Development of adaptive immunity in rainbow trout, Oncorhynchus mykiss (Walbaum) surviving an infection with Yersinia ruckeri

Fish & Shellfish Immunology 25 (2008) 533–541

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Development of adaptive immunity in rainbow trout, Oncorhynchus mykiss (Walbaum) surviving an infection with Yersinia ruckeri Martin K. Raida*, Kurt Buchmann Department of Veterinary Pathobiology, Section of Fish Diseases, Faculty of Life Sciences, The University of Copenhagen, Stigbøjlen 7, DK-1870 Frederiksberg C, Denmark

a r t i c l e i n f o

a b s t r a c t

Article history: Received 26 March 2008 Received in revised form 2 July 2008 Accepted 15 July 2008 Available online 23 July 2008

Development of adaptive immunity in rainbow trout (Oncorhynchus mykiss) surviving a primary infection with 5  105 CFU Yersinia ruckeri O1 (LD50 dose) was investigated by transcriptome analysis of spleen tissue. These fish surviving a primary infection showed also a significantly increased survival following a secondary infection (same dose) when compared to naı¨ve trout. The weight of the rainbow trout spleen doubled during the first 14 days of the primary infection but the affected organs subsequently recovered normal weight which remained constant during the re-infection period. Gene transcription in the spleen was measured using Quantitative real-time RT-PCR (qPCR). Samples taken 8 h.p.i., 1, 3, 7, 14 and 28 d.p.i. were compared to PBS-injected control fish sampled at the same time points. The investigated cytokines and chemokines comprised interleukin (IL)-1b, IL-1 receptor antagonist (Ra), IL-6, IL-8, IL-10, IL-11 and IFN-g, IL-1 receptor I and II (IL-RI and IL-RII). Transcript levels of genes encoding cytokines and receptors were increased during the primary infection but not during the secondary infection. Changes of T cell occurrence or activity in the spleen during the infections were inferred from the transcript level of T cell receptor (TCR), CD4 and CD8a genes. No alteration in the expression of MHC class ll and immunoglobulin (Ig)M and IgT was detected during the experiment. The amount of Y. ruckeri O1 in the spleen was measured with a Y. ruckeri 16S ribosomal RNA specific qPCR and this parameter was correlated to the expression of IL-1b, IL-8 and IL-10 genes with a peak expression at 3 d.p.i. (first infection). The low transcript levels of the bacterial gene and the hosts’ immune genes during the re-infection can be interpreted as a result of development of adaptive immunity. This would explain the relatively fast elimination of the bacteria during the secondary infection whereby the activation of cytokines becomes less pronounced. Ó 2008 Elsevier Ltd. All rights reserved.

Keywords: Immunity Rainbow trout Yersinia ruckeri qPCR Host–pathogen interaction Immune response Adaptive immunity

1. Introduction Yersinia ruckeri is the aetiological agent of enteric redmouth (ERM) disease or yersiniosis, affecting mainly salmonids [1,2]. Although generally well controlled by means of vaccination and antibiotic treatment, this disease has kept on causing outbreaks, especially in endemic areas. In some cases the losses due to this disease can be as high as 30–70% of the stock [3]. Protective immunity in rainbow trout against ERM has been known since the first commercial fish vaccines based on formalin killed bacteria were introduced [4]. Recently, transcription of genes encoding both innate and adaptive immune parameters in the spleen following vaccination has been described [5]. The spleen seems to represent a major secondary lymphoid organ in fish during bacterial infections. Thus, it has been reported that antigens are captured by immunocompetent cells at

* Corresponding author. Tel.: þ45 35332701; fax: þ45 5282742. E-mail address: [email protected] (M.K. Raida). 1050-4648/$ – see front matter Ó 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2008.07.008

inflammatory foci and then transported to the spleen for the initiation of adaptive immune responses [6]. In vaccinated rainbow trout, antigen trapping takes place in the walls of the splenic ellipsoids, which suggests a specific role for these cell clusters during development of immunity [7]. Further, during Y. ruckeri infection in rainbow trout a dramatic increase in spleen weight (up to threefold) has been observed and interpreted as a result of influx of cells recruited by inflammatory cytokines [8]. This complies with the fact that Y. ruckeri counts increase in spleen tissue after challenge [8,9], which is associated with migration of leukocytes from the anterior kidney to the blood and the spleen in rainbow trout during Y. ruckeri infection [9]. Likewise, expression of cytokines and chemokines was increased in the spleen during Y. ruckeri infection, indicating that the spleen is actively involved in rainbow trout immune responses against this pathogen [8,9] It is generally agreed that regulation of inflammation results from a balance between pro- and anti-inflammatory cytokines, which also will minimize the negative effects of the inflammatory processes [10]. However, the immediate activation of the innate immune response is an important event during induction of the

534

M.K. Raida, K. Buchmann / Fish & Shellfish Immunology 25 (2008) 533–541

adaptive response eventually leading to specific long-term protection [11]. Also in fish a strict regulation of these two immune branches is likely to produce an optimal immune response. The present work contributes to our understanding of the complex interactions between humoral and cellular factors in rainbow trout responding to primary and secondary Y. ruckeri infections. Due to the central role of the spleen in this process the investigation is based on a description of the expression of immune relevant genes in spleen tissue. The work emphasizes genes encoding cytokines, their antagonists, immunoglobulins and T cell markers and adds to the notion that these are central elements of the adaptive immune response in rainbow trout. 2. Materials and methods 2.1. Fish and rearing conditions Juvenile rainbow trout (Skinderup strain from Jutland, Denmark), hatched and reared under pathogen-free conditions (Danish Centre for Wild Salmon, Randers, Denmark), were brought to the experimental fish keeping facility at the University of Copenhagen when reaching a body weight of 4–6 g. The pathogen-free status of the fish was confirmed upon their arrival in the laboratory by analysis for bacterial, parasitic and viral pathogens. The 600 fish were kept in three 200 l tanks with bio-filters (Eheim, Germany) and maintained at a 12 h light and 12 h dark cycle in aerated (100% oxygen saturation) tap water at 13  C. They were fed a commercial trout feed (BioMar, Denmark) (2% biomass per day). 2.2. Bacterial strain Y. ruckeri serovar I (strain 392/2003), isolated from diseased rainbow trout in Spain [12], was used for the challenge experiments. The bacteria were grown in LB-medium (Oxoid LP0042, Tryptone 10 g, Oxoid LP0021Yeast-extract 5 g, NaCl 5 g, H2O to 1000 ml, pH 7.4) at 20  C for 36 h and enumerated as colony forming units (CFUs) by the spread plate method on blood agar (Blood agar base CM55 [Oxoid] supplemented with 5% bovine blood). 2.3. Primary and secondary challenge experiments Primary infection trials were conducted using a total of 400 rainbow trout, half of them were used as non-infected control fish. All fish were anaesthetized by immersion in 40 mg/l tricaine methane sulfonate (MS-222, Sigma–Aldrich, Denmark). Two hundred trout were infected by intra-peritoneal (ip.) injection (5  105 CFU/fish in 50 ml PBS) corresponding to a previously determined LD50 (data not shown). Two hundred non-infected control fish were injected with 50 ml sterile PBS. In the primary challenge experiment the infected fish received an ip. injection and were observed for 35 days. In the re-challenge experiment a total of 97 surviving fish from the primary challenge received an additional injection of 5  105 (CFU/fish) bacteria 35 days after the primary infection. When performing the re-challenge of the survivors, a group of 200 naı¨ve fish was infected as control to confirm virulence of the bacteria. The non-infected control fish were also reinjected with sterile PBS at day 35 post-primary injection. Bacterial samples from the head kidney from all fish that died were cultured on blood agar plates to confirm the cause of death. Mortalities were only considered to be caused by Y. ruckeri if the bacteria were recovered as pure culture from the head kidney. Relative percentage survival (RPS) was calculated using the following equation: RPS ¼ (1  (percent immune mortality/percent control mortality))  100 [13].

2.4. Detection of Y. ruckeri in blood Counts of Y. ruckeri in the blood of 5 ip. infected naı¨ve rainbow trout were taken 0, 1, 2, 3, 5 and 6 days post-infection. The fish were killed after blood sampling. Samples (10 ml blood) from each fish were plated onto blood agar in a 10-fold dilution series (in triplicate). 2.5. Sampling for gene expression studies Spleens from five infected and five control fish were sampled at 0, 8 h and 1, 3, 7, 14 and 28 d following infection (both primary and secondary challenges). No moribund fish were sampled for gene expression experiments. Fish were killed by immersion into an overdose of MS-222 (100 mg/l). Spleen tissue was sampled aseptically, immediately transferred to RNA-later (Sigma–Aldrich), prestored for 24 h at 4  C and subsequently stored at 20  C until isolation of RNA. When comparing groups for immunological parameters the infected fish and non-infected control fish sampled at the same time points were compared. A spleen size index was calculated as the ratio between spleen weight (g): body weight (g), for individual fish from day 7 in order to describe changes of spleen weight during infection. 2.6. Expression of Y. ruckeri-specific 16S ribosomal RNA gene in the spleen of rainbow trout A primer pair and a TaqMan probe were designed in an unconserved region of the Y. ruckeri partial 16S ribosomal RNA gene (Genbank accession number: X75275), which gives a specific amplification of Y. ruckeri strains only [14]. The amplicon is 70 bp long. Forward primer: 50 GCGAGGAGGAAGGGTTAAGTG30 , reverse primer: 50 GTTAGCCGGTGCTTCTTCTG30 , and the TaqMan probe: 50 AATAGCACTGAACATTGACGTTACTCG30 . 2.7. Isolation of total RNA and cDNA synthesis Homogenisation of tissue was done by sonication on ice (Sonicator Ultrasonic Liquid Processor Model XL 2020, heat Systems, New York, USA) and total RNA isolated using GenEluteÔ total RNA kit (Sigma–Aldrich, Denmark). Removal of genomic DNA was conducted with deoxyribonuclease I (Sigma–Aldrich). RNA quantity was checked by OD260/280 measurements (SmartSpecÔ 3000, BIO-RAD, USA). cDNA synthesis was performed on 400 ng total RNA in a 20 ml setup using TaqManÒ Reverse Transcription reagents following the manufacturer’s instructions (Applied Biosystems, USA). Random hexamer primers were used in the reverse transcription reactions. RT-reactions lacking reverse transcriptase (RT minus) but not RNA were also performed to verify that the samples did not contain genomic DNA. The synthesised cDNA samples were diluted 1:10 in MilliQ H2O and stored at 20  C. 2.8. Gene expression analysis Spleen samples were analyzed using qPCR for expression of genes encoding cytokines (IL-1b1, IL-1Ra, IL-6, IL-10, IL-11 and IFNg), chemokine IL-8, immunoglobulins (IgM, IgT) and cellular receptors (TCR, CD4, CD8a, MHC II and IL-1 receptor I and II). qPCR assays were performed using a Stratagene MX3000PTM real-time PCR system. Based on available GenBank (NCBI) sequences primers and dual-labelled TaqManÒ probes conjugated with 50 HEX, FAM or CY 50 and a 30 BHQ1 or BHQ2 were designed using Primer3 software (http://frodo.wi.mit.edu/). Primers and probes were analyzed for hairpin structure, self- and hetero-dimers in OligoAnalyzer 3.0 (http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/ Default.aspx?c¼EU). Primers and probes are listed in Table 1. All

M.K. Raida, K. Buchmann / Fish & Shellfish Immunology 25 (2008) 533–541

535

Table 1 Quantitative PCR (qPCR) expression of immune relevant genes in rainbow trout Gene

GenBank accession no.

Product size

Forward primer

Reverse primer

Probe

qPCR efficiency %

Cytokines IL-1b1 IL-1Ra IL-6 IL-8 IL-10 IL-11 IFN-g

AJ223954, AJ298294 AJ295296 DQ866150 AJ279069 AB118099 AJ 535687 AY795563

91 65 91 69 70 104 68

acattgccaacctcatcatcg aaggaggacaaggaggagga actcccctctgtcacacacc agaatgtcagccagccttgt cgactttaaatctcccatcgac gcaatctcttgcctccactc aagggctgtgatgtgtttctg

ttgagcaggtccttgtccttg cactccattgatcgtcagga ggcagacaggtcctccacta tctcagactcatcccctcagt gcattggacgatctctttcttc ttgtcacgtgctccagtttc tgtactgagcggcattactcc

catggagaggttaaagggtggc gccttcgccagtgaaggagaca ccactgtgctgatagggctgg ttgtgctcctggccctcctga catcggaaacatcttccacgagct tcgcggagtgtgaaaggcaga ttgatgggctggatgactttagga

99.7 98.7 104.7 104.8 101.7 98.6 102.4

Cell receptors CD8-a CD4 TcR IL-1RI IL-1RII MHC-II b

AF178054 AY973028 AF329700 AJ295296 AJ276474 AF115533

74 89 73 70 91 67

acaccaatgaccacaaccatagag cattagcctgggtggtcaat tcaccagcagactgagagtcc atcatcctgtcagcccagag ctcaatctgctctcggcatt tgccatgctgatgtgcag

gggtccacctttcccacttt ccctttctttgacagggaga aagctgacaatgcaggtgaatc tctggtgcagtggtaactgg gcggaggtagtcgtagtcca gtccctcagccaggtcact

accagctctacaactgccaagtcgtgc cagaagagagagctggatgtctccg ccaatgaatggcacaaaccagagaa tgcatcccctctacaccccaaa ttcatcgctcgctctgcctg cgcctatgacttctaccccaaacaaat

104.5 98.6 96.6 116.2 97.6 101.1

Immunoglobulins IgM IgT

S63348 AY870265

72 72

cttggcttgttgacgatgag agcaccagggtgaaacca

ggctagtggtgttgaattgg gcggtgggttcagagtca

tggagagaacgagcagttcagca agcaagacgacctccaaaacagaac

98.4 98.5

House-keeping gene Elongation factor 1a

AF498320

63

accctcctcttggtcgtttc

tgatgacaccaacagcaaca

gctgtgcgtgacatgaggca

100.0

Primers and probe sets including their accession number, product sizes, sequences and qPCR efficiency.

primers and probes were HPLC-purified (Sigma–Genosys Ltd., UK). The primers were optimized according to MgCl2 concentrations. Melting curve analysis of the primers was conducted with an SYBR Green based qPCR assay, to make sure that the primers did not form primer dimers. To assess that the primer and probe pairs were quantitative within the working range, serial dilutions in 10-fold increment of cDNA were used, and efficiency for the primer pairs was calculated (Table 1). The cycling conditions were one cycle of initial denaturation at 94  C for 2 min, followed by 40 cycles with denaturation at 94  C for 30 s and annealing and elongation in one step at 60  C for 1 min. Wells contained 6.25 ml of 2  JumpStartTM Taq ReadyMixTM, 3–6 mM MgCl2 (all chemicals from Sigma– Aldrich, Denmark), 0.5 ml forward and reverse primer (10 mM), 0.5 ml TaqManÒ probe (5 mM), 2.5 ml of diluted cDNA (1:10) and autoclaved MilliQ water to a volume of 12.5 ml. RT minus and negative controls (MilliQ water without template) were used for every plate setup. Several reference genes were validated in spleen tissue, namely bactin, Ribosomal protein S20 and Elongating factor 1-a (EF1-a). By comparing the expression results of the spleen tissues from infected and non-infected control fish, it was found that EF1-a was the most stably expressed gene between all individuals. EF1-a primers with corresponding probe were therefore used as endogenous control (reference or house-keeping gene) to correlate for potentially different loading amounts of RNA added to the RT-PCR reaction and for variation in cDNA synthesis efficiencies [15,16]. If the real-time curve did not reach the threshold within 40 cycles the sample was not considered for that particular gene. A high Ct value designates that the gene is expressed at a low level and one Ct value corresponds to a two-fold difference in gene expression. 2.9. Calculations and statistical analysis Results from the challenge experiments were analysed using the Kaplan–Meier test (GraphPad Prism 4, www.graphpad.com/ manuals/Prism4/PrismUsersGuide.pdf), which were used to analyse for differences in mortality between groups. 2.10. Data analysis of gene expression The threshold cycle (Ct) was determined at the linear slope in a log fluorescence/Ct plot. The expression results were analyzed

using the 2DDCt method [17]. Expression of all genes in fish injected with bacteria or PBS was expressed relative to the gene expression of the five unhandled fish sampled pre-injection which were used for calibration (mean expression ¼ 1) for each investigated gene. In order to describe the effects of infection on gene expression the normalized gene expression data (DDCt) for infected and PBS-injected control fish were compared to each other. Since data followed a normal distribution (Kolmogorov–Smirnoff’s test), Student’s t-test was used for testing differences in relative transcription level between the controls and infected fish at each sampling time. Correlations between expression of the Y. ruckeri specific 16S ribosomal RNA gene and expression of immune genes in the spleen of rainbow trout were analysed using the Spearman Rank Order correlation test. A significance level of 5% was applied in all tests. The data are presented as the mean value of fold increase/decrease from five fish at each sampling point post-injection. All statistical calculations were performed with GraphPad Prism 4 (GraphPad Software, Inc., San Diego, USA).

3. Results 3.1. Challenge experiment Each fish received an intra-peritoneal (ip.) injection with 5  105 CFU Y. ruckeri in 50 ml PBS. This dose was found to be the LD50 in a pilot experiment (data not shown) and was used for both the primary and the secondary challenge experiment. Pure Y. ruckeri cultures were re-isolated from head kidney of all infected fish which died in the challenge experiments. Control fish were injected with 50 ml PBS, and no mortality was observed during the experiment. During the primary infection, the survival of infected fry was significantly (p < 0.0001) (Fig. 1) lower than the non-infected control group (n ¼ 200). Survivors of the primary infection were re-infected ip. with the same dose (5  105 CFU/fish) on day 35, and a group of naı¨ve fish were infected as virulence control (to confirm that the virulence of the bacteria was the same as in the primary infection). The survival of re-infected fry was significantly (p ¼ 0.0009) lower than the non-infected control group. When comparing the survival in the primary infected versus the reinfected fry, the survival was significantly higher during the re-infection (p < 0.0001). During the 35 day period following the primary

536

M.K. Raida, K. Buchmann / Fish & Shellfish Immunology 25 (2008) 533–541

Fig. 1. Percent survival of Y. ruckeri infected and non-infected rainbow trout during primary and secondary infections. During the primary infection, the survival of infected fry was significantly (p < 0.0001) lower than the non-infected control group (n ¼ 200). Survivors of the primary infection were re-infected ip. with the same dose (5  105 CFU/fish) day 35, and a group of naı¨ve fish were infected as virulence control (to confirm the virulence of the bacterial broth). The survival of re-infected fry was significantly (p ¼ 0.0009) lower than the non-infected control group. When comparing the survival in the primary infected versus the re-infected fry, the survival was significantly higher during the re-infection (p < 0.0001).

infection 34% of the infected fish died. A total of 97 fish survived the primary infection and were re-challenged at day 35. During the reinfection only 7% of the previously infected fish died. The cumulative percent mortality (CPM) was determined after 28 days, and the RPS was 79%. 3.2. Re-isolation of pathogen Y. ruckeri was re-isolated from the head kidney of all fish which died during the challenge experiments. Dead fish exhibited external signs associated with ERM infection including petechial haemorrhages in the mouth, around the anus and at the base of the dorsal fins. 3.3. Detection of Y. ruckeri in the spleen The Y. ruckeri specific primer pair with corresponding TaqMan probe detected the presence of Y. ruckeri in the infected fish. The

bacteria were detectable 8 h.p.i. The Y. ruckeri gene transcripts increased rapidly and peaked on day 3 with more than a 21,000fold increase relative to the detection level. The amount of Y. ruckeri decreased from day 3 and at day 28 the infection was barely detectable (Fig. 2). The expression of Y. ruckeri was detectable 8 h.p.i. (re-infection) but decreased rapidly. Thus, Y. ruckeri was only detected in one out of five re-infected fish at day 3 and 7. This was also supported when agar culturing was conducted. By using this technique Y. ruckeri was re-isolated from the head kidney of 20% of the fish 28 days after the primary challenge, and in only 4% of the fish 28 days after the re-challenge. The spleen weight index (spleen weight/body weight) was twice as high in the infected fish as in the controls 7 and 14 d.p.i. during the primary infection. During the secondary infection no significant weight differences were found (Fig. 3). 3.4. Detection of Y. ruckeri in blood The presence of Y. ruckeri in the blood of infected trout was detected from 2 days after the primary infection (Fig. 4). More than 1 106 CFU/ml blood were detected in infected fish 6 d.p.i.. 3.5. Expression of investigated immune genes in the spleen of rainbow trout Low levels of constitutive expression of all examined genes in the spleen were detected in unhandled fish, but transcription of a range of genes was shown to be significantly regulated due to infection (Table 2). 3.6. Expression of the IL-1 family genes in the spleen of rainbow trout Genes encoding the pro-inflammatory cytokine IL-1b1, the antiinflammatory antagonist IL-1Ra and the IL-1 receptor type I (IL-1RI) and the IL-1 decoy receptor type II (IL-1RII) were investigated in the spleen tissue. A significantly increased gene expression of all the measured IL-1 family genes was detected in the infected rainbow

Fig. 2. Expression of a Y. ruckeri specific 16S sequence, in the spleen of rainbow trout (n ¼ 5) during primary and secondary ip. infection with 5  105 CFU/fish Y. ruckeri. The Y. ruckeri 16S transcript was significantly increased relative to controls day 3 and 7 after the primary infection.

M.K. Raida, K. Buchmann / Fish & Shellfish Immunology 25 (2008) 533–541

537

p < 0.0001). The expression of IL-1RI was also correlated to expression of IL-1RII (r ¼ 0.85, p < 0.0001). 3.7. Expression of other cytokine and chemokine genes in the spleen of rainbow trout

Fig. 3. The figure shows a spleen weight index (spleen weight/body weight) from uninfected and infected fish (n ¼ 5). The weight of the spleen was significantly increased 7 and 14 days pi. during the primary infection (p ¼ 0.03).

trout when compared to un-infected controls. The number of IL-1b transcripts was significantly increased in the infected fish compared to the non-infected control fish at 8 h.p.i., 1 and 3 d.p.i. The IL-1b expression peaked 3 d.p.i. with a 77.8-fold increase compared to PBS injected control fish. No differences in expression of IL-1b1 were seen at later time points. Expression of genes encoding IL-1RI and IL-1RII was significantly increased at 1 and 3 d.p.i. in the primary infected fish. Gene transcript numbers of both genes peaked on day 3 p.i. IL-1RI transcript was elevated 4.2and 6.9-fold, and IL-1RII was 3.4- and 17.4-fold increased at 1 and 3 d.p.i., respectively. No significant regulations were seen at later time points (Tables 2 and 3 and Fig. 5). The transcript of the IL-1 receptor antagonist (Ra) was significantly increased in all samples from the infected fish from 8 h.p.i. to 7 d.p.i. IL-1Ra expression peaked 3 d.p.i. Expression of IL-1Ra and the IL-1 receptor expression were correlated with the expression of IL-1b1 (IL-1Ra: r ¼ 0.69, p < 0.0001), (IL-1RI: r ¼ 0.69, p < 0.0001), (IL-1RII: r ¼ 0.79, p < 0.0001). Likewise, IL-1Ra also showed correlation to IL-1RI (r ¼ 0.50, p < 0.0001) and IL-1RII (r ¼ 0.59,

Gene transcripts encoding IL-6 and IL-11 were significantly upregulated in infected fish 1–3 d.p.i. (primary infection) (10.2 to 20.7 and 14.7- to 18.8-fold, respectively) (Table 2). The gene encoding the chemokine IL-8 was significantly upregulated during the primary infection from 8 h.p.i. to 14 d.p.i., peaking at 3 d.p.i. (Table 2). The number of IL-10 gene transcripts was 396.2-fold increased in the infected fish 3 d.p.i. (primary infection) (Table 2), and a minor down-regulation relative to the un-infected fish was seen 14 d.p.i. (re-infection) (Table 3). The IFN-g gene transcript level was increased 22.1-fold in the infected trout 3 d.p.i. (primary infection), and down-regulated relative to the un-infected control group 3 and 7 d.p.i. during the re-infection. The transcript of the T cell receptor gene was stable during the infections, but an increase in CD4 expression was seen 1–3 d.p.i. (2to 2.3-fold) (primary infection), and CD8a was 3.4-fold up-regulated 14 d.p.i. (re-infection). No significant changes in expression of genes encoding MHC II, IgM and IgT were seen during the infections (Tables 2 and 3). 4. Discussion The head kidney of teleosts is considered to be the major organ for the capture and clearance of bacteria due to the presence of resident macrophage populations [18], but it has been speculated that recruitment and activation of lymphocytes following infection occur in the spleen [6,19]. This complies with the finding that expression of genes encoding cytokines was higher in the spleen compared to the head kidney following ip. injection of a Y. ruckeri bacterin [5]. In the present study, the immune gene activation in the spleen was found to be extensive during the primary Y. ruckeri infection in rainbow trout, concomitant with a significant increase of spleen weight (Fig. 3), probably due to influx or proliferation of cells. Further, the early peak of Y. ruckeri in the spleen compared to the blood could indicate that the spleen actively clears the bacterial infection. 4.1. Cytokines within the IL-1 family

Fig. 4. Detection of Y. ruckeri in blood of infected rainbow trout (n ¼ 5). More than 1 106 CFU/ml blood were detected in infected fish 6 days post-infection.

IL-1b is one of the best described pro-inflammatory cytokines in rainbow trout [20–23]. Increased levels of IL-1b transcripts in rainbow trout tissue have been reported and ascribed to infections with ectoparasites [24–26], virus [27] and injection of killed Y. ruckeri bacterin [5]. The IL-1 system of ligands and receptors is a complex system of agonists and antagonists. IL-1-induced activity occurs as a consequence of binding to its receptor complex (IL-1R) on the cell surface of target cells [28]. In mammals the IL-1R transduction system is extraordinarily sensitive and just a few ligand-occupied receptors initiate biological activity [29]. We found a significantly increased expression of the IL-1b1 gene and its associated receptors in infected fish (Table 2 and Fig. 5). The IL-1b1 expression was significantly increased from 8 h.p.i. to 3 d.p.i. where it peaked (77.8-fold) and also was positively correlated to the abundance of the pathogen (Table 2 and Fig. 2). The present work indicates that this established path of immunological events in mammals also occurs in rainbow trout, involving IL-1b as an important mediator of the early immune response in rainbow trout.

538

M.K. Raida, K. Buchmann / Fish & Shellfish Immunology 25 (2008) 533–541

Table 2 Quantitative PCR (qPCR) expression of immune relevant genes in the spleen of rainbow trout following primary ip. infection with Y. ruckeri Gene

Treat-ment

Gene expression in Spleen. Fold increase of target gene relative to elongation factor a (SD) 0h

8h

1 Day

3 Days

7 Days

14 Days

28 Days

IL-1b

Infected Control

1.0

0.5–2.2

2.6* 0.6

1.1–5.9 0.5–0.9

13.6* 0.4

0.7–269.4 0.3–0.6

77.8*** 0.6

46.8–129.4 0.2–1.5

3.1 0.6

0.2–42.4 0.3–1.3

1.2 0.7

0.2–5.5 0.2–1.8

0.5 0.6

0.2–1.3 0.2–1.9

IL-6

Infected Control

1.0

0.7–1.5

0.7 0.4

0.3–1.8 0.3–0.5

10.2* 0.5

1.5–69.3 0.3–0.8

20.7*** 0.5

10.0–42.8 0.2–1.1

1.4 1.4

0.4–5.4 0.6–3.3

1.9 0.4

0.3–11.3 0.1–2.5

0.4 0.8

0.2–0.8 0.2–3.4

IL-8

Infected Control

1.0

0.6–1.7

4.8* 2.2

2.4–9.5 1.8–2.9

32.7* 2.3

5.0–212.9 1.6–3.3

58.9*** 2.0

29.2–118.9 1.1–3.7

8.4* 0.9

1.5–46.1 0.5–1.8

3.1* 1.4

2.2–4.5 0.7–2.7

3.4 1.9

1.9–6.3 0.9–4.0

IL-10

Infected Control

1.0

0.5–2.0

0.8 0.8

0.4–1.6 0.5–1.2

6.6 1.0

0.7–62.3 0.8–1.4

396.2*** 0.8

169.8–924.3 0.3–2.6

8.7 1.5

0.5–138.3 0.2–9.7

3.7–106.5 1.3–48.2

7.3 6.6

1.3–41.5 1.1–38.8

IL-11

Infected Control

1.0

0.5–2.0

1.0 1.0

0.4–2.4 0.4–2.3

14.7* 1.2

3.6–59.9 0.6–2.6

18.8* 1.9

11.1–32.0 1.3–2.7

2.1 1.5

0.9–4.9 0.5–4.7

3.5 2.6

0.9–13.8 0.8–7.8

1.6 2.4

0.8–3.2 1.0–5.7

IFN-g

Infected Control

1.0

0.6–1.8

2.5 1.9

1.6–3.8 0.8–4.3

9.4 3.9

1.8–50.4 2.2–7.1

22.1* 3.7

16.4–29.8 1.6–8.4

8.7 5.8

2.3–33.5 1.5–22.7

15.0 9.7

1.9–117.4 2.0–47.6

10.0 6.7

4.1–24.6 2.0–23.3

CD4

Infected Control

1.0

0.7–1.3

1.1 0.8

0.6–1.9 0.5–1.2

2.0* 0.8

1.0–4.2 0.6–1.2

2.3* 0.8

1.3–4.1 0.5–1.3

1.6 0.9

0.5–4.6 0.5–1.6

1.1 1.0

0.7–1.7 0.5–1.8

0.8 0.7

0.5–1.2 0.5–1.0

CD8

Infected Control

1.0

0.6–1.7

0.7 0.8

0.4–1.4 0.4–1.5

0.9 1.1

0.4–2.0 0.8–1.5

0.5 1.3

0.2–1.3 0.8–2.0

0.9 0.8

0.5–1.8 0.6–1.1

2.4 1.6

1.3–4.4 0.9–3.0

2.1 1.1

1.4–3.0 0.5–2.3

TcR

Infected Control

1.0

0.7–1.3

0.9 0.8

0.4–1.9 0.5–1.3

1.2 0.9

0.6–2.4 0.7–1.2

0.4 0.9

0.2–0.9 0.6–1.3

0.7 1.1

0.3–1.5 0.9–1.4

2.1 1.0

1.3–3.3 0.5–2.0

1.1 1.0

0.7–1.8 0.6–1.8

IL-1RI

Infected Control

1.0

0.7–1.5

0.9 0.5

0.4–2.5 0.3–1.0

4.2* 0.6

1.4–13.1 0.5–0.8

6.9* 0.7

3.4–14.0 0.4–1.2

2.0 1.1

0.7–5.6 0.6–2.1

1.8 1.6

0.5–6.7 0.6–4.4

1.4 1.2

0.7–2.9 0.5–2.5

IL-1RII

Infected Control

1.0

0.4–2.3

0.5 0.3

0.2–1.5 0.2–0.7

3.4* 0.2

0.4–33.2 0.2–0.2

17.4*** 0.3

6.7–44.9 0.1–0.5

0.9 0.3

0.1–5.6 0.1–0.8

0.8 0.6

0.2–3.0 0.2–2.1

0.5 0.3

0.2–1.6 0.1–1.0

IL-1Ra

Infected Control

1.0

0.8–1.3

1.1* 0.5

0.7–1.8 0.3–0.7

3.7* 0.7

1.2–12.1 0.6–1.0

8.2*** 0.6

5.0–13.6 0.4–0.8

2.0* 0.6

0.7–5.5 0.4–0.8

0.6 0.4

0.4–0.8 0.3–0.5

0.7 0.5

0.5–1.0 0.4–0.7

MHC II

Infected Control

1.0

0.7–1.5

1.1 0.8

0.6–2.2 0.6–1.1

1.4 1.0

0.8–2.5 0.8–1.2

0.5 1.0

0.2–0.9 0.6–1.6

0.7 0.8

0.4–1.4 0.5–1.1

1.0 0.9

0.7–1.4 0.6–1.3

1.3 1.1

0.9–1.8 0.8–1.4

IgM

Infected Control

1.0

0.7–1.4

0.7 0.7

0.5–0.9 0.4–1.2

0.6 1.2

0.4–0.8 0.5–2.7

0.5 0.6

0.3–0.9 0.4–0.8

1.0 0.6

0.6–1.8 0.5–0.8

0.7 0.7

0.6–0.9 0.6–0.9

0.6 0.6

0.4–0.9 0.5–0.9

IgT

Infected Control

1.0

0.6–1.7

0.4 0.2

0.2–0.8 0.0–4.4

0.5 0.8

0.2–1.6 0.3–1.7

0.6 1.2

0.2–1.5 0.7–2.1

1.6 0.2

0.7–4.1 0.1–4.1

0.4 0.9

0.1–7.9 0.4–2.2

1.0 0.3

0.5–2.2 0.1–3.9

19.9 7.9

Expression was compared to controls injected with PBS, and *indicates significant up- or down-regulation relative to control (p < 0.05), **(p < 0.01) and ***(p < 0.001).

IL-1Ra is a structural variant of IL-1 that binds to both types of IL-1 receptors but fails to activate cells. IL-1Ra functions have not been described in fish, but in mammals it acts as an anti-inflammatory protein which blocks the effects of IL-1. The balance between IL-1 and IL-1Ra in tissue plays an important role in susceptibility to and severity of many diseases. Thus, IL-1Ra protects against IL-1-induced leucocyte inflammation [30–32], and augments suppression of serum IFN-g, TNF-a, IL-1b, IL-6 and C3 concentrations [33]. In the present work IL-1Ra transcript was expressed in the spleen of rainbow trout and the level of transcript was increased from 8 h.p.i. to 7 d.p.i. (Table 2). The antagonist gene transcription was also positively correlated to the expression of IL1b1, IL-1RI and IL-1RII, suggesting that the gene is involved in down-regulation of the IL-1b induced inflammation. 4.2. IL-1 receptors Only binding of IL-1b to the IL-1R type I receptor evokes signal transduction and activation of the nuclear factor (NF)-kB pathway [34]. IL-1RII binds IL-1b but is unable to transduce a signal due to the lack of a functional cytoplasmic tail [35,36]. Thus, IL-1R type II acts as a decoy receptor, functioning by capturing excess IL-1 [34]. In the present study Y. ruckeri infection induced highly significant increases of both IL-1b and IL-1R1 in the spleen (Table 2). Expression of the IL-1RII ‘‘decoy receptor’’ in rainbow trout is known to be up-regulated during ectoparasitic infection [24–26]. The present work showed that IL-1RII expression was increased during bacterial

infection, and we suggest that the function of this protein in rainbow trout is also to bind excess IL-1b and in that way act as a regulating molecule. 4.3. Other cytokines and chemokines The rainbow trout IL-6 gene was recently cloned and characterized. It was found expressed in trout spleen, gill, gastrointestinal tract, ovary and brain [37]. The key features of IL-6 appear to be phylogenetically well conserved within the vertebrates [37] and from mammalian immunology it is known that expression of IL-6 is induced by pro-inflammatory mediators including IL-1b [24,38– 40]. IL-6 is important as the major mediator of acute phase reactions [34]. In rainbow trout IL-6 is known to be up-regulated from a very low level following both LPS and b-glucan in vivo stimulation [41] and to be up-regulated due to bath-vaccination with Y. ruckeri bacterin [42]. In the present work we found that IL-6 expression was almost silent in control fish, whereas the expression increased 10-fold 1 d.p.i., and 20-fold 3 d.p.i. (Table 2). These events support its suggested role as a pro-inflammatory mediator in this host. IL-8 belongs to the CXC chemokine subfamily, and is considered to have a chemo-attractive effect on neutrophils in trout [43,44]. Previous studies have described increased expression of IL-8 during Y. ruckeri bath-vaccination and challenge [8]. Our results support the impression of IL-8 as a central part of the inflammatory reaction. Thus, IL-8 was up-regulated in the spleen from 8 h.p.i. to 14 d.p.i. and the higher amount of IL-8 transcripts is likely to have attracted

M.K. Raida, K. Buchmann / Fish & Shellfish Immunology 25 (2008) 533–541

539

Table 3 Quantitative PCR (qPCR) expression of immune relevant genes in the spleen of rainbow trout following secondary ip. infection with Y. ruckeri Gene

Treatment

Gene expression in spleen. Fold increase of target gene relative to elongation factor a (SD) 8h

1 Day

3 Days

7 Days

14 Days

28 Days

IL-1b

Infected Control

1.0 0.2

0.5–2.0 0.1–0.4

0.7 0.5

0.2–2.7 0.2–1.6

0.3 0.6

0.3–0.5 0.3–1.3

0.2 0.3

0.1–0.4 0.1–0.7

0.2 0.9*

0.1–0.4 0.4–1.7

0.4 0.8

0.2–1.1 0.2–2.8

IL-6

Infected Control

1.0 0.4

0.5–2.1 0.1–1.4

0.5 2.4

0.2–1.5 0.8–6.8

0.4 0.8

0.2–1.0 0.5–1.4

0.8 0.9

0.6–1.2 0.5–1.6

1.3 2.2

0.7–2.4 1.0–5.2

0.4 2.4*

0.2–0.8 1.2–4.7

IL-8

Infected Control

3.7 2.0

1.3–10.5 1.1–4.0

3.8 3.2

2.8–5.3 1.8–5.6

2.1 3.1

1.4–3.1 1.9–5.0

2.8 3.6

1.4–5.5 2.7–4.7

1.9 3.3

1.2–3.3 2.2–5.0

3.7 5.3

2.9–4.7 3.0–9.4

IL-10

Infected Control

1.1 1.4

0.9–1.4 0.6–3.5

2.2 0.9

0.9–5.4 0.3–2.8

2.0 2.7

0.9–4.3 1.5–4.9

1.5 0.7

0.6–3.6 0.4–1.4

1.7 14.5*

0.6–5.4 3.0–70.2

0.4 0.7

0.2–0.8 0.4–1.3

IL-11

Infected Control

1.7 1.1

0.6–5.0 0.6–2.0

1.4 2.7*

0.8–2.4 2.1–3.4

2.3 2.2

1.8–2.9 1.1–4.4

1.8 3.7

1.0–3.1 2.2–6.4

6.5 6.9

3.9–11.1 3.8–12.6

2.7 5.8

2.3–3.1 3.6–9.4

IFN-g

Infected Control

6.3 1.7

2.7–14.9 1.1–2.8

4.0 5.2

2.0–13.5 2.0–13.5

3.8 8.7*

1.7–8.2 4.4–17.0

2.7 20.2*

1.3–5.3 6.5–62.6

5.4 2.1

1.9–15.6 1.5–3.0

2.2 1.7

0.7–6.8 0.9–3.3

CD4

Infected Control

1.4 1.2

0.9–2.2 0.6–2.4

0.9 1.0

0.5–1.5 0.6–1.9

0.9 1.5

0.7–1.1 0.8–2.9

1.2 1.9

0.8–2.0 1.4–2.5

1.6 2.0

1.1–2.2 1.1–3.6

1.2 1.7

0.8–2.0 1.1–2.6

CD8

Infected Control

1.2 1.6

0.8–1.9 1.0–2.7

0.9 1.0

0.4–2.1 0.3–3.9

1.7 1.1

0.8–3.6 0.7–1.7

2.5 1.9

1.6–3.8 1.5–2.6

3.4* 1.8

2.3–5.0 1.2–2.7

2.2 2.8

1.5–3.2 1.9–4.1

TcR

Infected Control

0.8 1.0

0.6–1.2 0.5–1.9

1.1 1.1

0.5–2.4 0.7–1.8

1.3 1.1

0.8–1.9 0.6–2.0

2.0 1.9

1.3–3.2 1.1–3.3

2.9 2.5

1.5–5.3 1.8–3.4

1.7 2.8*

1.3–2.1 2.2–3.6

IL-1RI

Infected Control

0.9 0.8

0.4–1.9 0.4–1.4

0.8 1.4

0.4–1.6 0.7–3.0

1.0 1.2

0.9–1.2 0.7–2.3

0.9 1.5

0.6–1.4 0.7–2.9

1.4 2.4

0.7–2.6 1.2–4.5

1.0 1.1

0.5–2.2 0.6–2.1

IL-1RII

Infected Control

0.3 0.3

0.1–0.7 0.1–0.5

0.2 0.3

0.1–0.4 0.1–0.6

0.3 0.3

0.2–0.4 0.2–0.5

0.1 0.2

0.1–0.2 0.1–0.4

0.3 0.9*

0.2–0.5 0.4–2.2

0.2 0.2

0.1–0.4 0.1–0.6

IL-1Ra

Infected Control

0.9 0.6

0.6–1.4 0.3–1.0

1.0 1.1

0.6–1.5 0.8–1.5

0.9 0.8

0.7–1.1 0.5–1.2

0.8 0.9

0.4–1.5 0.7–1.2

1.0 0.5

0.8–1.3 0.2–1.0

0.7 0.7

0.4–1.1 0.4–1.3

MHC II

Infected Control

1.1 1.2

0.7–1.9 0.7–1.9

0.9 1.4

0.6–1.4 0.8–2.5

1.1 1.0

0.9–1.4 0.7–1.5

1.6 1.6

1.2–2.3 1.4–1.8

1.5 1.6

1.1–2.1 1.4–1.9

1.5 1.7

1.0–2.3 1.4–2.1

IgM

Infected Control

0.5 0.6

0.3–0.8 0.4–0.9

0.6 0.7

0.3–1.1 0.4–1.4

0.6 0.7

0.4–0.9 0.5–1.2

0.5 0.9

0.3–1.0 0.6–1.3

0.6 0.6

0.5–0.7 0.4–0.8

0.4 0.6

0.3–0.7 0.4–1.1

IgT

Infected Control

0.9 1.3

0.4–1.9 1.0–1.6

0.8 0.2

0.3–1.8 0.1–7.8

1.5 1.7

0.5–4.2 1.0–3.0

2.5 1.2

1.4–4.5 0.7–2.2

1.1 0.9

0.6–2.0 0.4–1.8

1.3 0.5

0.5–3.0 0.1–4.7

Expression was compared to controls injected with PBS, and * indicates significant up- or down-regulation relative to control (p < 0.05).

neutrophils to the spleen which could partly explain the weight increase of this organ during the primary infection (Fig. 3). IL-8 was (as IL-1b1 and IL-10) positively correlated to the expression of Y. ruckeri 16S ribosomal RNA gene, which could indicate that IL-8 is attracting phagocytes to the site of inflammation. This result is in agreement with the finding that Y. ruckeri bacterial counts have been associated with increased levels of CXCd mRNA expression in the spleen of infected rainbow trout [8]. It is generally agreed that regulation of inflammation results from a balance between pro- and anti-inflammatory cytokines. Regulation of inflammation is a central event in the immune response reducing the negative effects of the inflammatory processes. Recently, some anti-inflammatory factors in teleosts have been cloned. The cytokine IL-10 belongs to this group, and IL10 homologues have been found in rainbow trout [45], fugu [46], carp [47] and zebrafish [48]. IL-10, initially known as cytokine synthesis inhibitory factor, is a multifunctional cytokine and demonstrates immunosuppressive function. The main function of IL-10 seems to be regulation of the inflammatory response, thereby minimizing damage to the host induced by an excessive response. Thus, IL-10 blocks chemokine receptors and inhibits the effect of pro-inflammatory cytokines [49] and inhibits the activation of macrophages/monocytes, whereby it controls cytokine synthesis, nitric oxide (NO) production and the expression of other costimulatory molecules [50]. The function of IL-10 in teleosts is less clear. Our study demonstrated high expression of IL-10 3 d.p.i. and no pro-inflammatory cytokines were found up-regulated after the

high IL-10 expression (Table 2). This could indicate that IL-10 serves an anti-inflammatory role also in rainbow trout corresponding to its action in mammals. IL-11 is a multifunctional cytokine that in mammals stimulates haematopoietic progenitor cells and exerts a series of important immunomodulatory effects. This cytokine is in rainbow trout modulated by infection and other cytokines, suggesting that IL-11 is an active player in the cytokine network and the fish immune response to infection [51]. During our investigation on infection with Y. ruckeri, IL-11 transcription increased from day 1 to 3. Therefore, the exact function of this cytokine should be addressed in future studies. 4.4. Expression of genes involved in the adaptive immunity In mammals, CD4þ T cells differentiate into IFN-g producing cells following exposure to IL-1b [52]. The present study could indicate that a similar pathway occurs in rainbow trout. We detected an increased expression of IL-1b1 followed by a doubling of the CD4 expression. This was again associated with a highly increased expression of IFN-g transcripts (22.1-fold). In the present study no regulation of expression of the genes encoding IgM, IgT and MHC II was found in the spleen (Tables 2 and 3). It is possible that the main regulation of immunoglobulin expression takes place in the head kidney and not in the spleen. It has previously been indicated from studies on vaccinated trout, showing that the antibody response was mainly caused by Ig secretion from plasma cells

540

M.K. Raida, K. Buchmann / Fish & Shellfish Immunology 25 (2008) 533–541

Fig. 5. Gene expression of IL-1b, IL-1 receptor antagonist (Ra) and IL-1 receptor I and II, in the spleen of rainbow trout infected with Y. ruckeri (n ¼ 5).

in the anterior kidney [5,53]. However, the lack of increases in Ig gene transcripts during the infections may also be explained by the fact that Y. ruckeri-specific Ig mRNA merely represents a limited fraction of the huge amount of mRNA encoding secreted Ig [5]. In mammals CD8a is known as a marker for cytotoxic T cells. CD8 positive T cells recognize antigens that are displayed as peptide:MHC class I complexes on the cell surface [54]. The gene encoding CD8a has been identified in rainbow trout [55] and specific cytotoxicity of T-cells has also been recognized using clonal rainbow trout [56,57]. There were no difference in the transcript levels of CD8a between infected and control fish during the primary Y. ruckeri infection, but during the secondary infection, the CD8a gene was the only one up-regulated relative to the controls. It is noteworthy that the gene encoding CD-8a previously was found up-regulated in rainbow trout bath-vaccinated with Y. ruckeri bacterin [42], which indicates that activity of cytotoxic T-cells plays a role in the cellular adaptive protection mechanisms against Y. ruckeri infection. Increased expression of CD-8a in spleen of rainbow trout was previously reported following exposure to other viral and bacterial pathogens such as infectious haematopoietic necrosis virus (IHNV) and Flavobacterium psychrophilum [19] and a similar reaction in peripheral blood leucocytes after infection with viral haemorrhagic septicaemia virus (VHSV) [57]. In conclusion, this study on the development of adaptive immunity in rainbow trout suggests that the immune response is initiated by cytokines which activate lymphocytes to initiate an adaptive immune response eventually leading to long-lasting protective immunity. The amount of Y. ruckeri in the spleen was increased 21,000-fold during the first 3 days before the bacterial infection decreased probably due to innate immune response factors. During the re-infection with the same dose of Y. ruckeri, the presence of bacteria was only detectable in three out of five reinfected fish 8 h.p.i. and in none of the tested fish 1 d.p.i. These data comply with the viewpoint that the adaptive immunity is much more efficient than the innate immune response when clearing a bacterial infection in rainbow trout. The weak expression of the investigated genes in the well protected rainbow trout following the re-infection was noteworthy. It corresponds to expression data on the immune response in rainbow trout reacting to a parasite where, following full recovery

from the primary infection, re-infection did not elicit transcription levels above those seen in un-infected rainbow trout [25]. One explanation of the weak gene expression during the re-infection is that the pathogen is killed very fast, whereby the associated expression of some pro-inflammatory cytokines is kept at a minimum. The present work has pin-pointed a series of immunological events during this dynamic infection and re-infection interaction between host and pathogen. Following the initial regulated cytokine expression (involving IL1b and its antagonists, receptor and decoy receptor) it is indicated that the protective effect may comprise regulated activity of T-cells. Acknowledgments This work was supported in part by a grant to the project 27407-0354 from the Danish Agency for Science Technology and Innovation and by the integrated research project IMAQUANIM sponsored by the European Commission and by a grant to the project FFS05-7 ‘‘Welfare in farmed Rainbow trout’’ from the Danish Ministry for Food. References [1] Fernandez L, Mendez J, Guijarro JA. Molecular virulence mechanisms of the fish pathogen Yersinia ruckeri. Veterinary Microbiology 2007;125:1–10. [2] Tobback E, Decostere A, Hermans K, Haesebrouck F, Chiers K. Yersinia ruckeri infections in salmonid fish. Journal of Fish Diseases 2007;30:257–68. [3] Horne MT, Barnes AC. Enteric redmouth disease (Yersinia ruckeri). In: Woo PTK, Bruno DW, editors. Fish diseases and disorders. Viral, bacterial and fungal infections, vol. 3. CABI Publishing; 1999. p. 455–77. [4] Ellis AE. Immunity to bacteria in fish. Fish & Shellfish Immunology 1999;9:291–308. [5] Raida MK, Buchmann K. Temperature-dependent expression of immunerelevant genes in rainbow trout following Yersinia ruckeri vaccination. Diseases of Aquatic Organisms 2007;77:41–52. [6] Chaves-Pozo E, Munoz P, Lopez-Munoz A, Pelegrin P, Ayala AG, Mulero V, et al. Early innate immune response and redistribution of inflammatory cells in the bony fish gilthead seabream experimentally infected with Vibrio anguillarum. Cell and Tissue Research 2005;320:61–8. [7] Espenes A, Press CM, Dannevig BH, Landsverk T. Immune complex trapping in the splenic ellipsoids of rainbow trout (Oncorhynchus mykiss). Cell and Tissue Research 1995;282:41–8. [8] Wiens GD, Glenney GW, Lapatra SE, Welch TJ. Identification of novel rainbow trout (Oncorynchus mykiss) chemokines, CXCd1 and CXCd2: mRNA expression after Yersinia ruckeri vaccination and challenge. Immunogenetics 2006;58:308–23.

M.K. Raida, K. Buchmann / Fish & Shellfish Immunology 25 (2008) 533–541 [9] Welch TJ, Wiens GD. Construction of a virulent, green fluorescent proteintagged Yersinia ruckeri and detection in trout tissues after intraperitoneal and immersion challenge. Diseases of Aquatic Organisms 2005;67:267–72. [10] Murphy K, Travers P, Walport M. Janeway’s immuno biology. 7th ed. New York and London: Garland Science Publishing; 2008. [11] Janeway CA. Presidential address to the American Association of Immunologists – the road less traveled by: the role of innate immunity in the adaptive immune response. Journal of Immunology 1998;161:539–44. [12] Fouz B, Zarza C, Amaro C. First description of non-motile Yersinia ruckeri serovar I strains causing disease in rainbow trout, Oncorhynchus mykiss (Walbaum), cultured in Spain. Journal of Fish Diseases 2006;29:339–46. [13] Ellis AE. Fish vaccination. 1st ed. London: Academic Press Limited; 1988. [14] Gibello A, Blanco MM, Moreno MA, et al. Development of a PCR assay for detection of Yersinia ruckeri in tissues of inoculated and naturally infected trout. Applied and Environmental Microbiology 1999;65:346–50. [15] Olsvik PA, Lie KK, Jordal AEO, Nilsen TO, Hordvik I. Evaluation of potential reference genes in real-time RT-PCR studies of Atlantic salmon. BMC Molecular Biology, http://www.biomedcentral.com/content/pdf/1471-21996-21.pdf, 2005;6. [16] Ingerslev HC, Pettersen EF, Jakobsen RA, Petersen CB, Wergeland HI. Expression profiling and validation of reference gene candidates in immune relevant tissues and cells from Atlantic salmon (Salmo salar L.). Molecular Immunology 2006;43:1194–201. [17] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the ‘2(-Delta Delta CT) method’. Methods 2001;25:402–8. [18] Press CM, Evensen O. The morphology of the immune system in teleost fishes. Fish & Shellfish Immunology 1999;9:309–18. [19] Overturf K, LaPatra S. Quantitative expression of immunological factors in rainbow trout, Oncorhynchus mykiss (Walbaum), after infection with either Flavobacterium psychrophilum, Aeromonas salmonicida, or infectious haematopoietic necrosis virus. Journal of Fish Diseases 2006;29:215–24. [20] Hong SH, Peddie S, Campos-Perez JJ, Zou J, Secombes CJ. The effect of intraperitoneally administered recombinant IL-1 beta on immune parameters and resistance to Aeromonas salmonicida in the rainbow trout (Oncorhynchus mykiss). Developmental and Comparative Immunology 2003;27:801–12. [21] Martin S, Zou J, Houlihan D, Secombes C. Directional responses following recombinant cytokine stimulation of rainbow trout (Oncorhynchus mykiss) RTS-11 macrophage cells as revealed by transcriptome profiling. BMC Genomics 2007;8:150. [22] Secombes CJ, Bird S, Cunningham C, Zou J. Interleukin-1 in fish. Fish & Shellfish Immunology 1999;9:335–43. [23] Secombes CJ, Zou J, Laing K, Daniels GD, Cunningham C. Cytokine genes in fish. Aquaculture 1999;172:93–102. [24] Gonzalez SF, Huising MO, Stakauskas R, Forlenza M, Verburg-van Kemenade BML, Buchmann K, et al. Real-time gene expression analysis in carp (Cyprinus carpio L.) skin: inflammatory responses to injury mimicking infection with ectoparasites. Developmental and Comparative Immunology 2007;31:244–54. [25] Lindenstrom T, Buchmann K, Secombes CJ. Gyrodactylus derjavini infection elicits IL-1 beta expression in rainbow trout skin. Fish & Shellfish Immunology 2003;15:107–15. [26] Sigh J, Lindenstrom T, Buchmann K. Expression of pro-inflammatory cytokines in rainbow trout (Oncorhynchus mykiss) during an infection with Ichthyophthirius multifiliis. Fish & Shellfish Immunology 2004;17:75–86. [27] Tafalla C, Coll J, Secombes CJ. Expression of genes related to the early immune response in rainbow trout (Oncorhynchus mykiss) after viral haemorrhagic septicemia virus (VHSV) infection. Developmental and Comparative Immunology 2005;29:615–26. [28] Scapigliati G, Costantini S, Colonna G, Facchiano A, Buonocore F, Bossu P, et al. Modelling of fish interleukin-1 and its receptor. Developmental and Comparative Immunology 2004;28:429–41. [29] Dinarello CA. Biologic basis for interleukin-1 in disease. Blood 1996;87:2095–147. [30] Bandara G, Mueller GM, Galealauri J, Tindal MH, Georgescu HI, Suchanek MK, et al. Intraarticular expression of biologically active interleukin-1 receptor antagonist protein by ex vivo gene transfer. Proceedings of the National Academy of Sciences of the United States of America 1993;90:10764–8. [31] Cominelli F, Bortolami M, Pizarro TT, Monsacchi L, Ferretti M, Brewer MT, et al. Rabbit interleukin-1 receptor antagonist. Cloning, expression, functional characterization, and regulation during intestinal inflammation. The Journal of Biological Chemistry 1994;269:6962–71. [32] Hung GL, Galealauri J, Mueller GM, Georgescu HI, Larkin LA, Suchanek MK, et al. Suppression of intraarticular responses to interleukin-1 by transfer of the interleukin-1 receptor antagonist gene to synovium. Gene Therapy 1994;1:64–9. [33] Yang H, Tuzun E, Alagappan D, Yu X, Scott BG, Ischenko A, et al. IL-1 receptor antagonist-mediated therapeutic effect in murine myasthenia gravis is associated with suppressed serum proinflammatory cytokines, C3, and antiacetylcholine receptor IgG1. Journal of Immunology 2005;175:2018–25.

541

[34] Engelsma MY, Huising MO, van Muiswinkel WB, Flik G, Kwang J, Savelkoul HFJ, et al. Neuroendocrine–immune interactions in fish: a role for interleukin-1. Veterinary Immunology and Immunopathology 2002;87:467–79. [35] Dinarello CA, Abraham E. Does blocking cytokines in sepsis work? American Journal of Respiratory and Critical Care Medicine 2002;166:1156–7. [36] Sangrador-Vegas A, Martin SAM, O’Dea PG, Smith TJ. Cloning and characterization of the rainbow trout (Oncorhynchus mykiss) type II interleukin-1 receptor cDNA. European Journal of Biochemistry 2000;267:7031–7. [37] Iliev DB, Castellana B, MacKenzie S, Planas JV, Goetz FW. Cloning and expression analysis of an IL-6 homolog in rainbow trout (Oncorhynchus mykiss). Molecular Immunology 2007;44:1803–7. [38] Ammit AJ, Lazaar AL, Irani C, O’Neill GM, Gordon ND, Amrani Y, et al. Tumor necrosis factor-alpha-induced secretion of RANTES and interleukin-6 from human airway smooth muscle cells – modulation by glucocorticoids and betaagonists. American Journal of Respiratory Cell and Molecular Biology 2002;26:465–74. [39] Bergamaschi A, Corsi M, Garnier MJ. Synergistic effects of cAMP-dependent signalling pathways and IL-1 on IL-6 production by H19-7/IGF-IR neuronal cells. Cellular Signalling 2006;18:1679–84. [40] Takezako N, Hayakawa M, Hayakawa H, Aoki S, Yanagisawa K, Endo H, et al. ST2 suppresses IL-6 production via the inhibition of I kappa B degradation induced by the LPS signal in THP-1 cells. Biochemical and Biophysical Research Communications 2006;341:425–32. [41] Lovoll M, Fischer U, Mathisen GS, Bogwald J, Ototake M, Dalmo RA. The C3 subtypes are differentially regulated after immunostimulation in rainbow trout, but head kidney macrophages do not contribute to C3 transcription. Veterinary Immunology and Immunopathology 2007;117:284–95. [42] Raida MK, Buchmann K. Bath vaccination of rainbow trout (Oncorhynchus mykiss Walbaum) against Yersinia ruckeri: effects of temperature on protection and gene expression. Vaccine 2008;26:1050–62. [43] Zhang H, Thorgaard GH, Ristow SS. Molecular cloning and genomic structure of an interleukin-8 receptor-like gene from homozygous clones of rainbow trout (Oncorhynchus mykiss). Fish & Shellfish Immunology 2002;13:251–8. [44] Jimenez N, Coll J, Salguero FJ, Tafalla C. Co-injection of interleukin 8 with the glycoprotein gene from viral haemorrhagic septicemia virus (VHSV) modulates the cytokine response in rainbow trout (Oncorhynchus mykiss). Vaccine 2006;24:5615–26. [45] Inoue Y, Kamota S, Itoa K, Yoshiura Y, Ototake M, Moritomo T, et al. Molecular cloning and expression analysis of rainbow trout (Oncorhynchus mykiss) interleukin-10 cDNAs. Fish & Shellfish Immunology 2005;18:335–44. [46] Zou J, Clark MS, Secombes CJ. Characterisation, expression and promoter analysis of an interleukin 10 homologue in the puffer fish, Fugu rubripes. Immunogenetics 2003;55:325–35. [47] Savan R, Igawa D, Sakai M. Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. European Journal of Biochemistry 2003;270:4647–54. [48] Zhang DC, Shao YQ, Huang YQ, Jiang SG. Cloning, characterization and expression analysis of interleukin-10 from the zebrarish (Danio rerion). Journal of Biochemistry and Molecular Biology 2005;38:571–6. [49] D’Amico G, Frascaroli G, Bianchi G, Transidico P, Doni A, Vecchi A, et al. Uncoupling of inflammatory chemokine receptors by IL-10: generation of functional decoys. Nature Immunology 2000;1:387–91. [50] Dumoutier L, Louahed J, Renauld JC. Cloning and characterization of IL-10-related T cell-derived inducible factor (IL-TIF), a novel cytokine structurally related to IL-10 and inducible by IL-9. Journal of Immunology 2000;164:1814–9. [51] Wang T, Holland JW, Bols N, Secombes CJ. Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout (Oncorhynchus mykiss). FEBS Journal 2005;272:1136–47. [52] Acosta-Rodriguez EV, Napolitani G, Lanzavecchia A, Sallusto F. Interleukins 1 beta and 6 but not transforming growth factor-beta are essential for the differentiation of interleukin 17-producing human T helper cells. Nature Immunology 2007;8:942–9. [53] Bromage ES, Kaattari IM, Zwollo P, Kaattari SL. Plasmablast and plasma cell production and distribution in trout immune tissues. Journal of Immunology 2004;173:7317–23. [54] Janeway CA, Travers P, Walport M, Shlomchik MJ. Immunobiology: the immune system in health and disease. 6th ed. New York and London: Garland Science Publishing; 2005. [55] Hansen JD, Strassburger P. Description of an ectothermic TCR coreceptor, CD8 alpha, in rainbow trout. Journal of Immunology 2000;164:3132–9. [56] Fischer U, Utke K, Ototake M, Dijkstra JM, Kollner B. Adaptive cell-mediated cytotoxicity against allogeneic targets by CD8-positive lymphocytes of rainbow trout (Oncorhynchus mykiss). Developmental and Comparative Immunology 2003;27:323–37. [57] Utke K, Bergmann S, Lorenzen N, Kollner B, Ototake M, Fischer U. Cellmediated cytotoxicity in rainbow trout, Oncorhynchus mykiss, infected with viral haemorrhagic septicaemia virus. Fish & Shellfish Immunology 2007;22:182–96.