Development of an amplification and hybridization assay for the specific and sensitive detection ofMycoplasma fermentansDNA

Molecular and Cellular Probes (1996) 10, 7–14

Development of an amplification and hybridization assay for the specific and sensitive detection of Mycoplasma fermentans DNA Silke Berg, Edeltraud Lu¨neberg and Matthias Frosch∗ Institut fu¨r Medizinische Mikrobiologie, Medizinische Hochschule, 30625 Hannover, Germany (Received 23 May 1995, Accepted 31 August 1995) A polymerase-chain-reaction-based detection system for Mycoplasma fermentans was established. The highly conserved tuf gene, which encodes elongation factor Tu of prokaryotes, served as target sequence for the PCR. With two PCR oligodeoxynucleotides, which were selected from M. fermentans specific sequences of the tuf gene, we amplified a 850 base pair DNA fragment. Via the biotin-moiety of one primer the PCR fragments were immobilized on streptavidin-coated microtitre plates. After alkaline denaturation a digoxigenin-labelled M. fermentans specific DNA probe was hybridized to the single stranded immobilized PCR fragment. Detection was performed by addition of an alkaline phosphatase conjugated anti-digoxigenin antibody. 4-methyl-umbelliferylphosphate was used as a fluorogenic substrate. Amplification of 10 fg chromosomal target DNA was detected by this ‘DNA enzyme immuno assay (DEIA)’ technique, corresponding to seven genome copies. Our study supports the presumption that the tuf gene proves to be a suitable target sequence for the PCR based detection of any bacterial species. Furthermore, hybridization of PCR fragments with radio-labelled DNA probes should no longer be necessary, because a very sensitive non-radioactive test system can easily be established with the ‘DEIA’ technique.  1996 Academic Press Limited KEYWORDS: Mycoplasma fermentans, species-specific oligonucleotides, polymerase chain reaction, non-radioactive hybridization, DNA enzyme immuno assay.

INTRODUCTION months of consumption.5 The isolate was then identified as a Mycoplasma species and was termed Mycoplasma incognitus.6 Autopsy studies showed ‘VLIA’ DNA in various tissues of AIDS patients, whereas the clinical relevance of these tissue infections remained unclear.7 Subsequent studies revealed that the presumably newly discovered species is a strain of the species M. fermentans.8 In two case reports the pathogenic potential of M. fermentans seemed to be obvious: In previously healthy non-AIDS patients who suffered from a very severe flu-like illness only M.

Mycoplasma fermentans, a member of the class Mollicutes, is a bacterium with so far unknown pathogenicity. M. fermentans was found in patients with rheumatoid arthritis1 and in the bone marrow of leukaemic patients2 as well as in the human urogenital tract.3 But it was not proven that M. fermentans was the cause of disease in these cases. In 1986, S.-C. Lo isolated a ‘virus like infectious agent (VLIA)’ from Kaposi’s sarcoma cells of HIV-infected individuals.4 In an animal study four silvered leaf monkeys were artificially infected with ‘VLIA’ and died within 9 ∗ Author to whom correspondence should be addressed.

0890–8508/96/010007+08 $18.00/0

7

 1996 Academic Press Limited

8

S. Berg et al.

fermentans was found as an infectious agent in biopsies and no further cause of the disease could be identified. Both patients recovered under adequate antimicrobial therapy.9,10 Clinical data as well as in vitro studies11,12 led to the suggestion that M. fermentans may play an important role in HIV-infection as a cofactor in the progression of AIDS. However, further investigations are required to elucidate the pathogenic potential of M. fermentans. Because mycoplasmas are difficult to grow in culture medium, more sensitive diagnostic tools like the polymerase chain reaction (PCR) are necessary for the detection of M. fermentans. In a previous study in our laboratory, a very sensitive PCR dependent diagnostic assay for the detection of M. pneumoniae was established.13 The tuf gene, which encodes elongation factor Tu (EF-Tu) of prokaryotes, was chosen as the PCR target sequence. Owing to the function of EFTu in protein biosynthesis, the tuf gene belongs—like rRNA genes—to the highly conserved genes in the bacterial genome, consisting of conserved and variable regions. From variable stretches within the tuf gene species-specific sequences are accessible. The M. pneumoniae specific, biotin-labelled amplification products were immobilized and hybridized in streptavidin-coated microtitre plates. Hybrids were detected with an enzyme-labelled antibody. This hybridization technique was shown to be as sensitive as the coventional Southern blot hybridization with radiolabelled DNA probes. Based on these previous studies, we improved this assay and applied it for the detection of M. fermentans DNA. MATERIALS AND METHODS Strains, media and DNA preparation Bacterial strains used in this study are listed in Table 1. All Mycoplasma strains were grown as described elsewhere.17 For cultivation of U. urealyticum the medium was supplemented with urea (0·1%) instead of arginine or glucose and pH was adjusted to 6·0. Genomic DNA of Mycoplasma was extracted following the protocol of Wenzel and Herrmann.18 Genomic DNA from the other bacteria and the human lung carcinoma cell line HTB 119 (obtained from the American Type Culture Collection) was extracted according to the procotol of Ausubel et al.19 Oligonucleotides Oligonucleotide synthesis was performed in a gene assembler plus (Pharmacia, LKB, Freiburg, Germany

by the phosphoamidite procedure. A TFA aminolinker (Pharmacia) was incorporated at the 5′-end of those oligonucleotides that were to be labelled with biotin or digoxigenin. The appropriate oligonucleotide (200 l solubilized in 0·5 ml 200 m NaHCO3 pH 9·0) was incubated with the biotin and digoxigenin coupling reagents, respectively. For biotin coupling, 5 mg biotinaminocaproate N-hydroxysuccinimidester (Sigma, Deisenhofen, Germany) was dissolved in 500 ll dimethylsulphoxid (Merck, Darmstadt, Germany) and for the digoxigenin coupling reagent, 5 mg digoxigenin-3-0-methyl-carbonyl-e-aminocaproat-Nhydroxy-succinimidester (Boehringer, Mannheim, Germany) was dissolved in 500 ll dimethylformamide (Sigma). The coupling reaction was carried out in the dark at room temperature in an overhead shaker for 24 h. Labelled oligonucleotides were purified by reversed phase FPLC.

Polymerase chain reaction The PCR amplification was performed in a total volume of 100 ll PCR buffer (10 m Tris-Cl pH 9·0, 50 m KCl, 0·1% Triton X-100) containing 2·5 m MgCl2, 200 l (each) dATP, dCTP, dGTP and dTTP (Pharmacia), 0·3 l of each primer, and varying template concentrations, ranging from 1 fg to 50 ng chromosomal DNA. The reaction mixture was overlayed with mineral oil (Sigma) and heated to 94°C for 5 min before 2·5 U Taq DNA Polymerase (Promega, Madison, Wi, USA) were added. 36 cycles were performed consisting of 90 s denaturing at 94°C, 90 s annealing at 60°C (when using primers SB1 and SB2) or 50°C (when using primers Msp27 and Msp28) and 120 s extension at 72°C. In the last cycle the extension time was elongated to 10 min. Amplification reactions were carried out in the thermocycler VARIUS V (Landgraf, Langenhagen, Germany).

Sequencing of PCR products The amplification products generated with primer Msp27 and Msp28 were separated from unincorporated primers with the Qiaex DNA Extraction Kit (Diagen, Du¨sseldorf, Germany). The DNA sequencing was carried out by the dideoxy chain termination method20 using the Taquence Sequencing Kit (USB, Heidelberg, Germany). One hundred and fifty picomoles of sequencing primer, 100 ng PCR fragment and 2 ll reaction buffer in a total volume of 10 ll were heated to 95°C for 5 min and cooled on ice/alcohol for 5 min. Primer annealing was carried out at 50°C for 5 min. After addition of 2 ll labelling

Detection of Mycoplasma fermentans Table 1.

9

Bacterial strains used in this study

Strain

Source

M. fermentans KL4 M. fermentans KL8 M. fermentans K7 M. fermentans P 15–86 M. fermentans incognitus M. fermentans PG 18 M. hominis M. genitalium M. lipophilum M. faucium M. orale M. buccale M. salivarium M. pirum M. iowae M. primatum M. arthritidis M. pneumoniae Acholeplasma laidlawii Ureaplasma urealyticum Staphylococcus aureus

R. Rosengarten, Tiera¨rztliche Hochschule Hannover, Germany (Ref. R. Rosengarten, Tiera¨rztliche Hochschule Hannover, Germany (Ref. R. Rosengarten, Tiera¨rztliche Hochschule Hannover, Germany (Ref. R. Rosengarten, Tiera¨rztliche Hochschule Hannover, Germany (Ref. E. Jacobs, Universita¨t Freiburg, Germany (Ref 4) NCTC 10117 NCTC 10111 NCTC 10195 NCTC 10173 NCTC 10174 NCTC 10112 NCTC 10136 NCTC 10113 NCTC 11702 NCTC 10185 NCTC 10163 NCTC 10162 ATCC 15293 NCTC 10116 NCTC 10177 Medizinische Mikrobiologie, Medizinische Hochschule Hannover, Germany Medizinische Mikrobiologie, Medizinische Hochschule Hannover, Germany Medizinische Mikrobiologie, Medizinische Hochschule Hannover, Germany Medizinische Mikrobiologie, Medizinische Hochschule Hannover, Germany Medizinische Mikrobiologie, Medizinische Hochschule Hannover, Germany U. Berger, Universita¨t Freiburg, Germany

Klebsiella oxytoca Escherichia coli Clostridium sporogenes Streptococcus pneumoniae Neisseria meningitidis

14) 14) 15) 16)

NCTC: National Collection of Type Cultures, London, UK. ATCC: American Type Culture Collection, Rockville, MD, USA.

mix, 2·5 lCi [a35S]dATP and 2·5 U Taq DNA polymerase the labelling reaction was performed at 50°C for 5 min. The chain elongation was terminated after addition of dideoxynucleotides at 70°C for 5 min. The DNA fragments were separated by polyacrylamide gel electrophoresis under denaturing conditions and detected by autoradiography.

Detection of PCR products M. fermentans specific amplification products were detected by a ‘DNA enzyme immuno assay’ technique.13 Streptavidin-coated microtitre plates (Antigen, Leinfelden-Echterdingen, Germany) were washed with PBS-0·05% Tween three times prior to use. The following steps were carried out in a total volume of 50 ll per well. In general, duplicates of 10 ll aliquots of a PCR amplification mixture were analysed. Immobilization of the PCR fragments, which were generated with biotin-labelled primer SB1 and

unlabelled primer SB2, was performed in the appropriate buffer (0·1  NaCl, 10 m NaPO4, pH 7·4) for 20 min at room temperature. After three times washing with PBS-0·05% Tween immobilized PCR amplicons were denatured with 100 m NaOH for 10 min at room temperature. A brief neutralizing step (1 min) with 100 m Tris-Cl pH 7·5 was followed by application of 1 pmol to 10 pmol digoxigenin-labelled hybridization oligonucleotide SB3 diluted in hybridization buffer (0·6  NaCl, 20 m NaPO4 pH 7·5, 1 m EDTA, 0·02% Ficoll, 0·02% Polyvinylpyrolidone, 0·02% BSA) to each well. The parafilmsealed microtitre plates were incubated for 2 h at 60°C in a water bath. Unbound hybridization probe was removed by washing with 6×SSC three times at room temperature, followed by one washing step with 3×SSC at 60°C and two washing steps with 2×SSC at 60°C. Hybrids were detected with an alkaline phosphatase conjugated anti-digoxigenin antibody (Boehringer) diluted in 1% bovine serum albumin in PBS. After 1 h incubation at room temperature

10

S. Berg et al.

microtitre plates were washed with PBS-0·05% Tween for three times. The substrate solution was prepared by dissolving 1 mg 4-methyl-umbelliferyl-phosphate (Sigma) in 25 ml buffer (100 m Tris-HCl pH 9·6, 100 m NaCl, 50 m MgCl2) and added to the wells. After 2 h incubation at room temperature fluorescence units were determined in a microtitre plate fluorometric reader (Titertek Fluoroskan, Flow Laboratories, Meckenheim, Germany). The cut-off value was determined by adding three standard deviations to the mean values of the negative controls. To investigate the influence of unincorporated primers and to compare the sensitivity of the hybridization assay obtained with purified and crude PCR fragments, respectively, aliquots from amplification reactions were purified with the Qiaex DNA Extraction Kit (Diagen) according to the instructions of the manufacturer.

RESULTS

Sequence analysis of the M. fermentans tuf gene fragments With the degenerated oligodeoxynucleotides Msp27 and Msp28 (see Ref. 13) which had been derived from conserved stretches of the tuf gene we amplified a 1120 base pair fragment of the M. fermentans tuf gene. The PCR fragments from six different M. fermentans strains were directly sequenced. PCR primers Msp27 and Msp28, respectively, were also used as sequencing primers. Comparison of the sequences revealed complete identity among the six M. fermentans strains within the analyzed stretches of the tuf gene. By aligning the M. fermentans partial sequences of the tuf gene to the tuf sequences of M. pneumoniae,13,21 M. hominis,22 M. genitalium,23 M. gallisepticum24 and the tufB-sequence of E. coli,25 M. fermentans specific oligonucleotide sequences SB1 (23-mer), SB2 (24-mer) and SB3 (22-mer) were selected from variable regions. The sequence alignment is shown in Fig. 1. Oligonucleotides SB1 and SB2 were used as PCR primers, whereas SB3 was applied as hybridization probe. Detailed description of the oligonucleotides is given in Table 2.

M. fermentans specific PCR PCR primers SB1 and SB2 were able to direct the generation of an 850 bp fragment of the tuf gene of M. fermentans (Fig. 2). The annealing temperature in the PCR reaction was 60°C. The oligonucleotide

primers SB1 and SB2 are highly specific for M. fermentans, since no amplification product was detected on agarose gels when 500 ng chromosomal DNA of 21 bacterial species (listed in Table 1 in the material and methods section) was subjected to PCR under the same conditions. In order to investigate the sensitivity of the PCR, serial dilutions from 1 ng to 1 fg of M. fermentans chromosomal DNA were prepared to serve as PCR template. From reaction mixtures with 10 fg genomic template DNA an amplification fragment could be visualized after agarose gel electrophoresis (Fig. 2). The genome of M. fermentans consists of 1200 kb,26 10 fg chromosomal DNA are therefore equivalent to seven genome copies. Thus, the specific amplification is also very sensitive. To simulate clinical specimens, which may contain considerable amounts of background DNA of human or bacterial origin, we added genomic DNA from M. hominis, E. coli and human lung carcinoma cell line HTB 119 to the amplification reaction mixture. 100 ng and 1 lg, respectively, of extracted DNA from either M. hominis, E. coli or from human cells were mixed with serial dilutions of M. fermentans DNA and amplification was performed as before. The sensitivity of the M. fermentans specific PCR was not affected under these conditions: an 850 bp fragment was detectable by agarose gel electrophoresis from reaction mixtures containing 10 fg chromosomal M. fermentans DNA and the additional non-M. fermentans DNA. The PCR assay therefore proves applicable for the investigation of clinical specimens.

Hybridization in microtitre plates To confirm the specificity of the PCR-generated 850 bp fragment, we further analysed the amplicons by hybridization with the oligonucleotide SB3. For this purpose, the biotin-labelled PCR fragments were immobilized on streptavidin-coated microtitre plates and after alkaline denaturation hybridized to the digoxigenin-labelled probe SB3. The PCR fragments from all six M. fermentans strains analysed in this study, gave a hybridization signal. The optimal concentration of the hybridization oligonucleotide was determined by immobilizing dilutions of PCR fragments ranging from 50 ng to 0·5 ng. Hybridization of the fragments was performed with dilutions of the digoxigenin-labelled probe SB3 (25 pmol to 0·1 pmol per well). One nanogram of immobilized DNA could be detected by hybridization with 1 pmol SB3 per well. Lower concentrations of the hybridization probe reduced the sensitivity of the detection. Higher concentrations of the hybridization probe were also found to be less sensitive due to an elevated background

Detection of Mycoplasma fermentans

11

Fig. 1. Sequence alignment of those parts of the tuf gene from which M. fermentans specific oligonucleotides were derived. Identical nucleotides are indicated by dots. The sequences of SB1, SB2 and SB3 are underlined. Numbers on the right margin refer to the position on the M. hominis tuf gene.22 PCR primer SB2 and hybridization oligonucleotide SB3 were synthesized reverse complementary to the coding strand. M. fer., M. fermentans; M. hom., M. hominis; M. pne., M. pneumoniae; M. gen., M. genitalium; M. gal., M. gallisepticum; E. col., E. coli. Table 2.

Sequences and description of M. fermentans specific oligonucleotides

Name

Sequence (5′–3′)

Function

Position∗

Derivation

SB 1 SB 2 SB 3

CAGTATTATCAAAGAAGGGTCTT TCTTTGGTTAATACGTAAATTGCT TTTTTCAGTTTCGTATTCGATG

PCR primer PCR primer Hybridization probe

101–123 930–953 201–222

Biotin — Digoxigenin

∗ Positions refer to the M. hominis tuf gene.22

Fig. 2. Sensitivity of PCR with primers SB1 and SB2. Serial dilutions of chromosomal M. fermentans DNA were subjected to PCR. 10 ll of the amplification reaction mixtures were analyzed by agarose gel electrophoresis and DNA brands were visualized by ethidium bromide staining. Lanes: 1, 10 pg template; 2, 1 pg template; 3, 100 fg template; 4, 10 fg template (corresponding to seven genome copies); 5, 1 fg template; 6, negative control without template DNA.

signal. Therefore, a hybridization probe concentration of 1 pmol per well was chosen for this assay. Subsequently, PCR amplicons generated from reaction mixtures with serial dilutions of M. fermentans template DNA, were analysed by hybridization in microtitre plates. Moreover, we determined whether the purification of PCR mixtures from unincorporated primers resulted in an increased sensitivity of the assay. As shown in Fig. 3, PCR fragments from reaction mixtures with 10 fg template DNA gave a hybridization signal clearly distinguishable from the signal of the control reaction with no template in the PCR mixture. The hybridization assay revealed a high sensitivity and provided in addition a confirmation of the specificity of the PCR results. Since no advantage concerning the sensitivity was observed between purified and unpurified PCR fragments (Fig. 3), the purification step was omitted.

12

S. Berg et al.

Fig. 3. Sensitivity of hybridization of amplification products in microtitre plates. Serial dilutions of M. fermentans chromosomal DNA were applied to PCR, and duplicate 10 ll aliquots of the reaction mixture were analysed in microtitre plates. 10 fg correspond to seven genome copies. Control: aliquots from the PCR negative control with no template DNA; RFU: relative fluorescence units, values are means of duplicate values. Black bars represent PCR fragments purified from unincorporated primers (Qiaex), grey bars represent unpurified PCR fragments.

Fig. 4. Specificity of hybridization with digoxigenin-labelled oligonucleotide SB3 in microtitre plates. The tuf gene of numerous Mycoplasma species and Acholeplasma was amplified with primers Msp27 and Msp28. Msp27 carries a biotin label, and the 1100 bp fragments were immobilized and hybridized in microtitre plates under the same conditions as for the M. fermentans-specific 850 bp fragments. Lanes: 1, M. fermentans PCR fragments generated with primers SB1 and SB2; 2, M. genitalium; 3, A. laidlawii; 4, M. pneumoniae; 5, M. hominis; 6, M. arthritidis; 7, M. buccale; 8, M. orale; 9, M. primatum; 10, M. salivarium; 11, PCR negative control with no template DNA. Duplicates of 10 ll aliquots from the PCR mixture were analysed. RFU: relative fluorescence units.

The specificity of the hybridization oligonucleotide SB3 was confirmed in the following way. The tuf gene of numerous Mycoplasma species and Acholeplasma laidlawii was amplified with primers Msp27 and Msp28. Msp27 was biotin-labelled for immobilization of the 1100 bp fragments on microtitre plates. None of the fragments hybridized with digoxigenin-labelled probe SB3 at 60°C (Fig. 4).

DISCUSSION In this paper we describe a PCR-based detection assay for the specific and sensitive identification of M. fermentans DNA. As in a recent study by our laboratory on the detection of M. pneumoniae,13 we again chose the tuf gene which encodes elongation factor Tu as target sequence for the PCR amplification. The

Detection of Mycoplasma fermentans

tuf gene bears the advantage of being an essential constituent of any bacterial genome. Moreover, in a particular species, e.g. M. fermentans, no sequence divergency among different strains and isolates was observed. Since the tuf gene belongs to the very conserved genes of the bacterial cell, a sequence uniformity is as well expectable for strains that may be isolated in the future. The PCR amplification of M. fermentans reported by different authors is in most cases based on the amplification of an insertionsequence-like element.27–31 Only in two recent reports, the 16S-rRNA gene was selected as PCR target.32,33 With primers SB1 and SB2 we amplified an 850 bp M. fermentans specific fragment. The PCR amplification was very sensitive, seven genome copies could be detected. Subsequent analysis of PCR amplicons either by hybridization or by restriction fragment analysis is generally considered as an essential step to confirm the specificity of a PCR amplification. We immobilized the PCR fragments in streptavidin-coated microtitre plates via the biotin moiety of one PCR primer and hybridized the denatured strands to a third oligonucleotide which carried a digoxigenin label. As for agarose gel analysis of PCR strands, with the hybridization technique in microtitre plates also amplification products from PCR mixtures with a template DNA concentration equal to seven genome copies were detectable. Compared to our study on the detection of M. pneumoniae, we here omitted the purification of PCR fragments prior to immobilization as well as the blocking step after immobilization. Owing to the high binding capacity of the streptavidin-coated microtitre plates (supplied by Antigen) these time-consuming steps were avoidable. The uniformly high quality of these microtitre plates contrasted to other products, including the plates used in the previous study,13 which exhibited strong differences in the binding capacity from plate to plate and even from well to well within a single plate. The hybridization procedure thus could be performed in a reduced time and is even more suitable for routinely processing a large number of samples. The hypothesis that M fermentans plays an important role in the progression of AIDS led to numerous studies on the incidence and distribution of this bacterium in HIV infected and uninfected patients.31–36 Nevertheless, the potential clinical significance of M. fermentans infection requires further investigation. Our assay is designed to combine simple and rapid handling with high specificity and sensitivity and should therefore be a suitable tool for such investigations.

13

ACKNOWLEDGEMENTS We are grateful to D. Bitter-Suermann for continuous support. M.F. is supported by a professorship from the Hermann-and-Lilly-Schilling foundation.

REFERENCES 1. Williams, M. H., Brostoff, J. & Roitt, I. M. (1970). Possible role of Mycoplasma fermentans in pathogenesis of rheumatoid arthritis. Lancet ii, 277–80. 2. Murphy, W. H., Bullis, C., Dabich, L., Heyn, R. & Zarafonetis, C. J. D. (1970). Isolation of mycoplasma from leukemic and non leukemic patients. Journal of the National Cancer Institute 45, 243–51. 3. Somerson, N. L. & Cole, B. C. (1979). The mycoplasma flora of human and nonhuman primates. In: The Mycoplasmas. Vol. 2 (Tully, J. G. & Whitcomb, R. F. eds.) pp. 191–216. New York: Academic Press. 4. Lo, S.-C. (1986). Isolation and identification of a novel virus from patients with AIDS. American Journal of Tropical Medicine and Hygiene 35, 675–676. 5. Lo, S.-C., Wang, R. Y.-H., Newton III, P. B., Yang, N. Y., Sonoda, M. A. & Shih, J. W.-K. (1989). Fatal infection of silvered leaf monkeys with a virus-like infectious agent (VLIA) derived from a patient with AIDS. American Journal of Tropical Medicine and Hygiene 40, 399– 409. 6. Lo, S.-C., Shih, J. W.-K., Newton III, P. B. et al. (1989). Virus-like infectious agent (VLIA) is a novel pathogenic Mycoplasma: Mycoplasma incognitus. American Journal of Tropical Medicine and Hygiene 41, 586– 600. 7. Lo, S.-C., Dawson, M. S., Wong, D. M. et al. (1989). Identification of Mycoplasma incognitus infection in patients with AIDS: an immunohistochemical, in situ hybridization and ultrastructural study. American Journal of Tropical Medicine and Hygiene 41, 601–16. 8. Saillard, C., Carle, P., Bove´, J. M. et al. (1990). Genetic and serologic relatedness between Mycoplasma fermentans strains and a mycoplasma recently identified in tissues of AIDS and non-AIDS patients. Research in Virology 141, 385–95. 9. Beecham, H. J., Lo, S.-C., Lewis, D. E., Comer, S. W., Riley, K. J. & Oldfield, E. C. (1991). Recovery from fulminant infection with Mycoplasma fermentans (incognitus strain) in non-immunocompromised host. Lancet 338, 1014–15. 10. Lo, S.-C., Buchholz, C. L., Wear, D. J., Hohm, R. C. & Marty, A. M. (1991). Histopathology and Doxycycline treatment in a previously healthy non-AIDS patient systemically infected by Mycoplasma fermentans (incognitus strain). Modern Pathology 4, 750–4. 11. Sasaki, T., Sasaki, Y., Kita, M., Suzuki, K., Watanabe, H. & Honda, M. (1992). Evidence that Lo’s mycoplasma (Mycoplasma fermentans incognitus) is not a unique strain among Mycoplasma fermentans strains. Journal of Clinical Microbiology 30, 2435–40. 12. Lemaıˆtre, M., Henin, Y., Destouesse, F., Ferrieux, C., Montagnier, L. & Blanchard, A. (1992). Role of mycoplasma infection in the cytopathic effect induced by Human Immunodeficiency Virus Type I in infected cell lines. Infection and Immunity 60, 742–8.

14

S. Berg et al.

13. Lu¨neberg, E., Jensen, J. S. & Frosch, M. (1993). Detection of Mycoplasma pneumoniae by polymerase chain reaction and nonradioactive hybridization in microtiter plates. Journal of Clinical Microbiology 31, 1088–94. 14. Williams, M. H. (1968). Recovery of mycoplasma from rheumatoid synovial fluid. In: Third Pfizer Symposium on Rheumatic Diseases. pp. 161–189. Edinburgh University Press. 15. Murphy, W. H., Furtado, D. & Plata, E. (1965). Possible association between leukemia in children and viruslike agents. JAMA 191, 110–5. 16. Quentmeier, H., Schmitt, E., Kirchhoff, H., Grote, W. & Mu¨hlradt, P. F. (1990). Mycoplasma fermentans derived high-molecular-weight material induces interleukin-6 release in cultures of murine macrophages and human monocytes. Infection and Immunity 58, 1273–80. 17. Schmitt, K., Da¨ubener W., Bitter-Suermann, D. & Hadding, U. (1988). A safe and efficient method for elimination of cell culture mycoplasmas using ciprofloxacin. Journal of Immunological Methods 109, 17–25. 18. Wenzel, R. & Herrmann, R. (1988). Physical mapping of the Mycoplasma pneumoniae genome. Nucleic Acids Research 16, 8323–36. 19. Ausubel, F. M., Brent, R., Kingston et al. (1989). Current protocols in molecular biology. New York: WileyInterscience and Greene Publishing Associates. 20. Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the USA 74, 5463–7. 21. Yogev, D., Sela, S., Bercovier, H. & Razin, S. (1990). Nucleotide sequence and codon usage of the elongation factor Tu (EF-Tu) gene from Mycoplasma pneumoniae. Molecular Microbiology 4, 1303–10. 22. Lu¨neberg, E., Kamla, V., Hadding, U. & Frosch, M. (1991). Sequence and expression in Escherichia coli of a Mycoplasma hominis gene encoding elongation factor Tu. Gene 102, 123–7. 23. Loechel, S., Inamine, J. M. & Hu, P.-E. (1989). Nucleotide sequence of the tuf gene from Mycoplasma genitalium. Nucleic Acids Research 17, 10127. 24. Inamine, J. M., Loechel, S. & Hu, P.-C. (1989). Nucleotide sequence of the tuf gene from Mycoplasma gallisepticum. Nucleic Acids Research 17, 10126. 15. An, G. & Friesen, J. D. (1980). The nucleotide sequence of the tuf B and four nearby tRNA structural genes of Escherichia coli. Gene 12, 33–9. 26. Herrmann, R. (1992). Genome structure and organisation. In: Mycoplasmas: Molecular biology and

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

pathogenesis. (Maniloff, J., McElhaney, R. N., Finch, L. R. & Baseman, J. B., eds.) pp. 157–168. Washington: American Society for Microbiology. Hu, W. S., Wang, R. Y.-H., Liou, R.-S., Shih, J. W.-K. & Lol, S.-C. (1990). Identification of an insertionsequence-like genetic element in the newly recognized human pathogen Mycoplasma incognitus. Gene 93, 67–72. Wang, R. Y.-H., Hu, W. S., Dawson, M. S., Shih, J. W.-K. & Lo, S.-C. (1992). Selective detection of Mycoplasma fermentans by polymerase chain reaction and by using a nucleotide sequence within the insertion sequence-like element. Journal of Clinical Microbiology 30, 245–248. Hawkins, R. E., Rickman, L. S., Vermund, S. H. & Carl, M. (1992). Association of mycoplasma and human immunodeficiency virus infection: detection of amplified Mycoplasma fermentans DNA in blood. The Journal of Infectious Diseases 165, 581–5. Katseni, V. L., Gilroy, C. B., Ryait, B. K. et al. (1993). Mycoplasma fermentans in individuals seropositive and seronegative for HIV-1. Lancet 341, 271–3. Teel, L. D. Finelli, M. R. & Johnson, S. C. (1994). Isolation of Mycoplasma species from bronchoalveolar lavages of patients positive and negative for human immunodeficiency virus. Journal of Clinical Microbiology 32, 1387–9. Blanchard, A., Hamrick, W., Duffy, L., Baldus, K. & Cassell, G. H. (1993). Use of the polymerase chain reaction for detection of Mycoplasma fermentans and Mycoplasma genitalium in the urogenital tract and amniotic fluid. Clinical Infectious Diseases 17 (Suppl. 1), 272–9. Dussurget O. & Roulland-Dussoix, D. (1994). Rapid, sensitive PCR-based detection of mycoplasmas in simulated samples of animal sera. Applied and Environmental Microbiology 60, 953–9. Montagnier L. & Blanchard, A. (1993). Mycoplasmas as cofactors in infection due to the Human Immunodeficiency Virus. Clinical Infectious Diseases 17 (Suppl. 1), 309–15. Bauer, F. A., Wear, D. J., Angritt, P. & Lo, S.-C. (1991). Mycoplasma fermentans (incognitus strain) infection in the kidney of patients with acquired immunodeficiency syndrome and associated nephropathy. Human Pathology 22, 63–69. Miller-Catchpole, R., Shattuck, M., Kandalaft, P., Variakojis, D., Anastasi, J. & Abrahams, C. (1991). The incidence and distribution of Mycoplasma fermentans (incognitus strain) in the Chicago AIDS autopsy series: an immunohistochemical study. Modern Pathology 4, 481–6.