Development of glycerol-utilizing Escherichia coli strain for the production of bioethanol

Enzyme and Microbial Technology 53 (2013) 206–215

Contents lists available at SciVerse ScienceDirect

Enzyme and Microbial Technology journal homepage: www.elsevier.com/locate/emt

Development of glycerol-utilizing Escherichia coli strain for the production of bioethanol Laxmi Prasad Thapa a , Sang Jun Lee a , Hah Young Yoo a , Han Suk Choi a , Chulhwan Park b,∗∗ , Seung Wook Kim a,∗ a b

Department of Chemical and Biological Engineering, Korea University, 1-Anam-Dong, Seongbuk-Gu, Seoul, 136-701, Republic of Korea Department of Chemical Engineering, Kwangwoon University, 447-1, Wolgye-Dong, Nowon-Gu, Seoul, 139-701, Republic of Korea

a r t i c l e

i n f o

Article history: Received 3 December 2012 Received in revised form 20 April 2013 Accepted 25 April 2013 Keywords: Enterobacter aerogenes Bioethanol production Recombinant strains Genetic manipulation

a b s t r a c t The production of bioethanol was studied using recombinant Escherichia coli with glycerol as a carbon source. Glycerol is an attractive feedstock for biofuels production since it is generated as a major byproduct in biodiesel industry; therefore, we investigated the conversion of glycerol to bioethanol using E. coli BL21 (DE3) which harbors several genes in ethanol production pathway of Enterobacter aerogenes KCTC 2190. Fermentation was carried out at 34 ◦ C for 42 h, pH 7.6, using defined production medium. Under optimal conditions, bioethanol production by the recombinant E. coli BL21 (DE3), strain pEB, was two-fold (3.01 g/L) greater than that (1.45 g/L) by the wild-type counterpart. The results obtained in this study will provide valuable guidelines for engineering bioethanol producers. © 2013 Elsevier Inc. All rights reserved.

1. Introduction Recently, the use and production of biofuels such as biodiesel and bioethanol from micro-organisms has increased substantially. Glycerol has become an abundant and inexpensive carbon source owing to its generation as an inevitable byproduct of biodiesel production. Over the past few years, the price of crude glycerol has decreased ten-fold because of the tremendous growth of the biodiesel industry [1]. Much effort has been devoted to the development of processes that convert crude glycerol into high-value products to maximize the full economic potential of the biodiesel production process. For example, the transformation of glycerol into 1,3-propanediol has been extensively studied in the past few years [2–4]. Currently, many research groups are studying the utilization of glycerol as a carbon source in the transformation of other valued products such as ethanol [5] and amino acids [6]. Biodiesel is generally produced by reacting a fat or oil (triglycerides) with methanol or ethanol in the presence of an alkali catalyst [7]. The production of 10 kg of biodiesel yields approximately 1 kg of glycerol [8]. Although crude glycerol can be used as a boiler fuel or a supplement for animal feed, the market value of crude glycerol is still very low

∗ Corresponding author. Tel.: +82 232903300; fax: +82 29266102. ∗∗ Corresponding author. Tel.: +82 29405173; fax: +82 29125173. E-mail addresses: [email protected] (C. Park), [email protected] (S.W. Kim). 0141-0229/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.enzmictec.2013.04.009

[9]. Thus, there is an urgent need to develop a practical process for converting glycerol into a useful product. Glycerol can be used as a carbon source by many microorganisms and can be converted into various products such as 1,3-propanediol, succinic acid, dihydroxyacetone, and ethanol [10]. The development of processes to convert low-priced glycerol into higher value products is therefore an excellent opportunity to add value to the production of biodiesel. In fact, the need for obtaining new chemicals from glycerol has prompted US government agencies; such as the department of energy, to promote new glycerol-platform chemistries and product families as one of their most important priorities [11]. Bioethanol is a combustible fuel that can be produced using well-known fermentation technology from a wide range of carbohydrate feedstocks; however, the technology required is not yet commercially available [12,13]. High ethanol yield is becoming increasingly important to the economic viability of the commercial process. This will likely require a combination of both strain development and improved process technology. Industrial production of ethanol, from carbohydrate feedstocks, such as glycerol, requires that the producing organism tolerate and produce high levels of ethanol and convert the substrate directly to the endproduct [14,15]. In E. coli, glycerol is converted to the glycolytic intermediate dihydroxyacetone phosphate (DHAP) in a two-step pathway involving glycerol dehydrogenase (glyDH) and dihydroxyacetone kinase (dhaK), as previously reported [16]. The conversion of DHAP into PEP occurs in five steps through the action of common

L.P. Thapa et al. / Enzyme and Microbial Technology 53 (2013) 206–215

207

Fig. 1. Primary fermentative pathways involved in microaerobic fermentation of glycerol in E. coli. Relevant genes and corresponding enzymes are included. Ethanol, succinate, acetate, and formate are the main products of fermentative utilization of glycerol (Dharmadi et al., 2006).

glycolytic enzymes [17]. While the glycolytic enzyme pyruvate kinase converts PEP into pyruvate during metabolism of other carbon sources (17), a unique characteristic of glycerol metabolism is that the conversion of PEP into pyruvate is coupled to DHA phosphorylation (i.e., since DHAK uses PEP as the phosphate group donor). This coupled reaction is a critical component of glycerol fermentation in E. coli and generates a cycle in the metabolic pathway (Fig. 1) which for the purpose of the model allows the assumption of negligible pyruvate kinase activity. The biosynthesis of acetyl-CoA from pyruvate can occur through two different enzymes, the pyruvate dehydrogenase complex (PDHC) and pyruvate formatelyase (PFL). However, considering the high NADH/NAD ratios observed during glycerol fermentation [18] and given that NADH negatively regulates PDHC [19], PFL is expected to play a primary role. The final reactions in the biosynthetic pathway of bioethanol in E. coli consist of the two-step conversion of acetyl-CoA into ethanol through the actions of acetaldehyde/alcohol dehydrogenase (ALDH/ADH) [19]. For some time, it was thought that the metabolism of glycerol in E. coli required the presence of external electron acceptors [20–23], but recently, it was discovered that E. coli can metabolize glycerol in a fermentative manner [16,18,24]. These researchers also identified the environmental conditions that enable this metabolic process, along with the pathways and mechanisms responsible for it [16]. These studies also suggested the feasibility of fermentation of glycerol into fuels, and other reduced chemicals, by inducing the dormant, native 1,2-propanediol fermentative pathway in E. coli without using external electron acceptors [18,24]. However, this approach, faces several critical challenges, such as low specific growth rates resulting in low chemical productivities and coproduction of unavoidable by-products, such as 1,2-propanediol. The reported specific growth rate appears to limit any practical application since a minimal doubling time of approximately 17 h results in the consumption of only 8–10 g/L glycerol after 110 h [18,24]. In addition, glycerol fermentation was successful only when complex components, such as yeast extract, tryptone, or amino acids which are required for biomass synthesis, were added to the medium ([18,24]. Fumarate, carnitine, and related C4 dicarboxylates can be present in tryptone, or generated from some of its components through degradation of amino acids. These compounds could then

serve as electron acceptors in the respiratory metabolism of glycerol [18]. The main objective of this study was to develop an engineered glycerol-utilizing E. coli BL21 (DE3) strain for the production of bioethanol by overexpressing the ethanol producing gene set of E. aerogenes KCTC 2190 (Fig. 1). We selected E. coli BL21 (DE3) as a host strain for the production of bioethanol from glycerol, because it is very amenable to industrial applications, easy to handle, grows well, can tolerant up to 3% ethanol, can be easily manipulated genetically and has never been used for glycerol-derived bioethanol production in E. coli BL21 (DE3) strain. In this study, five recombinant E. coli BL21 (DE3) strains were developed by harboring recombinant plasmids, each containing a different gene set from the ethanol biosynthetic pathway of E. aerogenes KCTC 2190. The production of bioethanol in all the recombinant strains was compared with that in the wild-type counterpart. 2. Materials and methods 2.1. Microorganisms and plasmids E. coli BL21 (DE3) (genotype: F-ompThsdSB (rB-mB-) gal dcm(DE3)) (Invitrogen Corporation, Carlsbad, CA, USA) was used for the production of bioethanol, and E. coli DH5␣ was used as the host strain. Genomic DNA of E. aerogenes KTCC 2190 was purified and used as a template to amplify the genes gldA (glycerol dehydrogenase), dhaK (dihydroxyacetone kinase), pykA (pyruvate kinase), pflB (pyruvate formate-lyase) and adhE (alcohol dehydrogenase). The plasmids, pETDuet-1 and pACYCDuet-1 (Novagen, Darmstadt, Germany), used for the construction of recombinant plasmids are listed in Table 1. 2.2. Extraction of genomic DNA To extract the genomic DNA of E. aerogenes KCTC 2190, overnight culture broth was transferred to a 1.5-mL microcentrifuge tube and centrifuged at 15,000 × g for 2 min to pellet the cells. Cell pellets were resuspended in 600 ␮L of lysis buffer and incubated at 80 ◦ C for 5 min to completely lyse the cells. The clear lysed solution was cooled to room temperature. Then, 3 ␮L of RNase solution was added to the cell lysate and the tube was inverted 2–5 times to mix well. The sample was incubated at 37 ◦ C for 30 min to digest RNA and cooled to room temperature. The sample was then mixed with 200 ␮L of protein precipitation solution (PPS). The sample was vortexed vigorously at a high speed for 20 s and kept on ice for 5 min. The sample was centrifuged for 3 min, and the supernatant was transferred to a clean 1.5mL microcentrifuge tube containing 600 ␮L of isopropanol (IPA). The DNA solution was mixed with IPA by inverting the tube at least 15 times. The solution was then

208

L.P. Thapa et al. / Enzyme and Microbial Technology 53 (2013) 206–215

Table 1 Strains, plasmids, and primers used in this study. Strains, plasmids and primers

Genotype, relevant characteristics or sequence

Source or reference

Strains E. coli BL21(DE3) E. aerogenes KCTC 2190 pET pK pKA pKAA pE pEB

F-omp T hsdSB(rB-mB-) gal dcm (DE3) Wild type Carrying plasmid pETDuet-l Carrying plasmid pETDK Carrying plasmid pETDKA Carrying plasmid pETLT Carrying plasmid pACYE Carrying plasmid pACYEB

Invitrogen Korean collection for type culture This study This study This study This study This study This study

Plasmids pETDUet-1 pACYCDuet-1

p15Aori lacI T7 lac Ampf pl5A ori lacI T7 lac Cmf

Novagen Novagen

Primers gldAF gldAR dhaKF dhaKR pykAF pykAR ypflBF pflBR adhEF adhEF adhER

TGGATCCTGATGCCGCCATGCTG GCGAATTCCCTTGTGAAAGACTTAACG CTAGAATTCGGAGCATAAACAATGAAA AGAGCTCTGTCGTGCTCCTTATTTTC CTTGAGCTCTAAGACTGTCATGAAAAA AAAGGTTAACCTGTAAATTATTAGAGC GCAGAATTCAGGGTAAATCATGATCTTC AGTTGAGCTCTGGTCATAAGTTATCCTC G CGAGCTCTGTTACTGAAGCGATGAATA CGAGCTCTGTTACTGAAGCGATGAATA CGAAGGTTAGTTTTTAG GATTACATC

This study This study This study This study This study This study This study This study This study This study This study

centrifuged for 2 min, and the supernatant was carefully poured off. The DNA pellet was washed by additional of 600 ␮L of 70% ethanol, and the tube was gently inverted several times. The sample was centrifuged for 2 min, and the ethanol was carefully poured off. DNA pellets were allowed to air-dry overnight. The dry cell pellet was dissolved in elution buffer to obtain genomic DNA of E. aerogenes KTCC 2190.

2.3. Construction and transformation of recombinant plasmids The recombinant plasmid pETDK was constructed by cloning the dhaK gene into the pETDuet-1 expression plasmid using EcoRI/SacI restriction enzymes; the pETDKA recombinant plasmid was constructed by cloning the pykA gene into the

Fig. 2. The recombinant plasmid constructed by cloning the (A) dhaK gene inthe pETDuet-1 expression plasmid by BamHI/EcoRI, (B) pykA gene in the recombinant plasmid pETDK byEcoRI/SacI, (C) gldA gene inthe recombinant plasmid pETDKA by SacI/HindIII, (D) adhE gene inthe pACYDuet-1 plasmid by SacI/HindIII, and (E) pflB gene in the recombinant plasmid pACYE by EcoRI/SacI restriction enzymes.

L.P. Thapa et al. / Enzyme and Microbial Technology 53 (2013) 206–215

209

Fig. 3. Photograph of the agarose gel confirming cloning of (A) lane 1 = gldA in the recombinant plasmid pETDKA by SacI/HindIII restriction enzyme digestion, lane 2 = dhaK and pykA by BamHI/SacI restriction enzyme digestion, lane 3 = gldA, dhaK, and pykA by BamHI/HindIII restriction enzyme digestion; and (B) pflB and adhE in the pACYDuet-1 recombinant plasmid by EcoRI/HindIII restriction enzyme digestion.

pETDK recombinant plasmid using SacI/HindIII; and the pETLP recombinant plasmid was constructed by cloning the dhaK, pykA and gldA genes one by one into the pETDuet-1expression plasmid using BamHI/EcoRI, EcoRI/SacI, and SacI/HindIII restriction enzymes, respectively (Fig. 2A–C). The cloning of all three genes in one operon was confirmed by restriction enzyme digestion of the recombinant plasmid pETLT by the respective enzymes (Fig. 3). Similarly, the recombinant plasmid pACYE was constructed by cloning the adhE gene into the pACYDuet-1 plasmid using EcoRI/SacI restriction enzymes, and the recombinant plasmid pACYEB was constructed by cloning the pflB gene into the recombinant plasmid pACYE using SacI/HindIII restriction enzymes; (Fig. 2D–E). The construction of each recombinant plasmid was confirmed using agarose gel electrophoresis (Fig. 3). Plasmids were introduced into E. coli BL21 (DE3) by transformation using the calcium chloride procedure as described by Mandel and Higa [25]. The transformants were screened on a LB agar plate containing the appropriate antibiotics. The plasmid DNA of all transformants was made and transformation was confirmed by restriction enzyme digestion. The recombinant strain harboring pETDuet-1 plasmid was referred to as pET, pETDK recombinant plasmid was referred to as pK, pETDKA recombinant plasmid was referred to as pKA, pETLT recombinant plasmid was referred to as pKAA, pACYEB recombinant plasmid was referred to as pEB, and pACYE recombinant plasmid was referred to as pE.

of recombinant strains were performed in LB medium containing 50 ␮g/mL ampicillin and 25 ␮g/mL chloramphenicol for 16 h at 34 ◦ C and 150 rpm. Two milliliters of seed culture was transferred to a 250-mL elementary flask containing 100 mL production medium (10 g/L glycerol, 40 g/L (NH4 ) SO4 , 1.5 g/L MgCl2 , 3.5 g/L KH2 PO4 , 3.5 g/L K2 HPO4 , 0.002 g/L FeSO4 , 0.002 g/L MnSO4 , 0.05 g/L CaCl2 , 0.01 g/L ZnSO4 , and 3 g/L tryptone) and incubated for 48 h at 34 ◦ C and 150 rpm.

2.4. Culture conditions Wild-type E. coli BL21(DE3) and E. coli DH5␣ were grown in Luria-Bertani (LB) medium (10 g/L tryptone, 5 g/L yeast extract, and 5 g/L NaCl). Seed cultures

Fig. 4. Bioethanol produced by various recombinant strains of E. coli; E. coli BL21 (DE3), pET; expressing the pETDuet-1 plasmid; pETDK; expressing dhaK, and pETDKA; expressing pykA along with dhaK, pETLT; expressing gldA along with dhaK and pykA, pACYE; expressing adhE and pACYEB; expressing pflB along with adhE.

Fig. 5. Effects of (A) temperature and incubation time, and (B) pH on the production of bioethanol by recombinant E. coli BL21 (DE3).

210

L.P. Thapa et al. / Enzyme and Microbial Technology 53 (2013) 206–215

2.5. DNA manipulation

2.7. Determination of the effects of glycerol, ammonium sulphate, and tryptone

DNA isolation and manipulation of genetic material using procedures such as deoxyribonucleic acid (DNA) isolation, restriction endonuclease digestion, and DNA ligation, in E. coli, were performed according to standard protocols [26,27]. Restriction enzymes and T4 DNA ligase were purchased from Roche (Germany) and iNtRON Biotechnology (Korea). An agarose gel extraction kit (MEGA quick-spin TM Total Fragment DNA Purification kit, iNtRON Biotechnology, Inc) was used to isolate largescale plasmid DNA from the gel.

The effects of the carbon source “glycerol” and the nitrogen sources “tryptone” and “ammonium sulphate” on bioethanol production were tested using recombinant E. coli BL21(DE3) and optimized following a factorial design and response surface methodology. Recombinant E. coli BL21 (DE3) strain was incubated in 100 mL of production medium at 34 ◦ C for 42 h at 200 rpm. Twenty runs were conducted and each run contained different concentration of glycerol, ammonium sulphate and tryptone components in the production medium. The effect of the variables on the process and the interaction among variables were studied using a factorial design. Response surface methodology was applied to optimize the process. Statistical analysis was conducted with SAS® version 9.1 (SAS, 2003). The levels of the chosen factors are shown in Table 3, including the center and star points. Combining the center points with factorial points allows the evaluation of the curvature effect. The star points are additional experiments that allow the determination of a nonlinear model.

2.6. Determination of the effects of temperature, cultivation period, and pH The effects of temperature and optimal production period on bioethanol production were verified by incubating the recombinant strains at 32 ◦ C, 34 ◦ C, and 37 ◦ C for various time intervals (Fig. 5A). Similarly, the effect of pH on bioethanol production was tested by adjusting pH of the production media to 4.0, 4.5, 5.0, 5.5 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, and 9.0 before autoclaving. A pH of 7.0 resulted in the highest bioethanol production; therefore, the second experiment was conducted by adjusting the pH of the production media to 6.8, 7.0, 7.2, 7.4, 7.6, 7.8, 8.0, and 8.2 to find the closest optimized pH condition for the production of bioethanol (Fig. 5B).

2.8. Determination of the effects of magnesium and phosphate salts The effect of magnesium chloride on bioethanol production was tested by adding 0.5, 0.75, 1.0, 1.25, 1.5, 1.75, and 2.0 g/L of magnesium chloride (Fig. 7A). Similarly, the

Fig. 6. Response surface plot and contour plot of bioethanol production as a function of (A) ammonium sulphate, and glycerol concentrations, (B) function of tryptone and glycerol concentrations, and (C) ammonium sulphate and tryptone concentrations.

L.P. Thapa et al. / Enzyme and Microbial Technology 53 (2013) 206–215

211

Table 2 Carbon balances for fermentative metabolism of glycerol at varying times and temperatures. Temp (◦ C)

Glycerol conc. (10 g/L)

24

36

42

48

60

30

Glycerol remained Ethanol Succinate Acetate Total product

6.93 0.859 0.252 1.341 2.252

5.776 1.234 0.386 2.041 3.661

5.108 1.244 0.265 2.477 3.986

4.815 1.238 0.1347 2.738 4.111

4.147 1.227 0.0069 3.282 4.516

34

Glycerol remained Ethanol Succinate Acetate Total product

6.672 1.246 0.363 1.339 2.95

5.382 1.65 0.386 2.39 4.427

3.777 1.707 0.383 2.111 4.202

4.497 1.703 0.253 2.268 4.224

4.82 1.692 0 2.425 4.11

37

Glycerol remained Ethanol Succinate Acetate Total product

6.111 0.677 0.282 1.892 2.851

4.994 0.731 0.498 0.808 2.937

3.281 0.747 0.015 2.747 3.511

4.095 0.712 0.13 2.957 3.683

4.452 0.741 0.113 3.545 4.4

Time for incubation (h)

Note: Glycerol remained: glycerol detected in culture broth after conversion into bioethanol, total product: Ethanol + Succinate + Acetate, Glycerol conc.: glycerol added in production medium.

effect of potassium phosphate (K2 HPO4 and KH2 PO4 ) salts on bioethanol production was tested by adding the same ratio (1:1) of both salts (Fig. 7B). 2.9. Batch fermentation Seed cultures were carried out for 16 h, and cells were immobilized using 2% chitosan beads and 2.5% trisodium phosphate. A batch bioreactor experiment was conducted in a 5-L bioreactor (Korea Fermentation Co. Ltd.; Korea) with a working

volume of 2 L, under aerobic condition. The growth conditions were 34 ◦ C and pH 7.6. Sterile air was sparged into the bioreactor at a flow rate of 500 mL/min. The agitation rate was controlled at a fixed value of 200 rpm to obtain a specified volumetric transfer coefficient for each experiment. Initial cell densities were adjusted to optical density (OD)600 . 2.10. Analytical methods Cell growth was monitored by optical density (OD) at 600 nm using a UV–visible spectrophotometer (Biomate5). The production of bioethanol by different E. coli BL21 (DE3) recombinant strains was analyzed by high-performance liquid chromatography (HPLC) using an Aminex HPX-87H column (300 9 7.8 mm, Bio-Rad, USA) and a refractive index detector (RID-10A, Shimadzu, Japan). The temperature of the column and detector was maintained at 50 ◦ C. The mobile phase was 0.005 N H2 SO4 applied at a flow rate of 0.8 mL/min.

3. Results 3.1. Analysis of bioethanol producer genes

Fig. 7. Effects of different concentrations of (A) magnesium chloride, and (B) potassium phosphate salts on the production of bioethanol in recombinant E. coli BL21 (DE3).

The E. aerogenes KCTC 2190 genome has been sequenced (Gene Bank accession no. CP002824) [28]. GldA, which functions as a glycerol dehydrogenase, is a key enzyme required for the biosynthesis of dihydroxyacetone from glycerol in the presence of NADH in the fermentation pathway of E. coli. It is 96% identical to the glycerol dehydrogenase (GldA) of Klebsiellaoxytoca 10-5246 and 65% identical to the glycerol dehydrogenase (CgrD) of E. coli. E. aerogenes dihydroxyacetone kinase (DhaK) shares 92% identity with Klebsiella oxytoca 10-5246 dihydroxyacetone kinase (DhaK) and 89% identity with dihydroxyacetone kinase (DhaK) of E. coli IAI39 at the amino acid level. It has a multi-subunit chain with a phosphoprotein donor related to PTS transport proteins, but it specifically excludes the DhaK paralog DhaK2 (TIGR02362), found in the same operon as DhaK and DhaK in the Firmicutes. Similarly, PykA, is 98% identical to the pyruvate kinase (PykF) of Klebsiella pneumoniae 342 and 96% identical to the pyruvate kinase of E. fergusonii ATCC 35469 at the amino acid level. PflB, which encodes pyruvate formate-lyase, is 80% identical to the pyruvate formate-lyase (PflH) from Enterobacter hormaechei ATCC 49162 and 80% identical to the pyruvate formatelyase of E. coli BL21(DE3). Similarly, AdhE is 86% identical to the alcohol dehydrogenase (AdhY) from Citrobacter youngae ATCC 29220 and 85% identical to the E. coli str. K-12 substr. MG1655 at the amino acid level, which is also a key enzyme required for the conversion of acetyl-CoA to ethanol in the presence of 2 molecules of NADH.

212

L.P. Thapa et al. / Enzyme and Microbial Technology 53 (2013) 206–215

Table 3 Factor levels for the central composite design. Symbol

Glycerol (g/L) Ammonium sulfate (g/L) Tryptone (g/L)

X1 X2 X3

Coded factor levels −2

−1

0

1

2

2 10 1

4 17.5 2

6 25 3

8 32.5 4

10 40 5

Note: +2: high start point level; +1: high factorial point level; 0: central point level; −1: low factorial point level; −2: low star point level.

3.2. Production of bioethanol from recombinant strains The main objective of this study was to enhance the production of bioethanol from glycerol via the fermentative pathway. Therefore, in order to determine the feasibility of enhancing the production of bioethanol, all recombinant strains, pET, pK, and pKA, pKAA, pE, and pEB, were incubated at 34 ◦ C for 24 h in a production medium [29]. Overexpression of genes can be induced by adding 0.1 mM IPTG solution after 5 h of incubation. Here, the IPTG induction time was slightly longer, because the presence of complex medium components such as tryptone, and yeast extract slightly decreases the growth rate of microorganism [18,24]. Wildtype E. coli BL21 (DE3) control was also incubated under the same conditions for 24 h. The concentration of bioethanol produced by recombinant strains was compared with that produced by wild-type E. coli BL21 (DE3) using HPLC. The pK recombinant strain (overexpressing PTS-dependent dihydroxyacetone kinase) was able to produce bioethanol, utilizing glycerol as a substrate, but yielded only 0.7 g/L (Fig. 4). The pKA recombinant strain (overexpressing PTS-dependent dihydroxyacetone kinase and PEPdependent pyruvate kinase) produced 0.76 g/L bioethanol, which is slightly higher than the amount produced by the pK strain. Fermentation of the pKAA recombinant strain (overexpressing glycerol dehydrogenase, dihydroxyacetone kinase and pyruvate kinase) produced 1.25 g/L bioethanol, which was two-fold higher than the amount produced by the wild-type (0.56 g/L) strain. The pE recombinant strain (overexpressing alcohol dehydrogenase) produced 0.88 g/L of bioethanol, which is almost two-fold higher than the amount produced by the wild-type strain. Incubation of the pEB recombinant strain (overexpressing alcohol dehydrogenase and pyruvate formate-lyase) produced 1.29 g/L bioethanol, which was more than two-fold the amount produced by the wild-type strain (Fig. 4). 3.3. Effects of various process parameters 3.3.1. Effects of temperature, cultivation period, and pH Temperature is one of the most critical parameters to control in any bioprocess [30]. The pEB recombinant strain was incubated at various temperatures (30 ◦ C, 34 ◦ C, and 37 ◦ C) for different intervals of time. The samples were retained for a fermentation period of 60 h and the fermented samples were analyzed. Bioethanol production increased with increasing temperature from 30 ◦ C to 34 ◦ C and reached a maximum value (1.70 g/L) at 34 ◦ C after 42 h of incubation. However, above 34 ◦ C, bioethanol production started to decrease with increasing temperature and reached a minimum value (0. 747 g/L) at 37 ◦ C (Fig. 5A). The results described in Fig. 5A were also quantitatively analyzed to examine the carbon-balance between the substrate used and the various metabolites produced (Table 2). The fractional distribution of glycerol carbons to various metabolites for a cultivation period of 42 h was as follows: ethanol (27.45%), acetate (62.14%), and succinate (5.86%) at 30 ◦ C; ethanol (40.62%), acetate (50.23%), and succinate (9.11%) at 34 ◦ C; and ethanol (21.27%), acetate (78.24%), and succinate (0.42%) at 37 ◦ C. The composition

of extracellular metabolites suggests that fermentative glycerol metabolism of pEB is a typical mixed-acid fermentation, similar to that of other enterobacteria such as Escherichia coli and Enterobacter aerogenes [31–34]. Similarly, the effect of initial pH was investigated in order to determine the most suitable pH for the growth of E. coli strains and bioethanol production. The E. coli BL21 (DE3) recombinant strain was fermented at different pH values between 6.8 and 8.2 by the addition of hydrochloric acid, to determine the maximum yield of bioethanol. The E. coli BL21 (DE3) recombinant strain was cultivated for a period of 42 h and the production of bioethanol was analyzed by HPLC. Fig. 5B shows that bioethanol concentration gradually increased along with increasing pH and reached a maximum (2.52 g/L) at pH 7.6. Production declined at higher pH levels due to decreased activity of E. coli (cell growth and enzyme activity).

3.3.2. Effects of glycerol, ammonium sulphate, and tryptone In this experiment, glycerol, ammonium sulphate, and tryptone were considered as important medium components for the production of bioethanol in E. coli. The concentration range of each component (2–10 g/L for glycerol, 10–40 g/L for ammonium sulphate, and 1–5 g/L for tryptone) was selected on the basis of published studies [29]. SAS 9.1 software was employed for ANOVA and calculations of the regression coefficient and the polynomial regression equation from the CCD experimental data. The coefficient of variation (CV) represents the degree of precision among treatments. We obtained a CV of 18.9%. A low CV value indicates that the factors are highly reliable during optimization. The Model F-value of 4.76 implies the model is significant; since there is only a 1.14% chance that a “Model F-value” this large could occur due to noise. The determination coefficient (R2 ) was 0.81; a high determination coefficient indicates a high degree of reliability between the observed experimental data and predictions. Furthermore, the pvalue, which is important in understanding the pattern of mutual interactions between the variables, was <0.0500, indicating that the model terms are significant. The following polynomial equation was obtained by multiple regression analysis. Y = 2.745 + 0.388X1 − 0.168X2 − 0.701X3 + 0.009X1 X2 + 0.487X1 X3 + 0.011X2 X3 − 0.054X12 + 0.002X22 + 0.065X32 (1) where X1 is a coded value for glycerol, X2 is a coded value for ammonium sulphate and X3 is a coded value for tryptone. Once the derived equation was solved, 3 contour plots and three-dimensional mesh graphs produced. The three-dimensional mesh graphs, with each contour plot, showed the effect of each medium composition factors and the approximate optimal level (Fig. 6A–C). The optimal coded values, as determined by RSM, were 0.62 for glycerol (X1 ), 0.60 for ammonium sulphate (X2 ), and 0.99 for tryptone (X3 ), whereas the actual values were 7.07 g/L for glycerol, 39.37 g/L for ammonium sulphate, and 3.15 g/L for tryptone. For each response, second-order models were plotted as 3 response surface graphs (data not shown), and another 3 contour graphs representing the response (bioethanol concentration, glycerol concentration loss, or ammonium sulphate loss) as a function of 2 of the 3 factors at the center point value of the third operating condition were plotted. Fig. 6A shows the response surface and contour plots for the predicted values of bioethanol production as a function of glycerol and ammonium sulphate concentrations. Fig. 6B illustrates the response surface and contour graphs of bioethanol as a function of glycerol and tryptone concentrations. Finally, the same corresponding response surface and contour plots for bioethanol

L.P. Thapa et al. / Enzyme and Microbial Technology 53 (2013) 206–215

production as a function of ammonium sulphate and tryptone concentrations are represented in Fig. 6C. 3.3.3. Effects of magnesium and phosphate salts The recombinant E. coli BL21 (DE3) strain, pEB, was cultivated with different concentrations of magnesium chloride ranging from 0.5 g/L to 2 g/L (0.750 g/L, 1 g/L, 1.25 g/L, 1.5 g/L, 1.75 g/L, and 2 g/L) to determine the optimum concentration. Fig. 7A shows that the concentration of bioethanol increased with an increase in magnesium chloride concentration and reached maximum (2.66 g/L) at a magnesium chloride concentration of 1.5 g/L. Further increase in the magnesium chloride concentration inhibited bioethanol production. Similarly, pEB recombinant strain was also fermented with various concentrations of both KH2 PO4 and K2 HPO4 in the same ratio (1:1) in order to determine the optimal concentrations. Bioethanol production increased with increasing concentrations of both phosphate salts and reached a maximum (3.018 g/L) at a phosphate salt concentration of 3.5 g/L. Further increase in the phosphate concentrations inhibited bioethanol production (Fig. 7B). Wild-type E. coli BL21 (DE3) was also fermented under optimized condition and was found to produce 1.45 g/L bioethanol (data not shown). 3.3.4. Batch fermentation under optimized conditions To evaluate the performance of the bioethanol producing strain at a large scale, 5-L batch fermentation was performed under the optimized cultivation conditions described above, in which batch fermentations were carried out at 34 ◦ C with 2 L of production medium. The pEB strain was cultured, cells were immobilized, and the concentration of bioethanol was measured by HPLC. Bioethanol production during batch fermentation of the pEB strain increased with time, and reached a maximum of 2.73 g/L after 42 h of incubation, [approximately 0.28 g/L lower than the production in a corresponding shaken-flask experiment (data not shown)]. 4. Discussion Although glycerol may be converted into many useful products by micro-organisms, fuel, such as bioethanol may be one of the best target products due to its sufficiently large market value; i.e., the demand for fuel is nearly inexhaustible [8]. Metabolism of glycerol in E. coli, however, has been thought to require the presence of external electron acceptors (20–23). Recently, Dharmadi et al., 2008; suggested that E. coli can ferment glycerol in complex medium components, such as yeast extract, tryptone, or amino acids that are required for biomass synthesis. They also suggested that fumarate, carnitine, and related C4 dicarboxylates might be present in tryptone or generated from some of its components through processes such as degradation of amino acids, and then serve as electron acceptors in the respiratory metabolism of glycerol [24]. In this study, we carried out both aerobic and anaerobic fermentative metabolism of glycerol for the production of bioethanol-but under anaerobic conditions, E. coli BL21 (DE3) did not grow. E. coli BL21 (DE3), is an ethanolic strain but can produce only 1.07 g/L bioethanol without external genes by using glucose as a carbon source [35]. Lee et al. also suggested that the ethanoltolerance capacity of E. coli BL21 (DE3), at ethanol concentration lower than 1%, was not significantly affected. However, cell growth was inhibited when the ethanol concentration of the medium reached 3% or higher. First, we incubated all recombinant strains of E. coli BL21 (DE3) in production media at 34 ◦ C for 48 h, pH 7.3, and 150 rpm, using wild-type E. coli BL21 (DE3) and the pET strain containing only the pETDuet-1 plasmid as controls. The metabolite concentrations of glycerol and bioethanol were measured for wild-type E. coli

213

BL21 (DE3) and the recombinant strains. The pK recombinant strain containing dihydroxyacetone kinase (dhaK), which converts dihydroxyacetone into dihydroxyacetone phosphate, led to an increase in ethanol production, which was higher than the amount produced by the wild-type strain (Fig. 4). Formation of the glycolytic intermediate, dihydroxyacetone phosphate, may assess to improve the growth rate of E. coli, and thus improve ethanol production [36]. When the pETDKA recombinant plasmid, containing the genes encoding dihydroxyacetone kinase (dhak) and pyruvate kinase (pykA) in one operon, was introduced into the E. coli BL21 (DE3) strain, a slight increase in bioethanol production was detected as compared to the amount of bioethanol produced by the pK strain (Fig. 4). The production of bioethanol by the pKA recombinant strain was significantly lower. Limited availability of the intracellular glycolytic intermediate, dihydroxyacetone phosphate, might be factor for the lower production of ethanol. Similarly, when the pETLT recombinant plasmid, containing three genes, gldA, dhaK, and pykA in one operon, was introduced into the E. coli BL21 (DE3) strain, bioethanol production was two-fold higher than that in the wildtype strain (Fig. 4). This result, suggests that the enzymatic activity of GldA of E. coli BL21 (DE3) strain might not be sufficient to convert glycerol into the glycerone intermediate; thus, ethanol production was very low. However, the overexpression of the gldA gene of E. aerogenes may add the enzymatic activity, and hence, more molecules of glycerol were converted into glycerone intermediate. Moreover, this result demonstrates that during the overexpression of the NAD+ -dependent gldA gene, one molecule of NADH was formed per glycerol converted to glycerone, thereby increasing the NADH/NAD+ ratio in the cells. The increased NADH/NAD+ ratio in the cells shifts the carbon balance toward the more reduced product, ethanol, without using an expensive substrate [37]. Similarly, when the pACYEB recombinant plasmid, containing both alcohol dehydrogenase and pyruvate formate-lyase in one operon, was introduced into the E. coli BL21 (DE3) strain, higher amounts of bioethanol were produced as compared to the recombinant strain containing only the alcohol dehydrogenase gene and almost two-fold greater than the amount produced by the wildtype E. coli BL21 (DE3) strain (Fig. 4). The increase in bioethanol production was related to the increased in hydrogen production, since overexpression of pyruvate formate-lyase increases the conversion rate of pyruvate into formate by generating more molecules of NADH and achieves redox balance. The higher NADH availability led to a shift toward the production of ethanol as the major fermentation product [38]. However, Murarka et al., 2008, suggested that accumulation of hydrogen gas has a negative effect on the metabolism of glycerol owing to hydrogen recycling and use as an electron donor in the reduction of fumarate to succinate, a process that ultimately led to a significant redox imbalance. Therefore, in our experiment we used a sili stopper instead of aluminum foil to prevent the accumulation of hydrogen. Therefore, the production of hydrogen may be increased by overexpression of pflB (pyruvate formate-lyase), along with the alcohol dehydrogenase (adhE) gene, and hence, bioethanol production improved. We, therefore, used the pEB strain for subsequent experiments designed to optimize various process parameters in order to enhance the production of bioethanol. Incubation time and temperature were the first key factors investigated. The pEB strain was incubated at 30 ◦ C, 34 ◦ C, and 37 ◦ C for varying time intervals. The strain pEB produced the greatest amount of bioethanol after 42 h of incubation at 34 ◦ C (Fig. 5A). Further, increase the temperature reduced bioethanol production but increased the production of byproduct such as acetate. Thus, the pEB strain, when incubated at 37 ◦ C, produced the lowest amount of ethanol but the highest amount of acetate as compared to when it was incubated at 32 ◦ C and 34 ◦ C (Table 2). Lee et al., 2010, also described the effect of temperature on the production

214

L.P. Thapa et al. / Enzyme and Microbial Technology 53 (2013) 206–215

of bioethanol by recombinant strains in glucose medium, and they found that a lower temperature (32 ◦ C) is suitable for the production of bioethanol in the E. coli BL21 (DE3) strains. Likewise, the effect of initial media pH was investigated by incubating pEB at different pH levels for 42 h at 34 ◦ C. The optimal condition for the conversion of glycerol into bioethanol was determined to be pH 7.6 (Fig. 5B). These findings indicate that E. coli is sensitive to changes in pH, as a change in growth medium pH affected the growth and bioethanol production. It has been noted that the most important characteristic of micro-organisms is their strong dependence on extracellular pH for cell growth and enzyme production [39]. The pH requirements vary from species to species, and even between different strains of the same species isolated from different habitats. Similarly, the effects of glycerol, ammonium sulphate and tryptone concentrations were optimized using the SAS 9.1 program, and the influence of the main factors and interactions were analyzed using statistical models (Eq. (1)). The shapes of the threedimensional surfaces and contour plots are shown in Fig. 6. These graphs represent the material balance responses-bioethanol yield versus glycerol, ammonium sulphate, and tryptone concentrations. The response surface plot clearly demonstrated the interactions between three positive nutritional factors (Figs. 6A–C). Calculation by Eq. (1) predicted the highest amount of bioethanol production, 2.78 g/L, when 7.07 g/L glycerol, 3.15 g/L tryptone, and 39.37 g/L ammonium sulphate were applied. Nitrogen sources are macronutrients, primarily required for the synthesis of cellular materials in microorganisms. Ammonium sulphate is generally a common nutrient supplemented for nitrogen and sulfur. Nitrogen is an important ionic growth factor in determining the rate of fermentation, as it controls the synthesis of proteins and nucleic acids [40,41]. Sulfur is a constituent of proteins, such as amino acids, cysteine, methionine, and some coenzymes, such as cocarboxylase [41]. Tryptone is an organic nitrogen source, which exhibited a significant positive effect on bioethanol production. This result confirms the specific requirement of tryptone as a nitrogen source for E. coli and is consistent with the result of many previous studies that showed that nitrogen sources affect microbial biosynthesis of bioethanol, and different types of nitrogen sources are generally effective in different microbial strains [42]. Finally, we investigated the effect of magnesium chloride and phosphate salts on ethanol production by the pEB recombinant strain by using optimized-temperature, incubation time, initial medium pH, and concentrations of glycerol, ammonium sulphate, and tryptone-conditions. Magnesium is an essential mineral nutrient for the growth of microorganisms. For example, ATP, the main energy source in cells, must be bound to a magnesium ion in order to be biologically active. Thus, the addition of magnesium chloride increases the production of bioethanol by generating more molecules of ATP (Fig. 7A). The addition of phosphate salts increases efficiency of the fermentation process of glycerol, since it also increases the formation of adenosine triphosphate (ATP). Depletion of potassium, phosphate, or magnesium ions leads to a reversible increase in the rate of protein degradation and an inhibition of ribonucleic acid (RNA) synthesis in E. coli [43]. Thus, the addition of phosphate salts in the production medium is required to increase the generation of ATP molecules, prevent degradation of protein, and inhibit RNA synthesis during bioethanol production (Fig. 7B). Immobilization of microbial cells permits immobilization of multistep and cooperative enzyme systems. Immobilization also avoids inactivation of enzymes during the fermentation process and increases the stability of many membrane-associated enzymes. Immobilization of cells also facilitates the control of process variables and reduces the risk of contamination. Thus, batch fermentation of immobilized cells in a bioreactor was performed using the optimized conditions because most industrial processes for

ethanol production use batch systems instead of shake-flask studies. The maximum amount of bioethanol produced by immobilized cells was 2.73 g/L. Based on the results obtained from the shakenflask experiments, we expected that greater amounts of bioethanol would be obtained after induction during the fed-batch fermentation of the pEB strain; however, the amount of bioethanol decreased slightly. The conversion rate of glycerol into bioethanol was lower than in the flask culture, perhaps due to a lower number of immobilized cells present in the fermentation process than in the flask incubation. 5. Conclusion In the present study, we investigated the effects of gldA, dhaK, pykA, pflB and adhE genes on bioethanol production in recombinant E. coli BL21 (DE3) strains by activating the fermentative pathway. Overexpression of the pACYEB recombinant plasmid, containing alcohol dehydrogenase and pyruvate fumarate-lyase, increased bioethanol production by two-fold, compared to the amount produced by the wild-type strain. Overexpression of pETLT, containing gldA, dhaK and pykA, improved bioethanol yield by almost twofold over the amount in the wild-type strain; however, the yield was slightly lower than that from the pACYEB recombinant plasmid. These results indicate that the production of bioethanol by overexpressing the adhE gene along with pflB is effective because the increase in bioethanol production was related to an increase in hydrogen production. The results obtained in this study will provide valuable guidelines for engineering bioethanol producers. Acknowledgments This work was supported by the Advanced Biomass R&D Center (ABC-2010-0029799) of Korea Grant funded by the Ministry of Education, Science and Technology. This research was also supported by the Creative Allied Project (CAP) of the Korea Research Council of Fundamental Science & Technology (KRCF). References [1] Chen Z, Liu H, Zhang J, Liu D. Elementary mode analysis for the rational design of efficient succinate conversion from glycerol by Escherichia coli. Journal of Biomedicine and Biotechnology 2010:14, http://dx.doi.org/10.1155/2010/518743. Article ID 518743. [2] Xu Y, Liu H, Du W, Sun Y, OuX, Liu D. Integrated production for biodiesel and 1,3-propanediol with lipase catalyzed transesterification and fermentation. Biotechnology Letters 2009;31(9):1335–41. [3] Chen Z, Liu H, Liu D. Regulation of 3-hydroxypropionaldehyde accumulation in Klebsiella pneumoniae by overexpression of dhaT and dhaD genes. Enzyme and Microbial Technology 2009;45(4):305–9. [4] Chen Z, Liu HJ, Zhang JA, Liu DH. Cell physiology and metabolic flux response of Klebsiella pneumonia to aerobic conditions. Process Biochemistry 2009;44(8):862–8. [5] Hongbo Hu, Wooda Thomas K. An evolved Escherichia coli strain for producing hydrogen and ethanol from glycerol. Biochemical and Biophysical Research Communications 2010;391(1):1033–8. [6] Srinophakun P, Reakasame S, Khamduang M, Packdibamrung K, Thanapi A. Potential of l-phenylalanine Production from raw glycerol of palm biodiesel process by a recombinant Escherichia coli. Chiang Mai Journal of Science 2012;39(1):59–68. [7] Parawira W. Biotechnological production of biodiesel fuel using biocatalysed transesterification: a review. Critical Reviews in Biotechnology 2009;29(2):82–93. [8] Sabourin-Provost G, Hallenbeck PC. High yield conversion of a crude glycerol fraction from biodiesel production to hydrogen by photofermentation. Bioresource Technology 2009;100:3513–7. [9] Jhonson DT, Taconi KA. The glycerin glut: options for the value-added conversion of crude glycerol resulting from biodiesel production. Environmental Progress 2007;26:338–48. [10] Da Silva GP, Mack M, Contiero J. Glycerol: a promising and abundant carbon source for industrial microbiology. Biotechnology Advances 2009;27:30–9. [11] Tyson KS, Bozell J, Wallace R, Petersen E, Moens L, Technical Report Biomass oil analysis: research needs and recommendations. National Renewable Energy Laboratory, U.S. Department of Energy; 2004.

L.P. Thapa et al. / Enzyme and Microbial Technology 53 (2013) 206–215 [12] Dinus RJ. Genetic Improvement of poplar feedstock quality for ethanol production. Applied Biochemistry and Biotechnology 2001;91–93:23–34. [13] Robertson GH, Doyle LR, Pavlath AE. Intensive use of biomass feedstock in ethanol conversion: the alcohol–water, vapor-phase separation. Biotechnology and Bioengineering 1983;25:3133–48. [14] Choi WJ, Hartono MR, Chan WH, Yeo SS. Ethanol production from biodieselderived crude glycerol by newly isolated Kluyvera cryocrescens. Applied Microbiology and Biotechnology 2011;89:1255–64. [15] Oh BR, Seo JW, Heo SY, Hong WK, Luo LH, Joe MH, et al. Efficient production of ethanol from crude glycerol by a Klebsiella pneumoniae mutant strain. Bioresource Technology 2011;102:3918–22. [16] Gonzalez R, Murarka A, Dharmadi Y, Yazdani SS. A new model for the anaerobic fermentation of glycerol in enteric bacteria: trunk and auxiliary pathways in Escherichia coli. Metabolic Engineering 2008;10:234–45. [17] Romeo T, Snoep JL. Glycolysis and flux control. In: Curtiss III R, Kaper JB, Squires CL, Karp PD, Neidhardt FC, Slauch JM, editors. EcoSal. Washington, DC: ASM Press; 2005., http://dx.doi.org/10.1128/ecosal.3.5.1 http://www.ecosal.org/ [18] Murarka A, Dharmadi Y, Yazdani SS, Gonzalez R. Fermentative utilization of glycerol by Escherichia coli and its implications for the production of fuels and chemicals. Applied and Environment Microbiology 2008;74: 1124–35. [19] Sawers RG, Clark DP. Fermentative pyruvate and acetyl-coenzyme A metabolism. In: Neidhardt FC, Curtiss III R, Ingraham JL, Lin ECC, Low KB, Magasanik B, Reznikoff WS, Riley N, Schaechter M, Umbarger HE, editors. Escherichia coli and Salmonella: cellular and molecular biology (web edition). Washington, DC: ASM Press; 2004, available at http://www.ecosal.org [20] Booth IR. Glycerol and methylglyoxal metabolism. In: Curtis III R, et al., editors. EcoSal-Escherichia coli and Salmonella: cellular and molecular biology. Washington, DC: ASM Press; 2005. http://www.ecosal.orgS (chapter 3.4.3). [21] Bouvet OM, Lenormand P, Carlier JP, Grimont PA. Phenotypic diversity of anaerobic glycerol dissimilation shown by seven entero bacterial species. Research in Microbiology 1994;145(2):129–39. [22] Bouvet OM, Lenormand P, Ageron E, Grimont PA. Taxonomic diversity of anaerobic glycerol dissimilation in the Enterobacteriaceae. Research in Microbiology 1995;146:279–90. [23] Lin EC. Glycerol dissimilation and its regulation in bacteria. Annual Review of Microbiology 1976;30:535–78. [24] Dharmadi Y, Muraka A, Gonzalez R. Anaerobic fermentation of glycerol by Escherichia coli: a new platform for metabolic engineering. Biotechnology and Bioengineering 2006;94:821–9. [25] Mandel M, Higa A. Calcium dependent bacteriophage DNA infection. Journal of Molecular Biology 1970;53:159–62. [26] Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA. Practical Streptomyces genetics. Norwich: John Innes Foundation; 2000. [27] Sambrook J, Russell DW. Molecular cloning: a laboratory manual. 3rd ed Cold Spring Harbor, New York: Cold Spring Harbor Laboratory; 2001.

215

[28] Shin SH, Kim S, Kim JY, Lee S, Um Y, Oh MK, et al. Complete genome sequence of Enterobacter aerogenes KCTC 2190. Journal of Bacteriology 2012;194(9):2373–4. [29] Khamduang M, Packdibamrung K, Chutmanop J, Chisti Y, Srinophakun P. Production of l-phenylalanine from glycerol by a recombinant Escherichia coli. Journal of Industrial Microbiology and Biotechnology 2009;36:1267–74. [30] Chi Z, Zhao S. Optimization of medium and cultivation conditions for pullulan production by new pullulan-producing yeast. Enzyme and Microbial Technology 2003;33:206–21. [31] Converti A, PeregoP. Use of carbon and energy balances in the study of the anaerobic metabolism of Enterobacter aerogenes at variable starting glucose concentrations. Applied Microbiology and Biotechnology 2002;59:303–9. [32] Gottschalk G. Bacterial metabolism. 2nd ed New York: Springer-Verlag; 1986. [33] Lee SG, Kim YJ, Han SI, Oh YK, Park S, Kim YH, et al. Simulation of dynamic behavior of glucose- and tryptophan-grown Escherichia coli using constraint based metabolic models with a hierarchical regulatory network. Journal of Microbiology and Biotechnology 2006;16:993–8. [34] Oh MK, Cha MJ, Lee SG, Rohlin L, Liao JC. Dynamic gene expression profiling of Escherichia coli in carbon source transition from glucose to acetate. Journal of Microbiology and Biotechnology 2006;16:543–9. [35] Lee SJ, Oh EK, Oh YH, Won JI, Han SK, Lee JW. Increased ethanol resistance in ethanolic Escherichia coli by insertion of heat-shock genes BEM1 and SOD2 from Saccharomyces cerevisiae. Biotechnology and Bioprocess Engineering 2010;15:770–6. [36] Dellomonaco C, Fava F, Gonzalez R. The path to next generation biofuels: successes and challenges in the era of synthetic biology. Microbial Cell Factories 2010;9:3. [37] Yao S, Mikkelsen MJ. Metabolic engineering to improve ethanol production in Thermoanaerobacter mathranii. Applied Microbiology and Biotechnology 2010;88:199–208. [38] Susana JBR, George NB, Sann KY. Metabolic engineering of Escherichia coli: increase of NADH availability by overexpressing an NADþ-dependent formate dehydrogenase. Metabolic Engineering 2002;4:217–29. [39] Kumar CG, Takagi H. Microbial alkaline proteases: from a bioindustrial view point. Biotechnology Advances 1999;17:561–94. [40] Harrison JS, Graham JC. Yeasts in the distillery practice. In: Rose AH, Harrison JS, editors. Yeast technology. The yeast, vol. 3. New Work: Academic Press; 1970. p. 283. [41] Stanier RY, Doudoroff M, Adelberg EA. The microbial world. Englewood Cliffs, NJ: Prentice-Hall; 1970. [42] Shaikh SA, Khire JM, Khan MI. Production of ␤-galactosidase from thermophilic fungus Rhizomucor sp. Journal of Industrial Microbiology and Biotechnology 1997;19:239–45. [43] John Stac, goldberg AL. Effects of starvation for potassium and other inorganic ions on protein degradation and ribonucleic acid synthesis in Escherichia coli. Journal of Biotechnology 1980;143(3):1223–33.