- Email: [email protected]
Development of an improved reverse genetics system for Akabane bunyavirus
Journal of Virological Methods 232 (2016) 16–20
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Short communication
Development of an improved reverse genetics system for Akabane bunyavirus Akiko Takenaka-Uema a,b , Keita Sugiura a , Norasuthi Bangphoomi a,c , Chieko Shioda d , Kazuyuki Uchida d , Kentaro Kato a,e , Takeshi Haga b , Shin Murakami a , Hiroomi Akashi a,∗ , Taisuke Horimoto a,∗ a Department of Veterinary Microbiology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan b Department of Infection Control and Disease Prevention, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan c Department of Preclinical and Applied Animal Science, Faculty of Veterinary Science, Mahidol University, 999 Phutthamonthon Sai 4 Road Salaya, Phutthamonthon Nakhonpathom 73170, Thailand d Department of Veterinary Pathology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan e Research Unit for Global Infection Control, National Research Center for Protozoan Diseases, Obihiro University of Agriculture and Veterinary Medicine, Inada-cho, Obihiro, Hokkaido 080-8555, Japan
a b s t r a c t Article history: Received 1 July 2015 Received in revised form 15 December 2015 Accepted 17 December 2015 Available online 27 February 2016 Keywords: Akabane virus Reverse genetics Vaccine
Akabane disease, caused by the insect-transmitted Akabane virus (AKAV), affects livestock by causing life-threatening deformities or mortality of fetuses. Therefore, Akabane disease has led to notable economic losses in numerous countries, including Japan. In this short communication, a new T7 RNA polymerase-based AKAV reverse genetics system was developed. Using this system, in which three plasmids transcribing antigenomic RNAs were transfected into cells stably expressing T7 polymerase, we successfully reconstituted the live attenuated vaccine TS-C2 strain (named rTTT), and also generated a mutant AKAV (rTTTNSs) that lacked the gene encoding the nonstructural NSs protein, which is regarded as a virulence factor. Analysis of growth kinetics revealed that rTTTNSs grew at a much slower rate than the rTTT and TS-C2 virus. These results suggest that our established reverse genetics system is a powerful tool that can be used for AKAV vaccine studies with gene-manipulated viruses. © 2016 Elsevier B.V. All rights reserved.
Akabane virus (AKAV) was first isolated in Japan in 1959 (Oya et al., 1961) and was classified in the genus Orthobunyavirus, family Bunyaviridae. Transmission of AKAV occurs in cows, ewes, and goats, primarily through biting midges, in Australia, Southeast Asia, East Asia, the Middle East, and Africa. During pregnancy, AKAV is able to cross the placenta, causing congenital deformities such as arthrogryposis-hydranencephaly syndrome, abortion, premature birth, and stillbirth (Kurogi et al., 1976). These virus-induced
∗ Corresponding authors. Fax: +81 3 5841 8184. E-mail addresses: [email protected] (A. Takenaka-Uema), sugiura [email protected] (K. Sugiura), [email protected] (N. Bangphoomi), chieko [email protected] (C. Shioda), [email protected] (K. Uchida), [email protected] (K. Kato), [email protected] (T. Haga), [email protected] (S. Murakami), [email protected] (H. Akashi), [email protected] (T. Horimoto). http://dx.doi.org/10.1016/j.jviromet.2015.12.014 0166-0934/© 2016 Elsevier B.V. All rights reserved.
complications have been the cause of great economic losses in the livestock industry (Inaba et al., 1975). Although vaccination has reduced the prevalence of Akabane disease, frequent cases still occur in Japan and Korea (Inaba and Matumoto, 1990; Kim et al., 2011). Moreover, antigenic and pathogenic variants of AKAV have been isolated (Akashi and Inaba, 1997; Kamata et al., 2009; Lee et al., 2002; Liao et al., 1996; Miyazato et al., 1989; Ogawa et al., 2007a; Yamakawa et al., 2006). For example, a variant Iriki strain was isolated from a calf presenting non-suppurative encephalitis and neurological symptoms in Japan (Miyazato et al., 1989). The Iriki strain showed low cross-reactivity with antiserum against the current vaccine strain of AKAV in the neutralization tests, suggesting that this and other variants may be the cause of virus persistence even in areas where vaccines are administered. Therefore, it is necessary to reconsider the vaccine strategy to control the disease effectively.
A. Takenaka-Uema et al. / Journal of Virological Methods 232 (2016) 16–20
17
Fig. 1. Construction of recombinant AKAVs. (A) Schematic representation of the nonstructural NSs protein translational start site in the S RNA segment. The NSs start codon was mutated to ablate NSs translation without affecting the amino acid sequence of the nucleoprotein (N). (B) Genetic marker for recombinant AKAV lacking NSs. The mutation in rTTTNSs generates a new HpyCH4IV restriction site, which is underlined in (A). After RNA was extracted from the infected cells, RT-PCR was performed to amplify the 344-bp fragment of the NSs open reading frame. No band was observed in the control sample without an RT reaction. HpyCH4IV digestion of the RT-PCR product from rTTTNSs yielded two fragments (60 bp and 284 bp).
Members of the genus Orthobunyavirus have a genome comprising three unique species of single-stranded RNA, designated as S (small), M (medium), and L (large). The L RNA segment of AKAV encodes RNA-dependent RNA polymerase (L protein), while the M segment encodes envelope glycoproteins Gn and Gc and a nonstructural NSm protein. The envelope glycoproteins are responsible for virus neutralization and attachment to mammalian or insect cells (Ludwig et al., 1991). The S segment encodes a nucleoprotein (N), which shares antigenic determinants with the nucleoproteins of some other species in the genus (Akashi et al., 1997), and a nonstructural NSs protein, which acts as a type I interferon antagonist and is involved in the regulation of host protein synthesis, thereby functioning as a virulence factor (Weber et al., 2002). Reverse genetics systems are useful for studying basic mechanisms as well as practical applications for many viruses, albeit they occasionally pose technical difficulties for negative-sense RNA viruses. We previously developed an RNA polymerase I-based reverse genetics system using the OBE-1 strain for AKAV (Ogawa et al., 2007c). However, its efficiency for virus rescue was substandard, lacking the robustness of the reverse genetics system. To address this flaw, we sought to establish a T7 RNA polymerasebased reverse-genetics system, which has provecd to be effective in rescuing other bunyaviruses (Blakqori and Weber, 2005; Bridgen and Elliott, 1996; Ikegami et al., 2006) We selected the TS-C2 vaccine strain (Kurogi et al., 1979) (purchased from the National Veterinary Assay Laboratory) as the donor virus for development of the reverse genetics system in this study, since this system may be used to generate potential AKAV vaccine candidates in the future. For example, vaccine candidates such as reassortants having the S and L segments of TS-C2 and M segment of the antigenic variants can be easily constructed by using the reverse
Fig. 2. Characterization of recombinant AKAVs. (A) Plaque sizes of recombinant viruses. The results are shown for 50 randomly selected plaques for each virus. The mean plaque sizes are represented by open circles (*, P < 0.05; two-tailed Student’s t-test). (B) Growth kinetics of wt and recombinant viruses. HmLu-1 cells were infected with each virus at an MOI of 0.01. Supernatants were collected at the time points shown, and the number of PFUs was determined. The results shown are the means ± SD of three independent experiments.
genetics system. First, we determined both end sequences of the viral genome, which were required for cloning of viral cDNAs into plasmids for reverse genetics. To this end, viral RNA was extracted from virions in the supernatant of hamster lung (HmLu-1) cells infected with the TS-C2 strain using the Viral RNA mini kit (Qiagen, Hilden, Germany). The RNA was transcribed by SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA) using specific primers designed based on the OBE-1 sequence (Ogawa et al., 2007b) (Table 1, RT), after which poly C tails were added using the 5 RACE system (Invitrogen). Next, we performed PCR amplification of the cDNA ends with GoTaq Green Master Mix (Promega, Madison, WI, USA) using the anchor and gene-specific primers (Table 1, first PCR). The abridged universal primer, which is homologous to the adapter region of the anchor primer, and other specific primers (Table 1, nested PCR) were used for the second amplification reactions of both ends. All fragments were cloned into pCR2.1-TOPO (Invitrogen) and sequenced using standard protocols (3130xl Genetic Analyzer; Applied Biosystems, Foster City, CA, USA). We then amplified full-length cDNAs of the TS-C2 strain by LA Taq polymerase (TaKaRa Bio, Shiga, Japan) using gene-specific primer sets (Table 1), TA cloned, and sequenced. The GenBank accession numbers assigned to the TS-C2 strain sequences are
18
A. Takenaka-Uema et al. / Journal of Virological Methods 232 (2016) 16–20
Table 1 Primers used to clone AKAV TS-C2 strain RNA fragments.
3 - or 5 -end amplification
RNA segment
Primer
Amplification reaction
Sequence (5 -3 )
Nucleotides (OBE-1)
L
L-10R L-4R L-60F L3 NCR-R1 L5 RACE M-5R M-35F M303–284 M4059–4080 S-8R S-0F S400–381 S459–478
RT first PCR RT, first PCR Nested PCR Nested PCR RT, first PCR RT, first PCR Nested PCR Nested PCR RT, first PCR RT, first PCR Nested PCR Nested PCR
CAATGGCTTTAAATGCGTCC TCTCATAATCCAGGCCCAAT GCCTACAAGTAGCTGTTAGC GTTGTATGTTGTATTTA CCCTGGATATCGATAATGAA GTTATCCAGATCTATAGAGA CTACTATTCCTGCGCTAC TCTTGAACTGGATTGCACTC AACCATTATGGAATGAGTTAAG ATAGACATGGTGCACTTAGG CATTTTCAACGATGTTCCAC CAATTGTGGCAGCTGCCTCT GGGATTTGCCCCTGGTGCTG
1063–1044 400–381 5981–6000 30–14 6643–6662 514–495 3535–3552 303–284 4059–4080 791–772 48–67 400–381 459–478
T7riboSM2-LF pT7riboSM2-LR T7riboSM2-MF2 T7riboSM2-MR2/TSC T7riboSM2-SF T7riboSM2-SR2
RT, PCR PCR RT, PCR PCR RT, PCR PCR
aatcgtctcctatagAGTAGTGTACCCCTAAATACAACATACA aatcgtctccacccAGTAGTGTGCCCCTAAATGCAATAATAT aatcgtctcctatagAGTAGTGAACTACCACAACAAAATGATTATTACAA aatcgtctccacccAGTAGTGTCCTACCACAACAAATAATTATTATATCAGCA aatcgtctcctatagAGTAGTGAACT aatcgtctccacccAGTAGTGTTCT
1–28 6868–6841 1–35 4309–4271 1–27 858–832
M
S
Full-length cloning
L M S
Restriction sites are underlined. Table 2 Sequence differences between the TS-C2 and OBE-1 strains. Segment
OBE-1/nt position/TS-C2
OBE-1/aa position/TS-C2
Gene
S
T432C – T754 del
– – –
N NSs 5 NCR
M
C78A A549G C1155T G1163C T1164C G1191A G1225A T1325C G1384T A1433G A1893G G2556A C3271T G3641A C3658T G3690T A4013G A4301G
P19H K176R T378I V381P – R390Q M401I C435R L454F K471E E624G G845D – V1207I – W1313L T1331A –
Gn
T2088A A2673G G4232A C4599T T4700C A4878C A5648G C5697T G5736A T6244C G6600A
– – G1401E – I1557T Q1616H N1873S – – S2072P M2190I
RdRp
L
NSm
Gc
5 NCR
OBE-1; GenBank accession numbers: AB190458.1, AB100604.1, and AB000851.1.
AB968525, AB968526, and AB968527. Genome sequence of the TSC2 possessed considerable differences from database sequence of its parent OBE-1 strain, as shown in Table 2. Within the open reading frame of each segment, sequence similarities were 99.6–99.9% at the nucleotide level and 99.0–100% at the amino acid level. To generate recombinant viruses using the T7 polymerasedriven reverse genetics, the L-, M-, and S-segment cDNAs of the TS-C2 strain were inserted into the pT7riboSM2 vector (Habjan et al., 2008) at the Esp3I restriction site, yielding pT7riboSM2/TL,
−/TM, and −/TS, respectively. These plasmids transcribe full-length anti-genomic sense RNA segments driven by T7 polymerase, with the 3 ends trimmed by the hepatitis delta virus ribozyme. Thus, we assessed the ability of these three plasmids to effectively rescue the virus in our reverse genetics system. To start, subconfluent layers of baby hamster kidney cells expressing T7 RNA polymerase (BHK/T7-9) (Ito et al., 2003) were grown in six-well plates. Each well was transfected with 1.2 g of pT7riboSM2/TL, 0.6 g of pT7riboSM2/TM, and 1.2 g of pT7riboSM2/TS using 9 L of TransIT-LT1 reagent (Mirus Bio LLC, Madison, WI, USA) in 200 L of Opti-MEM (Life Technologies Japan, Tokyo, Japan). Transfected cells were cultivated at 37 ◦ C and, at 6 days post transfection (dpt), BHK/T7-9 cells were overlaid on the transfected cells. Two days later, extensive cytopathic effects were observed and the infectious virus (named rTTT) was recovered in culture supernatants at a titer of 8.6 × 103 PFU/mL, indicating that supporting plasmids that express viral proteins are not required in this system. This was also demonstrated in other T7 polymerase-based bunyavirus reverse genetics systems (Blakqori and Weber, 2005; Ikegami et al., 2006; Lowen et al., 2004), albeit not in our previous polymerase I-based system which required supporting plasmids (Ogawa et al., 2007c). The rTTT viruses were plaque purified three times. We also inserted the L-, M-, and S-segment cDNAs of the OBE-1 strain into the pT7riboSM2 vector, and the resultant plasmids were named pT7riboSM2/OL, −/OM, and −/OS, respectively. Using these three plasmids, recombinant OBE-1 virus was rescued by the T7 polymerase-based system using the same procedures as that used for the rescue of rTTT virus. The primers for cloning were prepared based on database sequences (provided upon request). To authenticate our T7 polymerase-based system, we sought to generate an AKAV mutant virus not expressing the NSs gene, which is considered a virulence factor, but is not essential for virus growth (Ogawa et al., 2007c). We constructed the plasmid for the system and abolished NSs expression without altering the N amino acid sequence by changing the ATG start codon (nucleotides [nt] 59–61 of the S cDNA) to ACG in pT7riboSM2/TS using the QuikChange II kit (Agilent Technologies, Palo Alto, CA, USA) to generate pT7riboSM2/TSNSs. Using this plasmid, we carried out reverse genetics protocols under the same conditions as those with rTTT rescue, resulting in generation of a mutant TS-C2 virus (rTTTNSs) with a titer of 1.4 × 104 PFU/mL in culture supernatants of the transfected cells. The rTTTNSs viruses were plaque puri-
A. Takenaka-Uema et al. / Journal of Virological Methods 232 (2016) 16–20
fied three times. To confirm that rTTTNSs was derived from the cDNA, we distinguished rTTT and rTTTNSs by HpyCH4IV restriction analysis, as mutagenesis of the NSs start site created a unique recognition site for this enzyme (Fig. 1A). RT-PCR products with HpyCH4IV digestion showed that rTTTNSs carried this restriction site in the S segment (Fig. 1B). Direct sequencing of the RT-PCR product also confirmed the substitution with no unwanted mutations. Our next step was to examine growth kinetics and plaque sizes of the recombinant viruses. Sub-confluent monolayers of HmLu-1 cells were infected with the wild-type (wt) TS-C2 strain and recombinant viruses at a multiplicity of infection (MOI) of 0.01 for 1 h at 37 ◦ C. The infected cells were washed with PBS and overlaid with serum-free medium. At different time points (12, 24, 36, 48, and 60 h) post infection, supernatants were harvested. The number of plaque forming units (PFUs) was determined, as previously described (Kurogi et al., 1979). These experiments were performed in triplicate. To examine the differences in plaque morphology between the viruses, cells were infected with the wt or recombinant viruses and overlaid with DMEM containing 0.8% agar and 2% fetal calf serum, and then stained with neutral red four days later. The TS-C2 virus formed variable plaque sizes compared to the rTTT and rTTTNSs viruses, suggesting that the TS-C2 virus contains a mixed virus population. Although subtle variations existed in the plaque sizes of the biologically cloned viruses, rTTTNSs typically formed smaller plaques than rTTT (Fig. 2A). Moreover, analysis of the growth kinetics of the viruses in HmLu-1 cells revealed that rTTTNSs grew at a slower rate than rTTT and the wt virus, TS-C2. These findings are indicative of lower rTTTNSs viral replication. Nevertheless, rTTTNSs reached a maximal yield at 48 h post infection, which was equivalent to those of the other two viruses (Fig. 2B). In this study, we first applied a T7 polymerase-based reverse genetics method to AKAV. This method has been reported for other bunyaviruses, such as Bunyamwera virus, La Crosse virus, and Rift Valley fever virus (Blakqori and Weber, 2005; Bridgen and Elliott, 1996; Ikegami et al., 2006; Lowen et al., 2004), and we successfully used it to generate recombinant viruses. Compared to our previous polymerase I-based system, this system appears to be superior since the number of plasmids required for transfection protocols is lower (three plasmids in this system vs. five plasmids in the previous system), resulting in high transfection efficiency and robust virus rescue. When we examined the rescue efficacy of the polymerase I-based system using OBE-1 (Ogawa et al., 2007c), the parent strain of TC-S2, virus titers in the culture supernatant of the transfected cells were less than 1 PFU/mL in total, even after overlay of fresh cells to the transfected cells that proved to be the considerable step increasing virus rescue efficacy in T7 polymerase-based system, and in some trials, we were unable to rescue any recombinant virus. In contrast, the T7 polymerase-based system robustly rescued recombinant OBE-1 virus. In every trial, recombinant virus could be rescued at a titer of more than 103 PFU/mL. We propose that our T7 polymerase-based reverse genetics method will be valuable for basic viral research as well as practical application studies for AKAV. For example, our system may provide powerful tools for analyzing the mechanisms regulating AKAV attenuation. Indeed, differences in the TS-C2 and OBE-1 strains were found in the amino acid sequence of the M and L segments. In the future, a reverse genetics reassortment study will identify the factors responsible for the attenuation of the TS-C2 vaccine strain. Since NSs have been proposed to act as an AKAV virulence factor (Ogawa et al., 2007c), we can hypothesize that deletion of NSs from the TS-C2 strain will result in a more attenuated phenotype. Theoretically, any virus used for a live vaccine should contain multiple altered genetic loci in order to prevent reversion to virulence. Additionally, vaccines based on recombinant viruses lacking
19
NSs, such as rTTTNSs, may allow for differentiation between infected and vaccinated animals (DIVA), if NSs antibodies can be consistently detected in animals infected with the wt virus, but not in vaccinated animals. In the case of Rift Valley fever virus, although NSs-defective vaccines can be used for DIVA (McElroy et al., 2009), this differentiation is limited to herds with large numbers of animals owing to the inconsistent induction of NSs antibodies (Fernandez et al., 2012). Evaluation of the potential for DIVA with an NSs-defective vaccine strain against Akabane virus infection is an important goal for future studies. In conclusion, genetically manipulated viruses produced by reverse genetics technology can be used to establish nextgeneration vaccination strategies. In this way, our established reverse genetics system is a powerful tool, which can be used for vaccine studies targeting Akabane disease. Acknowledgements We thank Dr. Ito of the Laboratory of Zoonotic Diseases, Gifu University, Japan, for providing BHK/T7-9 cells and Dr. Weber of the Department of Virology, University of Freiburg, Freiburg, Germany, for providing pT7riboSM2. This study was supported in part by a Research and Development Project for Application in Promoting New Policies in Agriculture, Forestry and Fisheries grant from the Ministry of Agriculture, Forestry and Fisheries, and a Grant-inAid from the Ministry of Education, Culture, Sports, Science and Technology of Japan. References Akashi, H., Inaba, Y., 1997. Antigenic diversity of Akabane virus detected by monoclonal antibodies. Virus Res. 47, 187–196. Akashi, H., Kaku, Y., Kong, X., Pang, H., 1997. Antigenic and genetic comparisons of Japanese and Australian Simbu serogroup viruses: evidence for the recovery of natural virus reassortants. Virus Res. 50, 205–213. Blakqori, G., Weber, F., 2005. Efficient cDNA-based rescue of La Crosse bunyaviruses expressing or lacking the nonstructural protein NSs. J. Virol. 79, 10420–10428. Bridgen, A., Elliott, R.M., 1996. Rescue of a segmented negative-strand RNA virus entirely from cloned complementary DNAs. Proc. Natl. Acad. Sci. U. S. A. 93, 15400–15404. Fernandez, J.C., Billecocq, A., Durand, J.P., Cêtre-Sossah, C., Cardinale, E., Marianneau, P., Pépin, M., Tordo, N., Bouloy, M., 2012. The nonstructural protein NSs induces a variable antibody response in domestic ruminants naturally infected with Rift Valley fever virus. Clin. Vaccine Immunol. 19, 5–10. Habjan, M., Penski, N., Spiegel, M., Weber, F., 2008. T7 RNA polymerase-dependent and -independent systems for cDNA-based rescue of Rift Valley fever virus. J. Gen. Virol. 89, 2157–2166. Ikegami, T., Won, S., Peters, C.J., Makino, S., 2006. Rescue of infectious rift valley fever virus entirely from cDNA, analysis of virus lacking the NSs gene, and expression of a foreign gene. J. Virol. 80, 2933–2940. Inaba, Y., Kurogi, H., Omori, T., 1975. Letter Akabane disease: epizootic abortion, premature birth, stillbirth and congenital arthrogryposis-hydranencephaly in cattle, sheep and goats caused by Akabane virus. Aust. Vet. J. 51, 584–585. Inaba, Y., Matumoto, M., 1990. Akabane virus. In: Dinter, Z., Morein, B. (Eds.), In Virus Infections of Ruminants, vol. 3. Elsevier Science Publishers, Amsterdam, the Netherlands, pp. 467–480. Ito, N., Takayama-Ito, M., Yamada, K., Hosokawa, J., Sugiyama, M., Minamoto, N., 2003. Improved recovery of rabies virus from cloned cDNA using a vaccinia virus-free reverse genetics system. Microbiol. Immunol. 47, 613–617. Kamata, H., Inai, K., Maeda, K., Nishimura, T., Arita, S., Tsuda, T., Sato, M., 2009. Encephalomyelitis of cattle caused by Akabane virus in southern Japan in 2006. J. Comp. Pathol. 140, 187–193. Kim, Y.H., Kweon, C.H., Tark, D.S., Lim, S.I., Yang, D.K., Hyun, B.H., Song, J.Y., Hur, W., Park, S.C., 2011. Development of inactivated trivalent vaccine for the teratogenic Aino, Akabane and Chuzan viruses. Biologicals 39, 152–157. Kurogi, H., Inaba, Y., Takahashi, E., Sato, K., Akashi, H., Satoda, K., Omori, T., 1979. An attenuated strain of Akabane virus: a candidate for live virus vaccine. Natl. Inst. Anim. Health Q. (Tokyo) 19, 12–22. Kurogi, H., Inaba, Y., Takahashi, E., Sato, K., Omori, T., Miura, Y., Goto, Y., Fujiwara, Y., Hatano, Y., Kodama, K., Fukuyama, S., Sasaki, N., Matumoto, M., 1976. Epizootic congenital arthrogryposis-hydranencephaly syndrome in cattle: isolation of Akabane virus from affected fetuses. Arch. Virol. 51, 67–74. Lee, J.K., Park, J.S., Choi, J.H., Park, B.K., Lee, B.C., Hwang, W.S., Kim, J.H., Jean, Y.H., Haritani, M., Yoo, H.S., Kim, D.Y., 2002. Encephalomyelitis associated with akabane virus infection in adult cows. Vet. Pathol. 39, 269–273. Liao, Y.K., Lu, Y.S., Goto, Y., Inaba, Y., 1996. The isolation of Akabane virus (Iriki strain) from calves in Taiwan. J. Basic Microbiol. 36, 33–39.
20
A. Takenaka-Uema et al. / Journal of Virological Methods 232 (2016) 16–20
Lowen, A.C., Noonan, C., McLees, A., Elliott, R.M., 2004. Efficient bunyavirus rescue from cloned cDNA. Virology 330, 493–500. Ludwig, G.V., Israel, B.A., Christensen, B.M., Yuill, T.M., Schultz, K.T., 1991. Role of La Crosse virus glycoproteins in attachment of virus to host cells. Virology 181, 564–571. ˜ C.G., Nichol, S.T., 2009. Development of a RVFV ELISA that McElroy, A.K., Albarino, can distinguish infected from vaccinated animals. Virol. J. 6, 125. Miyazato, S., Miura, Y., Hase, M., Kubo, M., Goto, Y., Kono, Y., 1989. Encephalitis of cattle caused by Iriki isolate: a new strain belonging to Akabane virus. Jpn. J. Vet. Sci. 51, 128–136. Ogawa, Y., Fukutomi, T., Sugiura, K., Kato, K., Tohya, Y., Akashi, H., 2007a. Comparison of Akabane virus isolated from sentinel cattle in Japan. Vet. Microbiol. 124, 16–24.
Ogawa, Y., Kato, K., Tohya, Y., Akashi, H., 2007b. Sequence determination and functional analysis of the Akabane virus (family Bunyaviridae) L RNA segment. Arch. Virol. 152, 971–979. Ogawa, Y., Sugiura, K., Kato, K., Tohya, Y., Akashi, H., 2007c. Rescue of Akabane virus (family Bunyaviridae) entirely from cloned cDNAs by using RNA polymerase I. J. Gen. Virol. 88, 3385–3390. Oya, A., Okuno, T., Ogata, T., Kobayashi, I., Matsuyama, T., 1961. Akabane: a new arbor virus isolated in Japan. Jpn. J. Med. Sci. Biol. 14, 101–108. Weber, F., Bridgen, A., Fazakerley, J.K., Streitenfeld, H., Kessler, N., Randall, R.E., Elliott, R.M., 2002. Bunyamwera bunyavirus nonstructural protein NSs counteracts the induction of alpha/beta interferon. J. Virol. 76, 7949–7955. Yamakawa, M., Yanase, T., Kato, T., Tsuda, T., 2006. Chronological and geographical variations in the small RNA segment of the teratogenic Akabane virus. Virus Res. 121, 84–92.
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Short communication
Development of an improved reverse genetics system for Akabane bunyavirus Akiko Takenaka-Uema a,b , Keita Sugiura a , Norasuthi Bangphoomi a,c , Chieko Shioda d , Kazuyuki Uchida d , Kentaro Kato a,e , Takeshi Haga b , Shin Murakami a , Hiroomi Akashi a,∗ , Taisuke Horimoto a,∗ a Department of Veterinary Microbiology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan b Department of Infection Control and Disease Prevention, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan c Department of Preclinical and Applied Animal Science, Faculty of Veterinary Science, Mahidol University, 999 Phutthamonthon Sai 4 Road Salaya, Phutthamonthon Nakhonpathom 73170, Thailand d Department of Veterinary Pathology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan e Research Unit for Global Infection Control, National Research Center for Protozoan Diseases, Obihiro University of Agriculture and Veterinary Medicine, Inada-cho, Obihiro, Hokkaido 080-8555, Japan
a b s t r a c t Article history: Received 1 July 2015 Received in revised form 15 December 2015 Accepted 17 December 2015 Available online 27 February 2016 Keywords: Akabane virus Reverse genetics Vaccine
Akabane disease, caused by the insect-transmitted Akabane virus (AKAV), affects livestock by causing life-threatening deformities or mortality of fetuses. Therefore, Akabane disease has led to notable economic losses in numerous countries, including Japan. In this short communication, a new T7 RNA polymerase-based AKAV reverse genetics system was developed. Using this system, in which three plasmids transcribing antigenomic RNAs were transfected into cells stably expressing T7 polymerase, we successfully reconstituted the live attenuated vaccine TS-C2 strain (named rTTT), and also generated a mutant AKAV (rTTTNSs) that lacked the gene encoding the nonstructural NSs protein, which is regarded as a virulence factor. Analysis of growth kinetics revealed that rTTTNSs grew at a much slower rate than the rTTT and TS-C2 virus. These results suggest that our established reverse genetics system is a powerful tool that can be used for AKAV vaccine studies with gene-manipulated viruses. © 2016 Elsevier B.V. All rights reserved.
Akabane virus (AKAV) was first isolated in Japan in 1959 (Oya et al., 1961) and was classified in the genus Orthobunyavirus, family Bunyaviridae. Transmission of AKAV occurs in cows, ewes, and goats, primarily through biting midges, in Australia, Southeast Asia, East Asia, the Middle East, and Africa. During pregnancy, AKAV is able to cross the placenta, causing congenital deformities such as arthrogryposis-hydranencephaly syndrome, abortion, premature birth, and stillbirth (Kurogi et al., 1976). These virus-induced
∗ Corresponding authors. Fax: +81 3 5841 8184. E-mail addresses: [email protected] (A. Takenaka-Uema), sugiura [email protected] (K. Sugiura), [email protected] (N. Bangphoomi), chieko [email protected] (C. Shioda), [email protected] (K. Uchida), [email protected] (K. Kato), [email protected] (T. Haga), [email protected] (S. Murakami), [email protected] (H. Akashi), [email protected] (T. Horimoto). http://dx.doi.org/10.1016/j.jviromet.2015.12.014 0166-0934/© 2016 Elsevier B.V. All rights reserved.
complications have been the cause of great economic losses in the livestock industry (Inaba et al., 1975). Although vaccination has reduced the prevalence of Akabane disease, frequent cases still occur in Japan and Korea (Inaba and Matumoto, 1990; Kim et al., 2011). Moreover, antigenic and pathogenic variants of AKAV have been isolated (Akashi and Inaba, 1997; Kamata et al., 2009; Lee et al., 2002; Liao et al., 1996; Miyazato et al., 1989; Ogawa et al., 2007a; Yamakawa et al., 2006). For example, a variant Iriki strain was isolated from a calf presenting non-suppurative encephalitis and neurological symptoms in Japan (Miyazato et al., 1989). The Iriki strain showed low cross-reactivity with antiserum against the current vaccine strain of AKAV in the neutralization tests, suggesting that this and other variants may be the cause of virus persistence even in areas where vaccines are administered. Therefore, it is necessary to reconsider the vaccine strategy to control the disease effectively.
A. Takenaka-Uema et al. / Journal of Virological Methods 232 (2016) 16–20
17
Fig. 1. Construction of recombinant AKAVs. (A) Schematic representation of the nonstructural NSs protein translational start site in the S RNA segment. The NSs start codon was mutated to ablate NSs translation without affecting the amino acid sequence of the nucleoprotein (N). (B) Genetic marker for recombinant AKAV lacking NSs. The mutation in rTTTNSs generates a new HpyCH4IV restriction site, which is underlined in (A). After RNA was extracted from the infected cells, RT-PCR was performed to amplify the 344-bp fragment of the NSs open reading frame. No band was observed in the control sample without an RT reaction. HpyCH4IV digestion of the RT-PCR product from rTTTNSs yielded two fragments (60 bp and 284 bp).
Members of the genus Orthobunyavirus have a genome comprising three unique species of single-stranded RNA, designated as S (small), M (medium), and L (large). The L RNA segment of AKAV encodes RNA-dependent RNA polymerase (L protein), while the M segment encodes envelope glycoproteins Gn and Gc and a nonstructural NSm protein. The envelope glycoproteins are responsible for virus neutralization and attachment to mammalian or insect cells (Ludwig et al., 1991). The S segment encodes a nucleoprotein (N), which shares antigenic determinants with the nucleoproteins of some other species in the genus (Akashi et al., 1997), and a nonstructural NSs protein, which acts as a type I interferon antagonist and is involved in the regulation of host protein synthesis, thereby functioning as a virulence factor (Weber et al., 2002). Reverse genetics systems are useful for studying basic mechanisms as well as practical applications for many viruses, albeit they occasionally pose technical difficulties for negative-sense RNA viruses. We previously developed an RNA polymerase I-based reverse genetics system using the OBE-1 strain for AKAV (Ogawa et al., 2007c). However, its efficiency for virus rescue was substandard, lacking the robustness of the reverse genetics system. To address this flaw, we sought to establish a T7 RNA polymerasebased reverse-genetics system, which has provecd to be effective in rescuing other bunyaviruses (Blakqori and Weber, 2005; Bridgen and Elliott, 1996; Ikegami et al., 2006) We selected the TS-C2 vaccine strain (Kurogi et al., 1979) (purchased from the National Veterinary Assay Laboratory) as the donor virus for development of the reverse genetics system in this study, since this system may be used to generate potential AKAV vaccine candidates in the future. For example, vaccine candidates such as reassortants having the S and L segments of TS-C2 and M segment of the antigenic variants can be easily constructed by using the reverse
Fig. 2. Characterization of recombinant AKAVs. (A) Plaque sizes of recombinant viruses. The results are shown for 50 randomly selected plaques for each virus. The mean plaque sizes are represented by open circles (*, P < 0.05; two-tailed Student’s t-test). (B) Growth kinetics of wt and recombinant viruses. HmLu-1 cells were infected with each virus at an MOI of 0.01. Supernatants were collected at the time points shown, and the number of PFUs was determined. The results shown are the means ± SD of three independent experiments.
genetics system. First, we determined both end sequences of the viral genome, which were required for cloning of viral cDNAs into plasmids for reverse genetics. To this end, viral RNA was extracted from virions in the supernatant of hamster lung (HmLu-1) cells infected with the TS-C2 strain using the Viral RNA mini kit (Qiagen, Hilden, Germany). The RNA was transcribed by SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA) using specific primers designed based on the OBE-1 sequence (Ogawa et al., 2007b) (Table 1, RT), after which poly C tails were added using the 5 RACE system (Invitrogen). Next, we performed PCR amplification of the cDNA ends with GoTaq Green Master Mix (Promega, Madison, WI, USA) using the anchor and gene-specific primers (Table 1, first PCR). The abridged universal primer, which is homologous to the adapter region of the anchor primer, and other specific primers (Table 1, nested PCR) were used for the second amplification reactions of both ends. All fragments were cloned into pCR2.1-TOPO (Invitrogen) and sequenced using standard protocols (3130xl Genetic Analyzer; Applied Biosystems, Foster City, CA, USA). We then amplified full-length cDNAs of the TS-C2 strain by LA Taq polymerase (TaKaRa Bio, Shiga, Japan) using gene-specific primer sets (Table 1), TA cloned, and sequenced. The GenBank accession numbers assigned to the TS-C2 strain sequences are
18
A. Takenaka-Uema et al. / Journal of Virological Methods 232 (2016) 16–20
Table 1 Primers used to clone AKAV TS-C2 strain RNA fragments.
3 - or 5 -end amplification
RNA segment
Primer
Amplification reaction
Sequence (5 -3 )
Nucleotides (OBE-1)
L
L-10R L-4R L-60F L3 NCR-R1 L5 RACE M-5R M-35F M303–284 M4059–4080 S-8R S-0F S400–381 S459–478
RT first PCR RT, first PCR Nested PCR Nested PCR RT, first PCR RT, first PCR Nested PCR Nested PCR RT, first PCR RT, first PCR Nested PCR Nested PCR
CAATGGCTTTAAATGCGTCC TCTCATAATCCAGGCCCAAT GCCTACAAGTAGCTGTTAGC GTTGTATGTTGTATTTA CCCTGGATATCGATAATGAA GTTATCCAGATCTATAGAGA CTACTATTCCTGCGCTAC TCTTGAACTGGATTGCACTC AACCATTATGGAATGAGTTAAG ATAGACATGGTGCACTTAGG CATTTTCAACGATGTTCCAC CAATTGTGGCAGCTGCCTCT GGGATTTGCCCCTGGTGCTG
1063–1044 400–381 5981–6000 30–14 6643–6662 514–495 3535–3552 303–284 4059–4080 791–772 48–67 400–381 459–478
T7riboSM2-LF pT7riboSM2-LR T7riboSM2-MF2 T7riboSM2-MR2/TSC T7riboSM2-SF T7riboSM2-SR2
RT, PCR PCR RT, PCR PCR RT, PCR PCR
aatcgtctcctatagAGTAGTGTACCCCTAAATACAACATACA aatcgtctccacccAGTAGTGTGCCCCTAAATGCAATAATAT aatcgtctcctatagAGTAGTGAACTACCACAACAAAATGATTATTACAA aatcgtctccacccAGTAGTGTCCTACCACAACAAATAATTATTATATCAGCA aatcgtctcctatagAGTAGTGAACT aatcgtctccacccAGTAGTGTTCT
1–28 6868–6841 1–35 4309–4271 1–27 858–832
M
S
Full-length cloning
L M S
Restriction sites are underlined. Table 2 Sequence differences between the TS-C2 and OBE-1 strains. Segment
OBE-1/nt position/TS-C2
OBE-1/aa position/TS-C2
Gene
S
T432C – T754 del
– – –
N NSs 5 NCR
M
C78A A549G C1155T G1163C T1164C G1191A G1225A T1325C G1384T A1433G A1893G G2556A C3271T G3641A C3658T G3690T A4013G A4301G
P19H K176R T378I V381P – R390Q M401I C435R L454F K471E E624G G845D – V1207I – W1313L T1331A –
Gn
T2088A A2673G G4232A C4599T T4700C A4878C A5648G C5697T G5736A T6244C G6600A
– – G1401E – I1557T Q1616H N1873S – – S2072P M2190I
RdRp
L
NSm
Gc
5 NCR
OBE-1; GenBank accession numbers: AB190458.1, AB100604.1, and AB000851.1.
AB968525, AB968526, and AB968527. Genome sequence of the TSC2 possessed considerable differences from database sequence of its parent OBE-1 strain, as shown in Table 2. Within the open reading frame of each segment, sequence similarities were 99.6–99.9% at the nucleotide level and 99.0–100% at the amino acid level. To generate recombinant viruses using the T7 polymerasedriven reverse genetics, the L-, M-, and S-segment cDNAs of the TS-C2 strain were inserted into the pT7riboSM2 vector (Habjan et al., 2008) at the Esp3I restriction site, yielding pT7riboSM2/TL,
−/TM, and −/TS, respectively. These plasmids transcribe full-length anti-genomic sense RNA segments driven by T7 polymerase, with the 3 ends trimmed by the hepatitis delta virus ribozyme. Thus, we assessed the ability of these three plasmids to effectively rescue the virus in our reverse genetics system. To start, subconfluent layers of baby hamster kidney cells expressing T7 RNA polymerase (BHK/T7-9) (Ito et al., 2003) were grown in six-well plates. Each well was transfected with 1.2 g of pT7riboSM2/TL, 0.6 g of pT7riboSM2/TM, and 1.2 g of pT7riboSM2/TS using 9 L of TransIT-LT1 reagent (Mirus Bio LLC, Madison, WI, USA) in 200 L of Opti-MEM (Life Technologies Japan, Tokyo, Japan). Transfected cells were cultivated at 37 ◦ C and, at 6 days post transfection (dpt), BHK/T7-9 cells were overlaid on the transfected cells. Two days later, extensive cytopathic effects were observed and the infectious virus (named rTTT) was recovered in culture supernatants at a titer of 8.6 × 103 PFU/mL, indicating that supporting plasmids that express viral proteins are not required in this system. This was also demonstrated in other T7 polymerase-based bunyavirus reverse genetics systems (Blakqori and Weber, 2005; Ikegami et al., 2006; Lowen et al., 2004), albeit not in our previous polymerase I-based system which required supporting plasmids (Ogawa et al., 2007c). The rTTT viruses were plaque purified three times. We also inserted the L-, M-, and S-segment cDNAs of the OBE-1 strain into the pT7riboSM2 vector, and the resultant plasmids were named pT7riboSM2/OL, −/OM, and −/OS, respectively. Using these three plasmids, recombinant OBE-1 virus was rescued by the T7 polymerase-based system using the same procedures as that used for the rescue of rTTT virus. The primers for cloning were prepared based on database sequences (provided upon request). To authenticate our T7 polymerase-based system, we sought to generate an AKAV mutant virus not expressing the NSs gene, which is considered a virulence factor, but is not essential for virus growth (Ogawa et al., 2007c). We constructed the plasmid for the system and abolished NSs expression without altering the N amino acid sequence by changing the ATG start codon (nucleotides [nt] 59–61 of the S cDNA) to ACG in pT7riboSM2/TS using the QuikChange II kit (Agilent Technologies, Palo Alto, CA, USA) to generate pT7riboSM2/TSNSs. Using this plasmid, we carried out reverse genetics protocols under the same conditions as those with rTTT rescue, resulting in generation of a mutant TS-C2 virus (rTTTNSs) with a titer of 1.4 × 104 PFU/mL in culture supernatants of the transfected cells. The rTTTNSs viruses were plaque puri-
A. Takenaka-Uema et al. / Journal of Virological Methods 232 (2016) 16–20
fied three times. To confirm that rTTTNSs was derived from the cDNA, we distinguished rTTT and rTTTNSs by HpyCH4IV restriction analysis, as mutagenesis of the NSs start site created a unique recognition site for this enzyme (Fig. 1A). RT-PCR products with HpyCH4IV digestion showed that rTTTNSs carried this restriction site in the S segment (Fig. 1B). Direct sequencing of the RT-PCR product also confirmed the substitution with no unwanted mutations. Our next step was to examine growth kinetics and plaque sizes of the recombinant viruses. Sub-confluent monolayers of HmLu-1 cells were infected with the wild-type (wt) TS-C2 strain and recombinant viruses at a multiplicity of infection (MOI) of 0.01 for 1 h at 37 ◦ C. The infected cells were washed with PBS and overlaid with serum-free medium. At different time points (12, 24, 36, 48, and 60 h) post infection, supernatants were harvested. The number of plaque forming units (PFUs) was determined, as previously described (Kurogi et al., 1979). These experiments were performed in triplicate. To examine the differences in plaque morphology between the viruses, cells were infected with the wt or recombinant viruses and overlaid with DMEM containing 0.8% agar and 2% fetal calf serum, and then stained with neutral red four days later. The TS-C2 virus formed variable plaque sizes compared to the rTTT and rTTTNSs viruses, suggesting that the TS-C2 virus contains a mixed virus population. Although subtle variations existed in the plaque sizes of the biologically cloned viruses, rTTTNSs typically formed smaller plaques than rTTT (Fig. 2A). Moreover, analysis of the growth kinetics of the viruses in HmLu-1 cells revealed that rTTTNSs grew at a slower rate than rTTT and the wt virus, TS-C2. These findings are indicative of lower rTTTNSs viral replication. Nevertheless, rTTTNSs reached a maximal yield at 48 h post infection, which was equivalent to those of the other two viruses (Fig. 2B). In this study, we first applied a T7 polymerase-based reverse genetics method to AKAV. This method has been reported for other bunyaviruses, such as Bunyamwera virus, La Crosse virus, and Rift Valley fever virus (Blakqori and Weber, 2005; Bridgen and Elliott, 1996; Ikegami et al., 2006; Lowen et al., 2004), and we successfully used it to generate recombinant viruses. Compared to our previous polymerase I-based system, this system appears to be superior since the number of plasmids required for transfection protocols is lower (three plasmids in this system vs. five plasmids in the previous system), resulting in high transfection efficiency and robust virus rescue. When we examined the rescue efficacy of the polymerase I-based system using OBE-1 (Ogawa et al., 2007c), the parent strain of TC-S2, virus titers in the culture supernatant of the transfected cells were less than 1 PFU/mL in total, even after overlay of fresh cells to the transfected cells that proved to be the considerable step increasing virus rescue efficacy in T7 polymerase-based system, and in some trials, we were unable to rescue any recombinant virus. In contrast, the T7 polymerase-based system robustly rescued recombinant OBE-1 virus. In every trial, recombinant virus could be rescued at a titer of more than 103 PFU/mL. We propose that our T7 polymerase-based reverse genetics method will be valuable for basic viral research as well as practical application studies for AKAV. For example, our system may provide powerful tools for analyzing the mechanisms regulating AKAV attenuation. Indeed, differences in the TS-C2 and OBE-1 strains were found in the amino acid sequence of the M and L segments. In the future, a reverse genetics reassortment study will identify the factors responsible for the attenuation of the TS-C2 vaccine strain. Since NSs have been proposed to act as an AKAV virulence factor (Ogawa et al., 2007c), we can hypothesize that deletion of NSs from the TS-C2 strain will result in a more attenuated phenotype. Theoretically, any virus used for a live vaccine should contain multiple altered genetic loci in order to prevent reversion to virulence. Additionally, vaccines based on recombinant viruses lacking
19
NSs, such as rTTTNSs, may allow for differentiation between infected and vaccinated animals (DIVA), if NSs antibodies can be consistently detected in animals infected with the wt virus, but not in vaccinated animals. In the case of Rift Valley fever virus, although NSs-defective vaccines can be used for DIVA (McElroy et al., 2009), this differentiation is limited to herds with large numbers of animals owing to the inconsistent induction of NSs antibodies (Fernandez et al., 2012). Evaluation of the potential for DIVA with an NSs-defective vaccine strain against Akabane virus infection is an important goal for future studies. In conclusion, genetically manipulated viruses produced by reverse genetics technology can be used to establish nextgeneration vaccination strategies. In this way, our established reverse genetics system is a powerful tool, which can be used for vaccine studies targeting Akabane disease. Acknowledgements We thank Dr. Ito of the Laboratory of Zoonotic Diseases, Gifu University, Japan, for providing BHK/T7-9 cells and Dr. Weber of the Department of Virology, University of Freiburg, Freiburg, Germany, for providing pT7riboSM2. This study was supported in part by a Research and Development Project for Application in Promoting New Policies in Agriculture, Forestry and Fisheries grant from the Ministry of Agriculture, Forestry and Fisheries, and a Grant-inAid from the Ministry of Education, Culture, Sports, Science and Technology of Japan. References Akashi, H., Inaba, Y., 1997. Antigenic diversity of Akabane virus detected by monoclonal antibodies. Virus Res. 47, 187–196. Akashi, H., Kaku, Y., Kong, X., Pang, H., 1997. Antigenic and genetic comparisons of Japanese and Australian Simbu serogroup viruses: evidence for the recovery of natural virus reassortants. Virus Res. 50, 205–213. Blakqori, G., Weber, F., 2005. Efficient cDNA-based rescue of La Crosse bunyaviruses expressing or lacking the nonstructural protein NSs. J. Virol. 79, 10420–10428. Bridgen, A., Elliott, R.M., 1996. Rescue of a segmented negative-strand RNA virus entirely from cloned complementary DNAs. Proc. Natl. Acad. Sci. U. S. A. 93, 15400–15404. Fernandez, J.C., Billecocq, A., Durand, J.P., Cêtre-Sossah, C., Cardinale, E., Marianneau, P., Pépin, M., Tordo, N., Bouloy, M., 2012. The nonstructural protein NSs induces a variable antibody response in domestic ruminants naturally infected with Rift Valley fever virus. Clin. Vaccine Immunol. 19, 5–10. Habjan, M., Penski, N., Spiegel, M., Weber, F., 2008. T7 RNA polymerase-dependent and -independent systems for cDNA-based rescue of Rift Valley fever virus. J. Gen. Virol. 89, 2157–2166. Ikegami, T., Won, S., Peters, C.J., Makino, S., 2006. Rescue of infectious rift valley fever virus entirely from cDNA, analysis of virus lacking the NSs gene, and expression of a foreign gene. J. Virol. 80, 2933–2940. Inaba, Y., Kurogi, H., Omori, T., 1975. Letter Akabane disease: epizootic abortion, premature birth, stillbirth and congenital arthrogryposis-hydranencephaly in cattle, sheep and goats caused by Akabane virus. Aust. Vet. J. 51, 584–585. Inaba, Y., Matumoto, M., 1990. Akabane virus. In: Dinter, Z., Morein, B. (Eds.), In Virus Infections of Ruminants, vol. 3. Elsevier Science Publishers, Amsterdam, the Netherlands, pp. 467–480. Ito, N., Takayama-Ito, M., Yamada, K., Hosokawa, J., Sugiyama, M., Minamoto, N., 2003. Improved recovery of rabies virus from cloned cDNA using a vaccinia virus-free reverse genetics system. Microbiol. Immunol. 47, 613–617. Kamata, H., Inai, K., Maeda, K., Nishimura, T., Arita, S., Tsuda, T., Sato, M., 2009. Encephalomyelitis of cattle caused by Akabane virus in southern Japan in 2006. J. Comp. Pathol. 140, 187–193. Kim, Y.H., Kweon, C.H., Tark, D.S., Lim, S.I., Yang, D.K., Hyun, B.H., Song, J.Y., Hur, W., Park, S.C., 2011. Development of inactivated trivalent vaccine for the teratogenic Aino, Akabane and Chuzan viruses. Biologicals 39, 152–157. Kurogi, H., Inaba, Y., Takahashi, E., Sato, K., Akashi, H., Satoda, K., Omori, T., 1979. An attenuated strain of Akabane virus: a candidate for live virus vaccine. Natl. Inst. Anim. Health Q. (Tokyo) 19, 12–22. Kurogi, H., Inaba, Y., Takahashi, E., Sato, K., Omori, T., Miura, Y., Goto, Y., Fujiwara, Y., Hatano, Y., Kodama, K., Fukuyama, S., Sasaki, N., Matumoto, M., 1976. Epizootic congenital arthrogryposis-hydranencephaly syndrome in cattle: isolation of Akabane virus from affected fetuses. Arch. Virol. 51, 67–74. Lee, J.K., Park, J.S., Choi, J.H., Park, B.K., Lee, B.C., Hwang, W.S., Kim, J.H., Jean, Y.H., Haritani, M., Yoo, H.S., Kim, D.Y., 2002. Encephalomyelitis associated with akabane virus infection in adult cows. Vet. Pathol. 39, 269–273. Liao, Y.K., Lu, Y.S., Goto, Y., Inaba, Y., 1996. The isolation of Akabane virus (Iriki strain) from calves in Taiwan. J. Basic Microbiol. 36, 33–39.
20
A. Takenaka-Uema et al. / Journal of Virological Methods 232 (2016) 16–20
Lowen, A.C., Noonan, C., McLees, A., Elliott, R.M., 2004. Efficient bunyavirus rescue from cloned cDNA. Virology 330, 493–500. Ludwig, G.V., Israel, B.A., Christensen, B.M., Yuill, T.M., Schultz, K.T., 1991. Role of La Crosse virus glycoproteins in attachment of virus to host cells. Virology 181, 564–571. ˜ C.G., Nichol, S.T., 2009. Development of a RVFV ELISA that McElroy, A.K., Albarino, can distinguish infected from vaccinated animals. Virol. J. 6, 125. Miyazato, S., Miura, Y., Hase, M., Kubo, M., Goto, Y., Kono, Y., 1989. Encephalitis of cattle caused by Iriki isolate: a new strain belonging to Akabane virus. Jpn. J. Vet. Sci. 51, 128–136. Ogawa, Y., Fukutomi, T., Sugiura, K., Kato, K., Tohya, Y., Akashi, H., 2007a. Comparison of Akabane virus isolated from sentinel cattle in Japan. Vet. Microbiol. 124, 16–24.
Ogawa, Y., Kato, K., Tohya, Y., Akashi, H., 2007b. Sequence determination and functional analysis of the Akabane virus (family Bunyaviridae) L RNA segment. Arch. Virol. 152, 971–979. Ogawa, Y., Sugiura, K., Kato, K., Tohya, Y., Akashi, H., 2007c. Rescue of Akabane virus (family Bunyaviridae) entirely from cloned cDNAs by using RNA polymerase I. J. Gen. Virol. 88, 3385–3390. Oya, A., Okuno, T., Ogata, T., Kobayashi, I., Matsuyama, T., 1961. Akabane: a new arbor virus isolated in Japan. Jpn. J. Med. Sci. Biol. 14, 101–108. Weber, F., Bridgen, A., Fazakerley, J.K., Streitenfeld, H., Kessler, N., Randall, R.E., Elliott, R.M., 2002. Bunyamwera bunyavirus nonstructural protein NSs counteracts the induction of alpha/beta interferon. J. Virol. 76, 7949–7955. Yamakawa, M., Yanase, T., Kato, T., Tsuda, T., 2006. Chronological and geographical variations in the small RNA segment of the teratogenic Akabane virus. Virus Res. 121, 84–92.