay thus allowing only 4 cycles of the PE reaction at previous step. The method was validated by analyzing 119 samples, corresponding to 833 genotypings. Materials and methods Instrumentation Lyophilization of PCR and PE reaction mixtures was carried out using the Lyophlex 0.8 lyophiliser from BOC Edwards. PCR amplification reactions were performed in either a 96-well GeneAmp® PCR system 9700 from Applied Biosystems or in the Mastercycler gradient from Eppendorf. PE reaction was also performed in the Mastercycler gradient. Microtiter well-based chemiluminometric genotyping assays were performed using the Stat Fax 2200 shaker and automated washer Stat Fax 2600 from Awareness Technology. Chemiluminescence measurements were carried out using the PhL microplate luminometer from Aureon Biosystems GmbH. A digital camera, Kodak DC 120 and the Gel Analyser Software were from Kodak. Materials All oligonucleotides, used as primers for amplification of the 5 regions of the LDLR gene, as well as biotinylated genotyping probes for PE reactions, were from ThermoElectron. The sequences of all oligonucleotides and their respective functions are given in Table 1. Deoxynucleotide triphosphates (dNTPs)
Table 1 Primers and biotinylated oligonucleotides used in PCR and probe extension reactions, respectively Name
Sequence (5′→3′)
Mutation detected
2_up 2_dn 6_up 6_dn 9_up 9_dn 11_up 11_dn 12_up 12_dn 858_N 858_M 939_N 939_M 1285_N 1285_M 1352_N 1352_M 1646_N 1646_M 1775_N 1775_M C81_N T81_N 81_M
GGGAATCAGACTGTTCCTGATCGGATG ACGTCTCCTGGGACTCATCAGAGCCA CAAGCAAACTGAGGCTCAGACACA CGCCCAGCATCGCTTCATTTTTT TGCAGGATGACACAAGGGGATGG CTCTGTCAAGCTGGGTGCTGAGGCA CCACCAGCTTCATGTACTGGACTGA ATTAGTCTGCCGTGGTGGCACGTGT CAGCACGTGACCTCTCCTTATCCA TGCATCTCGTACGTAAGCCACACCTC CCCAACAAGTTCAAGTGTCACAGC CCCAACAAGTTCAAGTGTCACAGA GGTCAGATGAACCCATCAAAGAGTGC GGTCAGATGAACCCATCAAAGAGTGA ACCTCCGTGTCCAGAGCGACCAC ACCTCCGTGTCCAGAGCGACCAT GGTCTGACCTGTCCCAGAGAATGAT GGTCTGACCTGTCCCAGAGAATGAC TCAAGAAAGGGGGCCTGAATGG TCAAGAAAGGGGGCCTGAATGA TCCAAGATGGTCTTCCGGTTGCCCC TCCAAGATGGTCTTCCGGTTGCCCT GGCACTGGAACTCGTTTCTTTCG GGCACTGGAACTCGTTTCTTTCA GGCACTGGAACTCGTTTCTTTCC
– – – – – – – – – – C858A C939A G1285A T1352C G1646A G1775A C/T81G
were from Promega. White, flat bottomed Maxisorp microtiter wells were from Nunc and streptavidin was from Roche. Tth DNA polymerase was purchased from Biotools, SmarTaq was from HyTest and Vent exo− DNA polymerase was from New England Biolabs. Fluorescein-ΟΒΕΑ-dCTP (F-dCTP) was from Millipore. Antifluorescein antibody conjugated to horseradish peroxidase (antiF-HRP) was from Biodesign and the chemiluminogenic substrate for horseradish peroxidase (CHMI) was obtained from BioFX. Samples 161 genomic DNA samples from individuals were included in this study. Blood collections were performed with informed oral consent of the participants. Genomic DNA was isolated by use of the QIAamp DNA Blood Mini Kit (Qiagen). Chemiluminometric genotyping by probe extension Polymerase chain reaction PCR mixture containing 3 mM MgCl2, 300 μM deoxynucleotide triphosphates, 5 pmol each of primers 2_up and 2_dn, 30 pmol of primers 6_up and 6_dn, 7.5 pmol of primers 9_up and 9_dn, 12 pmol of primers 11_up and 11_dn, 13.5 pmol of 12_up and 12_dn and stabilizers in a total volume of 20 μL, was lyophilized overnight. Lyophilized mixtures were reconstituted just before use by the addition of 30 μL of a solution containing DNA polymerase buffer, DNA polymerase and DNA template. After reconstitution the mixture contained 75 mM Tris–HCl (pH 9.0), 50 mM KCl, 20 mM (NH4)2SO4, 2 mM MgCl2,
K. Glynou et al. / Clinical Biochemistry 41 (2008) 335–342
337
Fig. 1. Schematic presentation of the LDLR gene and the relative positions of the mutation sites.
200 μM deoxynucleotide triphosphates, 2 U of thermostable Tth polymerase or SmarTaq polymerase, the primers, stabilisers and 100–300 ng template DNA. Amplification was carried out as follows: 1 cycle at 95 °C for 2 min, followed by 40 cycles at 95 °C for 10 s, 59 °C for 20 s and 72 °C for 20 s, and 1 final cycle at 72 °C for 5 min. Probe extension reaction Probe extension (PE) reaction mixture containing 5 μΜ dATP, 5 μΜ dTTP, 5 μΜ dGTP, 3.5 μΜ dCTP, 1.5 μΜ F-dCTP, 1.5 pmol biotinylated probe and stabilisers in a total volume of 10 μL was lyophilized overnight. The mixture was stored at 4 °C with desiccant and reconstituted just before use by the addition of a solution containing DNA polymerase buffer, Vent exo− DNA polymerase, and PCR-amplified product. The final mixture contained 75 mM Tris–HCl (pH 9.0), 50 mM KCl, 20 mM (NH4)2SO4, 2 mM MgCl2, except for the detection of G1646A mutation where the mixture contained 1.5 mM MgCl2, 5 μΜ dATP, 5 μΜ dTTP, 5 μΜ dGTP, 3.5 μΜ dCTP, 1.5 μΜ FdCTP, stabilisers, 1.5 pmol biotinylated probe, 0.5 U Vent exo− DNA polymerase and 1.5 μL of the PCR product (total volume 20 μL). The PE reactions were performed in a thermal cycler as follows: 1 cycle at 95 °C for 2 min followed by 4 cycles of denaturation at 95 °C for 20 s, annealing at 60 °C for 10 s and extension at 72 °C for 10 s. For each mutation, two PE reactions were performed, one using a probe complementary to the normal allele and the other with a probe complementary to the mutant allele. Probes were 5′-biotinylated whereas their 3′-end was complementary to the allelic nucleotide.
Fig. 2. Agarose gel (3%) electrophoresis of the products of multiplex PCR, followed by ethidium bromide staining. Lane 1 contains DNA ladder 50 bp, and lanes 2 and 3 contain amplicons produced from PCR reactions using Tth DNA polymerase and SmarTaq DNA polymerase, respectively. The lengths of PCR products are 200 bp, 251 bp, 363 bp, 414 bp and 616 bp.
Chemiluminometric assay of extension products and interpretation of results After the PE reaction was completed, 30 μL of wash buffer consisting of 100 mM Tris (pH 7.6), 150 mM NaCl and 1 mL/L Tween-20 were added to each PE product. A 50-μL aliquot of the PE reaction was transferred into streptavidin coated wells, prepared as previously reported [35], and the mixture was incubated at ambient temperature under gentle mechanical shaking for 10 min. The wells were washed three times with 300 μL wash buffer. Then, 50 μL of 0.11–0.22 mg/L antifluorescein-HRP diluted in wash buffer were added and the mixture was allowed to react for 20 min. The wells were washed as above and the activity of bound HRP was measured in the microplate luminometer by adding 50 μL chemiluminogenic
Fig. 3. Principle of probe extension reactions and the chemiluminometric detection of PE products. For each mutation two biotinylated probes are extended in two separate reactions. The 3′-end of the probes is complementary to the allelic nucleotide and only the probe which is perfectly hybridized to the PCR product will be extended by DNA polymerase leading to the incorporation of F-dCTP. Biotinylated PE products are captured onto streptavidin coated wells and horseradish peroxidase (HRP) labeled anti-fluorescein antibody (anti-F-HRP) is added. Anti-F-HRP binds only to the extended product. The activity of bound HRP is measured by adding a chemiluminogenic substrate.
338
K. Glynou et al. / Clinical Biochemistry 41 (2008) 335–342
Results
than when Tth was used. Under optimised conditions, 5 specific products of comparable intensity are generated with both polymerases (Fig. 2). Therefore both polymerases could be used. We chose Tth polymerase for the present study. Quality of template DNA affected the performance of PCR. DNA extracted using commercial kits (spin columns) and subsequently subjected to repeated freezing–thawing failed to amplify. Interestingly, DNA extracted more than 4 years ago using the salting-out procedure [36], gave all five amplicons with no loss of sensitivity of the multiplex amplification reaction. However, the quantity of DNA was not crucial for the amplification reaction, which was successful when the amount of template DNA ranged from 30 to 400 ng, while less than 30 ng or more than 400 ng has not been tested.
Polymerase chain reaction
Probe extension reaction/Chemiluminometric assay
Multiplex PCR produces 5 fragments of the LDLR gene, with sizes 200 bp, 251 bp, 363 bp, 414 bp and 616 bp. Each amplicon corresponds to a different exon carrying one or more of the mutations analysed (Fig. 1). PCR conditions and concentrations of the components were optimised in order to produce amplicons of comparable concentrations in the multiplex PCR. A common DNA polymerase (Tth polymerase) and a hot start type DNA polymerase (SmarTaq) were compared for their yield in PCR and for the formation of primer dimers. When SmarTaq was used less primer dimers were formed and as a consequence the PCR yield was slightly higher
The method described here, schematically presented in Fig. 3, was developed to detect 7 mutations in the LDLR gene in a single run. All probes used for the PE reactions were 5′-biotinylated to enable capture of PE products onto streptavidin-coated wells, and their 3′ end was complementary to the polymorphic nucleotide. PE probes were checked for their specificity by analyzing 8 individual PCR products amplified from heterozygous samples, each carrying one mutation. Primers were hybridized to the specific sequences and extended only in cases where the hybridization was perfect, except in the case of the primers used for the discrimination of the polymorphism C/T at nucleotide 81
substrate into each well and incubating under gentle shaking for 3 min at ambient temperature. Genotypes were assigned for each mutation by determining the signal ratio of specific to non specific probe extension reaction products. The signal ratio was calculated by dividing the Relative Luminescence Units (RLU) measured for the reaction of the probe (N) complementary to the wild type allele to the RLU measured for the reaction of the probe (M) complementary to the mutant allele. If N/M N 10 the sample was assigned as normal for the specific mutation, if N/M b 0.1 the sample was considered homozygous and if 0.5 b N/M b 4 the sample was considered heterozygous for the specific mutation.
Fig. 4. 8 individual PCR products from heterozygous samples each carrying one mutation were each subjected to 15 probe extension reactions with all biotinylated probes followed by chemiluminometric assay. Only probes that perfectly hybridize to the amplicons are extended and the RLU measured for individual amplicons with each probe is shown.
K. Glynou et al. / Clinical Biochemistry 41 (2008) 335–342
of exon 2. Although both primers were extended in the PE reaction of this individual amplicon, when products of the multiplex PCR were used as templates only the primer which was perfectly hybridized was extended. This was attributed to the different amount of PCR products used as substrate in the PE reaction. The concentration of each amplicon of the multiplex PCR is reduced compared to the concentration of the corresponding single PCR, so when the template is limited the specific extension is favoured. The RLU generated for each individual amplicon with each of the 15 biotinylated primers are shown in Fig. 4. The annealing temperature of the probes to the PCR product was studied in the range of 54–65 °C to select the temperature at which the extension of the non-complementary probe would be insignificant. The annealing temperature of 60 °C gave the highest N/M ratios for a normal sample. The incubation time needed for streptavidin to bind the biotinylated PE products, as well as the time needed for the binding of the anti-F-HRP to the F-dCTP that had been
339
Table 2 Patient genotypes analyzed in a blinded study Genotype
Number of samples studied
Heterozygous C858A Heterozygous C939A Heterozygous G1285A Homozygous G1285A Heterozygous T1352C Heterozygous G1646A Homozygous G1646A Heterozygous G1775A Heterozygous C/T81G Normal
36 2 28 3 1 40 1 4 3 1
introduced to the PE product were studied in the range of 10– 30 min, by analysing a normal sample for all mutations. At increased incubation times the RLU signals for the wild type probe increased, while the ratio N/M decreased because of the rise of the signals for the mutant probes. The incubation time needed for streptavidin–biotin binding was 10 min, while for the antibody–antigen binding 20 min were necessary in order to obtain the maximum N/M ratios. The effect of incubation time on the signal for the N probe and on the N/M ratio for the mutation G1646A is presented in Fig. 5. The effect was the same for the remaining 6 mutations. Patient study
Fig. 5. Effect of incubation time of each stage of the chemiluminometric assay on the signal of the N probe and the N/M ratio for mutation G1646A. A. Incubation time for binding of biotinylated PE products to streptavidin wells. B. Incubation time for binding of anti-F-HRP to the F-dCTP introduced to the PE product.
The method was developed for the detection of 7 LDLR mutations in the Greek population. Initial experiments to optimise the method were performed using 42 samples with known genotypes. Old DNA samples that had been freeze– thawed repeatedly gave no PCR products or faint products that failed to give a signal over blank measurement N 10 (S/B). Following the optimisations, 118 DNA samples from patients with a clinical diagnosis of FH and a normal sample (without LDLR mutations) were analysed by the proposed assay in a blind study. Genotypes of samples as well as the number of samples of each genotype analysed are shown in Table 2. 113 samples were genotyped on the first attempt, while the remaining 6 samples required repetition. Specifically, 2 samples failed because the signals for one mutation were less than 10 times the blank measurement and 4 samples failed because one or more mutations were in the gray zone. The above 6 samples were reanalysed and correctly genotyped on the second attempt. All 119 samples, corresponding to 833 genotypings, were in full concordance with mutation detection using other methods. For mutations G1646A, G1285A, and C858A the results of the present study were compared to analysis of LDLR mutations by use of the NanoChip® microelectronic array technology [34]. For mutation C939A, genotyping was compared to single-strand conformation polymorphism analysis (SSCP) followed by allele-specific oligonucleotide hybridization [4]. For G1775A, T1352C, C81G, and T81G genotypings were compared to sequencing results. According to the SNP database, nucleotide 81 of exon 2 has a single nucleotide polymorphism (SNP) with 2 possible wildtype alleles (C or T). In addition, the mutant 81G allele has been
340
K. Glynou et al. / Clinical Biochemistry 41 (2008) 335–342
Fig. 6. Genotyping of samples according to the N/M ratios. N/M ratio is plotted versus the number of the sample. N/M ratios range between 0.5–4 for heterozygous samples, greater than 10 in normal samples and lower than 0.1 in homozygous samples.
reported in the Greek population [7,9] as well as other populations. In the present study, the assay detects both the C/ T SNPs as well the 81G mutation. If, for example, the method detected only the T and G alleles, then in the case of a sample with a wild-type C allele and a mutant G allele, the biotinylated primer with T at the 3′ end would not be extended and the diagnosis would falsely be homozygous for the mutant G allele. Similarly, in the case of a sample with 2 wild-type C alleles, the assay would seem to fail giving S/B less than 10. Out of the 119 samples analysed, 3 samples were heterozygous for mutation 81G (2 genotypes were C/G and 1 was T/G). In the remaining 116 samples which were wild-type at position 81, we detected 213 wild-type C alleles and 19 wild-type T alleles (19 genotypes were C/T and 97 were C/C). The number of homozygous samples available for the study was limited (frequency of homozygous FH is 1:1,000,000), especially for the less common mutations for which homozygotes were not available. Also, only one compound heterozygous sample was found. However, the described assay as shown in Fig. 6 was able to discriminate between the 3 genotypes, wild-type, heterozygous and homozygous. Discussion In the present study we developed a method for the simultaneous genotyping of 7 mutations of the LDLR gene found in the Greek population. FH clinical diagnosis is based on family history and clinical phenotype, which does not always allow unequivocal diagnosis of FH in patients, especially children. Definitive diagnosis is only provided by mutation detection,
which is also important in prevention and early treatment during the asymptomatic stage of the disease since atherosclerosis begins in childhood. Although, the FH-causing mutations in Greek patients present a low heterogeneity compared to other European populations [4,9], there is a lack of high-throughput genotyping methods for routine use by molecular diagnostic laboratories. Most reports concerning Greek population present the characterization of the mutations [3–10] and only one [34] presents a diagnostic assay detecting the three most common mutations in Greece. The proposed method is composed of three steps (a) multiplex PCR to amplify the genomic regions of interest, (b) probe extension reaction of the amplified product in the presence of FdCTP and a DNA polymerase lacking 3′→5′ exonuclease activity, and (c) immobilization of the probe extension products in streptavidin-coated wells and chemiluminometric detection of the bound DNA. High specificity of the present method was achieved by optimizing the conditions of each step of the procedure. A multiplex PCR was optimised to produce 5 fragments of the LDLR gene, ranging in size from 200 bp to 616 bp. PCR primers were highly specific (Fig. 2), and were designed to bind at sites in the LDLR gene without polymorphisms, in order to exclude phenomena such as preferential amplification of one allele over the other, or allele drop-out, that would probably lead to misdiagnosis [37]. Following PCR the analysis proceeded with a few cycles of allele-specific probe extension without prior amplicon purification [35]. The biotinylated primers used in the PE reaction were
K. Glynou et al. / Clinical Biochemistry 41 (2008) 335–342
highly specific under the optimised reaction conditions, because each of the 8 PCR products reacted only with its designated primer (Fig. 4). Primer extension has been reported to be robust and to provide specific allele distinction [38] and this was observed in the present study by the clustering of the signal ratios from different samples, as well as the distance between the clusters for the different states of a given mutation (Fig. 6). The described method is rapid, requiring a total of 2 h to complete genotyping; 70 min for PCR, 10 min for PE and 40 min for detection. The use of preprepared lyophilized and dried reagents in a microtiter plate format makes the whole procedure easily executed by non experienced personnel. Microtiter plate format has been well established in many clinical laboratories, making the proposed assay practical and advantageous over microarrays that are currently being used mainly for research purposes. Microarrays are ideal for the detection of a large number of mutations in a few patients or for the detection of few mutations in many patients. The latter approach is useful for the Greek population but is only applicable in large hospital laboratory centers with an analogous work flow and experienced personnel. Chemiluminometric genotyping assays have already proven very useful in the genotyping of 15 HBB mutations responsible for causing beta-thalassaemia, another common monogenic disorder [35]. 119 patient DNA samples were analysed by the proposed method for 7 mutations of the LDLR gene responsible for causing familial hypercholesterolemia. Although each sample could be analysed in duplicate on two different primer extension and streptavidin microtiter plates in order to avoid miscalls due to mishandling during the assay, this is not recommended because of the higher cost and greater time of analysis. Instead, criteria for accepting a sample have been defined (S/B N 10). In addition, genotyping results should be evaluated in the light of clinical findings. Those samples that did not meet these criteria were reanalysed. After reanalysis of 6 samples that either failed to give S/B N 10 for one or more mutations or fell in the gray zones, the results for 833 SNP calls were in full agreement with either Nanochip microelectronic analysis or sequencing. The 7 mutations detected in the present study account for at least 50% of the mutations found in the Greek population. It is not possible to provide a more accurate estimate because a limited number of Greek patients have been screened for LDLR mutations. According to a representative sample of Greek FH heterozygotes, G1646A, G1285A, C939A, and C858A account for 51% of cases with the FH phenotype [4]. However, mutations G1775A, T1352C, and T/C81G were not part of the aforementioned study. The latter mutations were detected in Northwestern Greece [7], while G1775A and 81G were also detected in other Greeks [9]. A more systematic study is required to establish the molecular basis of FH in Greeks, as well as the overall frequency and geographical distribution of the LDLR mutations. Such a study could be accomplished by a combination of sequencing and of microarrays extended to cover not only the 3 most common mutations but also less common ones. Our system is suitable for routine use in the clinical laboratory, especially since the required instrumentation is affordable even for medium-sized laboratories as opposed to
341
the initial costly investment required for the Nanochip microelectronic array system (only one is available in Greece). In conclusion, we have developed a chemiluminometric method for the detection of mutations causing familial hypercholesterolemia. A diagnostic reagent set based on the proposed method has been manufactured and is accompanied by software that calculates the N/M ratios for each mutation immediately following measurement. The ratio provides the characterisation normal, heterozygous or homozygous for each single mutation detected. Additional LDLR mutations (occurring in the Greek population or in others) could be included in a different version of the assay by simply adding to the multiplex PCR additional regions of interest and by designing biotinylated primers for the primer extension reaction. This expansion will be enabled by PCR plates and microtiter plates of 384 wells, as well as by pipetting stations that facilitate automation of microtiter well-based assays. Acknowledgments The authors thank Dr. M.A. Carioulou and Dr. S. Xenophontos from the Molecular Genetics Department B and the Laboratory of Forensic Genetics at the Cyprus Institute of Neurology and Genetics for providing the heterozygous 1352 sample. References [1] Goldstein JL, Hobbs HH, Brown MS. Familial hypercholesterolemia. In: Scriver CR, Beaudet AL, Sly WS, Valle D, editors. The Metabolic and Molecular Bases of Inherited Disease. 8th ed. New York: McGraw Hill; 1995. p. 1981–2030. [2] Villeger L, Abifadel M, Allard D, Rabes JP, Thiart R, Kotze MJ, et al. The UMD-LDLR database: additions to the software and 490 new entries to the database. Hum Mutat 2002;20:81–7. [3] Mavroidis N, Traeger-Synodinos J, Kanavakis E, Drogari E, Matsaniotis N, Humphries SE, et al. A high incidence of mutations in exon 6 of the low-density lipoprotein receptor gene in Greek familial hypercholesterolemia patients, including a novel mutation. Hum Mutat 1997;9:274–6. [4] Traeger-Synodinos J, Mavroidis N, Kanavakis E, Drogari E, Humphries SE, Day INM, et al. Analysis of low density lipoprotein receptor gene mutations and microsatellite haplotypes in Greek FH heterozygous children: six independent ancestors account for 60% of probands. Hum Genet 1998;102:343–7. [5] Miltiadous G, Elisaf M, Xenophontos S, Manoli P, Cariolou MA. Segregation of a novel LDLR gene mutation (I430T) with familial hypercholesterolaemia in a Greek pedigree. Hum Mutat 2000;16:277. [6] Xenophontos SL, Pierides A, Demetriou K, Avraamides P, Manoli P, Ayton N, et al. Geographical clustering of low density lipoprotein receptor gene mutations (C292X; Q363X; D365E & C660X) in Cyprus. Hum Mutat 2000;15:380. [7] Miltiadous G, Elisaf M, Bairaktari H, Xenophontos SL, Manoli P, Cariolou MA. Characterization and geographic distribution of the low density lipoprotein receptor (LDLR) gene mutations in northwestern Greece. Hum Mutat 2001;17:432–3. [8] Dedoussis GV, Pitsavos C, Kelberman D, Skoumas J, Prassa ME, Choumerianou DM, et al. FH-Pyrgos: a novel mutation in the promoter (−45delT) of the low-density lipoprotein receptor gene associated with familial hypercholesterolemia. Clin Genet 2003;64:414–9. [9] Dedoussis GV, Genschel J, Bochow B, Pitsavos C, Skoumas J, Prassa M, et al. Molecular characterization of familial hypercholesterolemia in German and Greek patients. Hum Mutat 2004;23:285–6. [10] Dedoussis GV, Skoumas J, Pitsavos C, et al. FH clinical phenotype in Greek patients with LDL-R defective vs. negative mutations. Eur J Clin Invest 2004;34:402–9.
342
K. Glynou et al. / Clinical Biochemistry 41 (2008) 335–342
[11] Leonard JV, Whitelaw AG, Wolff OH, Lloyd JK, Slack J. Diagnosing familial hypercholesterolaemia in childhood by measuring serum cholesterol. Br Med J 1977;1:1566–8. [12] Kwiterovich Jr PO, Fredrickson DS, Levy RI. Familial hypercholesterolemia (one form of familial type II hyperlipoproteinemia). A study of its biochemical, genetic and clinical presentation in childhood. J Clin Invest 1974;53:1237–49. [13] Kastelein JJ. Screening for familial hypercholesterolaemia. Effective, safe treatments and DNA testing make screening attractive [Editorial]. BMJ 2000;321(7275):1483–4. [14] Sudhof TC, Goldstein JL, Brown MS, Russell DW. The LDL receptor gene: a mosaic of exons shared with different proteins. Science 1985;228: 815–22. [15] Humphries SE, Gudnason V, Whittall R, Day IN. Single-strand conformation polymorphism analysis with high throughput modifications, and its use in mutation detection in familial hypercholesterolemia. International Federation of Clinical Chemistry Scientific Division: Committee on Molecular Biology Techniques. Clin Chem 1997;43: 427–35. [16] Whittall R, Gudnason V, Weavind GP, Day LB, Humphries SE, Day IN. Utilities for high throughput use of the single strand conformational polymorphism method: screening of 791 patients with familial hypercholesterolaemia for mutations in exon 3 of the low density lipoprotein receptor gene. J Med Genet 1995;32:509–15. [17] Reshef A, Nissen H, Triger L, Hensen TS, Eliav O, Schurr D, et al. Molecular genetics of familial hypercholesterolemia in Israel. Hum Genet 1996;98:581–6. [18] Day IN, Whittall RA, O'Dell SD, et al. Spectrum of LDL receptor gene mutations in heterozygous familial hypercholesterolemia. Hum Mutat 1997;10:116–27. [19] Nissen H, Guldberg P, Hansen AB, Petersen NE, Horder M. Clinically applicable mutation screening in familial hypercholesterolemia. Hum Mutat 1996;8:168–77. [20] Ekstrom U, Abrahamson M, Sveger T, Lombardi P, Nilsson-Ehle P. An efficient screening procedure detecting six novel mutations in the LDL receptor gene in Swedish children with hypercholesterolemia. Hum Genet 1995;96:147–50. [21] Bodamer OA, Bercovich D, Schlabach M, Ballantyne C, Zoch D, Beaudet AL. Use of denaturing HPLC to provide efficient detection of mutations causing familial hypercholesterolemia. Clin Chem 2002;48:1913–8. [22] Naoumova RP, Neuwirth C, Pottinger B, Whittal R, Humphries SE, Soutar AK. Genetic diagnosis of familial hypercholesterolaemia: a mutation and a rare non-pathogenic amino acid variant in the same family. Atherosclerosis 2004;174:67–71. [23] Liguori R, Argiriou A, Simone VD. A rapid method for detecting mutations of the human LDL receptor gene by complete cDNA sequencing. Mol Cell Probes 2003;17:15–20. [24] Sozen M, Whittall R, Humphries SE. Mutation detection in patients with familial hypercholesterolaemia using heteroduplex and single strand
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33]
[34]
[35]
[36]
[37] [38]
conformation polymorphism analysis by capillary electrophoresis. Atheroscler Suppl 2004;5:7–11. Alharbi KK, Aldahmesh MA, Spanakis E, Haddad L, Whittall RA, Chen XH, et al. Mutation scanning by meltMADGE: validations using BRCA1 and LDLR, and demonstration of the potential to identify severe, moderate, silent, rare, and paucimorphic mutations in the general population. Genome Res 2005;15:967–77. Heath KE, Humphries SE, Middleton-Price H, Boxer M. A molecular genetic service for diagnosing individuals with familial hypercholesterolaemia (FH) in the United Kingdom. Eur J Hum Genet 2001;9:244–52. Fouchier SW, Defesche JC, Umans-Eckenhausen MW, Kastelein JP. The molecular basis of familial hypercholesterolemia in The Netherlands. Hum Genet 2001;109:602–15. Umans-Eckenhausen MA, Defesche JC, Sijbrands EJ, Scheerder RL, Kastelein JJ. Review of first 5 years of screening for familial hypercholesterolaemia in the Netherlands. Lancet 2001;357(9251):165–8. Umans-Eckenhausen MA, Sijbrands EJ, Kastelein JJ, Defesche JC. Low-density lipoprotein receptor gene mutations and cardiovascular risk in a large genetic cascade screening population. Circulation 2002;106:3031–6. Fouchier SW, Kastelein JP, Defesche JC. Update of the molecular basis of familial hypercholesterolemia in the Netherlands. Hum Mutat 2005;26: 550–6. Tejedor D, Castillo S, Mozas P, Jimenez E, Lopez M, Tejedor MT, et al. Reliable low-density DNA array based on allele-specific probes for detection of 118 mutations causing familial hypercholesterolemia. Clin Chem 2005;51:1137–44. Leitersdorf E, Tobin EJ, Davignon J, Hobbs HH. Common low-density lipoprotein receptor mutations in the French Canadian population. J Clin Invest 1990;85:1014–23. Kotze MJ, Langenhoven E, Warnich L, du Plessis L, Retief AE. The molecular basis and diagnosis of familial hypercholesterolaemia in South African Afrikaners. Ann Hum Genet 1991;55:115–21. Laios E, Drogari E. Analysis of LDLR mutations in familial hypercholesterolemia patients in Greece by use of the NanoChip microelectronic array technology. Clin Chim Acta 2006;374:93–9. Glynou K, Kastanis P, Boukouvala S, Tsaoussis V, Ioannou PC, Christopoulos TK, et al. High-throughput microtiter well-based chemiluminometric genotyping of 15 HBB gene mutations in a dry-reagent format. Clin Chem 2007;53:384–91. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16 (3):1215. Laios E, Glynou K. Allelic drop-out in the LDLR gene affects mutation detection in familial hypercholesterolemia. Clin Biochem 2008;41:38–40. Syvanen AC. Accessing genetic variation: genotyping single nucleotide polymorphisms. Nat Genet Rev 2001;2:930–42.