- Email: [email protected]
Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen
G Model
ARTICLE IN PRESS
PRBI-10554; No. of Pages 10
Process Biochemistry xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Process Biochemistry journal homepage: www.elsevier.com/locate/procbio
Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen Na-Reum Ha a , Sang-Choon Lee a , Jae-Wook Hyun b , Moon-Young Yoon a,∗ a b
Department of Chemistry and Research Institute of Natural Sciences, Hanyang University, Seoul 133-791, Republic of Korea Citrus Research Station, National Institute of Horticultural and Herbal Science, RDA, Jeju 699-946, Republic of Korea
a r t i c l e
i n f o
Article history: Received 11 August 2015 Received in revised form 5 November 2015 Accepted 6 November 2015 Available online xxx Keywords: Citrus canker FtsZ SELEX ssDNA aptamer Antibacterial agent
a b s t r a c t Citrus canker caused by Xanthomonas axonopodis pv. citri (X. axonopodis) is a plant pathogenic bacterial disease infectious to citrus crops, resulting in reduced fruit quality and premature fruit drop. Many chemical substances to prevent citrus canker cannot cure the progressive disease caused by drug resistant pathogens. In this study, we identified the filamentous temperature-sensitive Z (FtsZ) protein of X. axonopodis, a GTPase essential for bacteria cell division, as a new target for anti-citrus canker agent. We found nine single-stranded DNA aptamers with 44–444 nM Kd values against recombinant FtsZ, using SELEX. Among these aptamers, three FtsZ binding aptamers (FBAs) exhibited potent inhibitory effects with IC50 values of 1–2 M similar to berberine, a well-known commercial antibacterial agent. Furthermore, the FBAs also demonstrated high growth inhibitory activity at the cellular level with MIC50 values in the 100 M range. Consequently, this is the first report of a biocompatible inhibitory aptamer as a drug against X. axonopodis FtsZ, and provides a novel strategy for the development of eco-friendly citrus canker prevention agents, thereby replacing the presently used chemical-based drug in near future. © 2015 Elsevier Ltd. All rights reserved.
1. Introduction Of all the agricultural pests which threaten citrus crops, citrus canker, one of the most devastating diseases caused by Xanthomonas axonopodis pv. citri (X. axonopodis), is an economically representative disease of many citrus species such as lime, orange, lemon, pomelo, etc. [1]. At least 4 distinct types (Asiatic canker, Cancrosis B, Mexican lime cancrosis, and Citrus bacteriosis) of citrus canker are currently recognized. Among these types, the Asiatic canker (Canker A) is the most powerfully destructive to major citrus cultivars. Severe infection leads to a variety of effects including defoliation, dieback, severely blemished fruit, reduced fruit quality and premature fruit drop [2]. To prevent the disease, many chemical substances have been used and novel products are being continuously developed. Copper-containing products offer some protection along with field-grade antibiotics, especially streptomycin, used as preventative agents in food crops. Curative
Abbreviations: FtsZ, filamenting temperature sensitive mutantZ; X. axonopodis, Xanthomonas axonopodis pv. citri; SELEX, systematic evolution of ligands by exponential enrichment; IC50 , half maximal inhibitory concentration; MIC50 , half minimum inhibitory concentration. ∗ Corresponding author at: Department of Chemistry and Research institute of Natural Sciences, Hanyang University, 222 Wangsimni-ro, Seongdong-gu, Seoul 133-791, Republic of Korea. Fax: +82 2 2298 0319. E-mail address: [email protected] (M.-Y. Yoon).
applications of chemical-based pesticides reduce bacterial proliferation or spread of the bacterium, however, there is currently no cure for disease that has already progressed [3]. Furthermore, the use of chemical-based drugs for the prevention of citrus canker not only causes resistance to various drugs, it also has harmful effects on human health. Thus, such measures cannot be permanently used, and new approaches such as the development of effective eco-friendly antibiotic drugs that prevent widespread citrus canker need to be investigated. FtsZ (Filamenting temperature sensitive mutant Z) assembles into a highly dynamic ring structure called the Z-ring, and has GTPase activity. It is the major cytoskeletal protein in the bacterial cytokinesis mechanism of cell division in prokaryotic bacteria [4], and is homologous to the eukaryotic cytoskeleton protein (tubulin) [5,6]. The dynamic assembly of FtsZ plays an important role in the regulation of Z-ring formation [7,8]. The Z-ring leads to the constriction of membranes, formation of a septum and division of the cell. Therefore, the use of an FtsZ inhibitor could block Z-ring formation and eventually inhibit bacterial cell division. For last couple of decades, the FtsZ proteins from various species of bacteria, such as Bacillus anthracis (B. anthracis), Bacillus subtilis (B. subtilis), Escherichia coli (E. coli), Pseudomonas aeruginosa (P. aeruginosa), and Mycobacterium tuberculosis (M. tuberculosis), have been studied and many chemical inhibitors have been developed [9–12]. Therefore, it is considered to be a good target for the development of a new class of antibiotics [13–16].
http://dx.doi.org/10.1016/j.procbio.2015.11.008 1359-5113/© 2015 Elsevier Ltd. All rights reserved.
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008
G Model PRBI-10554; No. of Pages 10
ARTICLE IN PRESS N.-R. Ha et al. / Process Biochemistry xxx (2015) xxx–xxx
2
Aptamers are short single-stranded nucleic acid (DNA or RNA) molecules which bind to target molecules with high specificity and binding affinity because of their three-dimensional structure, characterized by stems, loops, hairpins, or quadruplexes, and can be screened for by the systematic evolution of ligands by exponential enrichment (SELEX) method [17,18]. The SELEX method is a widely used against various targets, including small molecules, proteins, cells, tissues and organisms [19]. As aptamers are quite small biological molecule in comparison with large molecules such as proteins, and antibodies, aptamers have various merits including simplicity to be synthesized and modified chemically, being small in size and having low immunogenic property. Consequently, aptamers have recently been used in biological applications, particularly as therapeutic agents [20]. In this study, we cloned and purified the FtsZ protein from X. axonopodis. Through 8 rounds of the SELEX process, we obtained 9 highly specific aptamers and characterized their binding affinity and specificity. Furthermore, we ultimately selected 3 candidate aptamers that showed inhibition of FtsZ polymerization activity within the micromolar range of half maximal inhibitory concentrations (IC50 ) in protein levels using an in-vitro FtsZ polymerization assay and bacterial growth inhibition within the 100 micromolar range of half minimum inhibitory concentration (MIC50 ) values in cellular levels using a surface viable counting assay. We suggest that the FtsZ protein could be a new target for antimicrobial agents, and the FtsZ binding aptamers (FBAs) may represent a novel and potent prevention agent for citrus canker.
Protein expression was induced by addition of 0.5 mM isopropyl-d-thiogalactopyranoside (IPTG) and cells were grown at 37 ◦ C for 6 h. In order to purify the FtsZ protein, the induced cells were harvested by centrifugation at 4,000 rpm for 20 min. The cells were then re-suspended in 50 ml buffer-A containing 20 mM Tris (pH 7.4) and 0.4 M NaCl with 1 mM phenylmethylsulfonyl fluoride (PMSF) dissolved in isopropanol, 0.5 mg ml −1 lysozyme, and sonicated. The induced FtsZ protein was obtained by centrifugation, and loaded onto a Ni2+ -charged chelating sepharose column for affinity chromatography (Vc (column volume) = 8 ml, Amersham Biosciences, Piscataway, NJ, USA). A linear gradient from 20–500 mM imidazole in elution buffer was used to elute the FtsZ protein, and fractions containing protein were concentrated. The final concentration of purified FtsZ protein was determined by Bradford assay, following the manufacturer’s protocol (Bio-Rad, Hercules, CA, USA). 2.4. Activity test of the purified FtsZ with polymerization assay
2. Materials and methods
The measurement of FtsZ activity was conducted by assembly of FtsZ in the presence of GTP using a standard polymerization assay. The FtsZ protein was used in a range of concentrations, 2.3 M (0.1 mg ml−1 ) to 11.1 M (0.5 mg ml−1 ), and was incubated in polymerization buffer containing 50 mM MES (2-(N -morpholino) ethanesulfonic acid, pH 6.5), 50 mM KCl, and 10 mM MgCl2 ) [22]. The polymerization reaction was initiated by adding 1 mM GTP into the reaction mixture for 1 h, and the signal was continuously measured to identify the polymerization of the FtsZ protein at intervals of 20 s at 350 nm by UV-spectrophotometer (Mecasys, Daejeon, Korea).
2.1. Materials
2.5. In-vitro aptamer screening against FtsZ
X. axonopodis pv.citri was obtained from the Citrus Research Station (Jeju Island, Korea) and grown on Nutrient-Yeast extract Agar at 30 ◦ C. Primers and the template for ssDNA library were synthesized by Bioneer (Daejeon, Korea). pfu polymerase was purchased from Solgent (Daejeon, Korea), and restriction endonucleases and DNA ligases from Takara Bio (Shiga, Japan). GTP and berberine were purchased from Sigma (St. Louis, MO, USA), and nutrients (bactotryptone, yeast extract and bacto-agar) were obtained from BD Difco Laboratories (Sparks, NV, USA). All chemicals were obtained from commercial sources and were the highest quality available.
Genomic DNA was isolated from X. axonopodis using a general alkaline lysis protocol, and served as the template in polymerase chain reactions (PCR). The DNA fragment encoding the open reading frame (ORF) of the FtsZ gene from X. axonopodis was amplified by PCR with gene specific primers, (forward: 5 ATATGGATCCATGGCACATTTCGAACTGATTGAAAAAATGGC-3 containing BamH I (bold) and reverse: 5 ATATCTCGAGTCAGTCGGCCTGGCGGCGCAGGAA-3 containing Xho I (bold)), and the amplified PCR product was confirmed on a 1% agarose gel. Then, the amplified FtsZ gene fragment was inserted into a pET28a (+) expression vector (Novagen, Madison, WI, USA) for the production of a recombinant fusion protein that included hexa-histidine tags at the C-terminal end. The cloned sequence of the FtsZ-pET28a gene was analyzed by Macrogen (Seoul, Korea) [21].
In order to prepare the single-stranded DNA (ssDNA) library containing 30 bases of randomized sequence and two primers binding sequences for PCR amplification and cloning, the template for ssDNA library, 5 -ATGCGGATCCCGCGC-(N30 )GCGCAAGCTTCGCGC-3 , was obtained from Bioneer. The template for ssDNA library was amplified by asymmetric PCR with one of the primers in excess, specifically forward primer in this case (forward primer: 5 -ATGCGGATCCCGCGC-3 with BamH I (bold) site and reverse primer: 5 -GCGCAAGCTTCGCGC-3 with Hind III site (bold)). Amplification of ssDNA library was confirmed by 12% native polyacrylamide gel electrophoresis. Product was obtained using a crush-and-soak and ethanol precipitation method and the ssDNA library used for aptamer screening was generated [23]. FtsZ protein dissolved in 50 mM Tris–HCl (pH 7.4) was incubated with 1 g ml−1 ssDNA library at room temperature. To remove the unbound aptamers, membrane filtration using Vivaspin ultrafiltration spin columns with 30 kDa cut-off (Sartorius Stedim Biotech GmbH, Goettingen, Germany) was used, and proteinbound aptamers were separated by centrifugation at 14,000 rpm for 15 min [21]. For the next round, the eluted ssDNA was amplified by asymmetric PCR, and amplified ssDNA was checked by loading on a 12% native polyacrylamide gel. ssDNA in the gel was further purified and recovered by the gel elution and crush-and-soak method, as described above. In order to increase the specificity of the ssDNA aptamer, negative selection was performed with bovine serum albumin (BSA) during round 4 of SELEX, and the unbound ssDNA was collected by centrifugation. A total of 8 rounds of SELEX were performed under harsh conditions (Table 1).
2.3. Expression and purification of the FtsZ protein
2.6. Analysis of aptamer sequences and secondary structures
E. coli BL21 (DE3) cells harboring the FtsZ plasmid were grown in 1.5 L of Luria–Bertani (LB) medium containing 100 mg ml−1 kanamycin until the optical density (OD600 ) reached 0.7 at 37 ◦ C.
To analyze the FtsZ binding aptamers (FBAs) sequence, the ssDNA library pool obtained from the final round of SELEX was amplified by symmetric PCR using 10 M of each primer. The
2.2. Cloning of X. axonopodis FtsZ and plasmid construction
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008
G Model
ARTICLE IN PRESS
PRBI-10554; No. of Pages 10
N.-R. Ha et al. / Process Biochemistry xxx (2015) xxx–xxx
3
Table 1 SELEX conditions used in each round. Round
Protein (g mL−1 )
Buffers
1st 2nd 3nd 4th 5th 6th 7th 8th
Tris [mM]
NaCl [mM]
Tween 20 (%)
50 (pH 7.4)
50 100 150 200 250 300 350 400
0.05 0.1 0.15 0.2 0.25 0.3 0.35 0.4
amplified double-stranded DNA (dsDNA) was digested with restriction endonucleases (BamH I and Hind III), and inserted into the pET28a (+) expression vector. The ligation product was confirmed by electrophoresis on a 1% agarose gel, and the sequence was determined by sequence analysis from Macrogen (Seoul, Korea). The secondary structures of the ssDNA aptamers were predicted by using M-fold free software [24,25]. 2.7. Estimation of binding affinity and specificity The apparent binding affinities of FBAs were measured using an enzyme-linked immunosorbent assay (ELISA) method with 5 biotin-conjugated FBAs (biotin-FBAs) synthesized by Bioneer and streptavidin-conjugated horseradish peroxidase (HRP) antibody (BD Biosciences, Franklin Lakes, NJ, USA) [21]. 22 nM (1 g ml−1 ) FtsZ protein, dissolved in TBS buffer (20 mM Tris–HCl (pH 8.0) and 150 mM NaCl), was immobilized on a 96-well polystyrene plate (SPL, Kyounggi-do, Korea) for 2 h. The wells were washed 3 times with TBST (TBS containing 0.05% Tween-20) and then incubated with 2% bovine serum albumin (BSA) for 1 h to block nonspecific interactions. After 5 gentle washes, each biotin-FBA was added in a concentration dependent manner and incubation was carried out for 2 h. The unbound aptamers were removed through 10 washing steps. Then, streptavidin-conjugated HRP (1:2,000 dilution in TBST) was added for 1 h, and bound FBAs were detected by addition of 3, 3 , 5, 5 -tetramethyl benzidine (TMB) solution (R&D Systems, Minneapolis, MN, USA). After 15 min incubation, the reaction was terminated by adding 1 M H2 SO4 , and the signal was measured using a SpectraMax M2 Multi-Mode Microplate Reader (Molecular Devices, Sunnyvale, CA, USA) at 450 nm. The binding ability of FBAs to X. axonopodis FtsZ and BSA was measured, and apparent binding affinities were estimated with the difference of absorbance value for bound FBA using the Origin Program. The binding specificity of FBAs towards the target protein was also evaluated by using other homologous FtsZ protein from B. anthracis and BSA.
10 10 10 5 5 3 3
ssDNA (g mL−1 )
Incubation (min)
1 1 0.5 0.5 0.3 0.3 0.2 0.2
60 60 45 45 45 30 30 30
2.9. Surface viable counting assay X. axonopodis was cultured on Nutrient-Yeast extract (NY) broth (BD Difco, Sparks, NV, USA) at 30 ◦ C until the OD600 reached 0.59. To determine the number of bacterial cells, 100 L of serial diluted cell cultures were spread on Nutrient-Yeast extract Agar (NYA) plates and incubated for 48 h at 30 ◦ C. The 103 colony-forming unit (CFU) ml−1 cells were selected for the bacterial cell growth inhibition test. To evaluate the antibacterial effect of FBAs, a surface viable counting assay was carried out [27]. A 103 CFU ml−1 of X. axonopodis cells with different concentrations of FBAs were tested for inhibition of cell growth. Samples under each condition were incubated for 3 h at room temperature and spread on NY Agar plates. The plates were then incubated for 48 h at 30 ◦ C and the inhibition effect was identified by counting the number of colonies. 2.10. Cytotoxicity assay Raw 264.7 cells in Dulbecco’s Modified Eagle Medium (DMEM) containing 10% fetal bovine serum (FBS) and 1% antibiotic solution (penicillin-streptomycin) were counted by hemocytometer, and a total 1 × 105 cells were seeded in 96-well plates and incubated with the condition of 5% CO2 at 37 ◦ C overnight. The cells were washed once with PBS (pH 7.5), after fresh media was added. Next, the cells were treated with various concentration of aptamers (from 6.25 M to 400 M) and incubated with the condition of 5% CO2 at 37 ◦ C for 4 h. To analyze the cell viability, a 1 mg ml−1 of the MTT solution (3-(4, 5-Dimethylthiazol-2-yl)-2, 5-Diphenyltetrazolium Bromide) was added on each well and incubated with above mentioned same condition for 4 h. Then, the dimethyl sulfoxide (DMSO) as a solubilization solution for formazan crystal was treated. 10% DMSO was used as a negative control. The absorbance was measured at 570 nm by a microtiter plate reader.
2.8. In-vitro inhibition assay
3. Results and discussion
The evaluation of the inhibition potency of the screened FBAs was conducted in the same manner as the FtsZ polymerization assay. Each FBA was pre-incubated with 11.1 M (0.5 mg ml−1 ) FtsZ protein in polymerization buffer for 30 min, and the reaction was initiated by adding 1 mM GTP. The turbidity, which corresponds to the degree of polymerization, was monitored by measuring the absorbance at 350 nm by UV-spectrophotometer. All data were plotted using the Origin Program. The IC50 was determined by fitting the following equation related with inhibition percentages based on absorbance for turbidity, where V0 is the reaction rate without inhibitor, Vf is the rate at saturating inhibition, and [I] is the inhibitor concentration [26].
3.1. Cloning and purification of X. axonopodis FtsZ protein
=
V0 − Vf × IC50 IC50 + [I]
+ Vf
The X. axonopodis FtsZ gene was amplified by PCR with extracted genomic DNA as a template and the designed primers. Amplification was confirmed on a 1% (w/v) agarose gel. As shown in Fig. 1A, the length of the amplified gene was approximately 1.2 kbp (exactly 1239 bp). To prepare recombinant protein, the gene was inserted into the pET 28a (+) expression vector after treatment with restriction endonucleases, transformed into E. coli BL21 (DE3) cells. The recombinant X. axonopodis FtsZ was expressed, and purified using Ni2+ -charged sepharose resin by histidine-tag affinity chromatography. The purified FtsZ protein was determined to be soluble, more than 95% homogeneous and was approximately 45 kDa by 12% SDS-PAGE (Fig. 1B). The purified protein was concentrated up to 2.5 mg ml−1 and used for further studies.
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008
G Model PRBI-10554; No. of Pages 10 4
ARTICLE IN PRESS N.-R. Ha et al. / Process Biochemistry xxx (2015) xxx–xxx
Fig. 1. Cloning and purification of the X. axonopodis FtsZ protein. (A) PCR product for the FtsZ gene on a 1% (w/v) agarose gel. Lane M, 25/100 bp DNA ladder; lane 1, amplified FtsZ gene (1239 bp). (B) Purified recombinant FtsZ protein on a 12% SDS-PAGE gel. Lane M, Protein ladder; lane 1, BL21(DE3) lysate before expressed; lane 2, BL21(DE3) lysate after expressed; lane 3, lysate before binding on column; lane 4, lysate after binding on column; lane 5, purified FtsZ protein (approximately 45 kDa) after concentration of all of the fractionized solution.
3.2. Characterization of recombinant X. axonopodis FtsZ protein FtsZ is structurally similar to its homologue in eukaryotes, tubulin, and forms polymers in the presence of GTP. The activity of purified recombinant FtsZ was measured by the absorbance value at 350 nm, which means the turbidity of the reaction, and the polymerization of FtsZ was monitored in a protein concentration dependent manner [22]. Various concentrations of FtsZ were pre-incubated in polymerization buffer for 10 min, and 1 mM GTP was added to initiate polymerization. As shown in Fig. 2, the signal, corresponding to turbidity strength, promptly increased with increasing protein concentration and the addition of GTP. In the presence of high concentrations of the FtsZ protein, polymerization progressed more rapidly, and the maximum signal was detected at 11.1 M (0.5 mg ml−1 ) of FtsZ. As the GTP was continually consumed, the absorbance signal was slowly recovered by depolymerization of FtsZ. In comparison with other bacterial FtsZ proteins, the polymerization (20 min) and depolymerization (1 h) of X. axonopodis FtsZ were definitely much slower than those of E. coli FtsZ (within 30 s for polymerization and 25 min for depolymerization) [22], and B. anthracis FtsZ (within 10 s for polymerization and polymerization was maintained for a prolonged period) [26], but faster than M. tuberculosis FtsZ (10 min for polymerization and 5 h for depolymerization) [28]. It is likely that the relatively slow assembly of X. axonopodis FtsZ was due to lower GTPase activity. The degree of FtsZ polymerization activity is not only quite important in bacterial cell growth, but also affects cell division time. The generation time for X. axonopodis cell growth is less than 3 h [29], which is explained by the fact that X. axonopodis has a long cell division time caused by having lower GTPase activity than others, including E. coli (20 min) [30], B. anthracis (50 min) [31]. However, since X. axonopodis FtsZ has higher GTPase activity than M. tuberculosis FtsZ, X. axonopodis has shorter generation time than that of M. tuberculosis (16–22 h) [32]. This growth rate corresponds significantly with the results for FtsZ polymerization activity. Consequently, FtsZ could be a key factor in regulating cell growth in X. axonopodis. 3.3. Identification of FtsZ binding aptamer and structural analysis The purified FtsZ protein and the ssDNA library obtained by asymmetric PCR were used for aptamer screening, and 8 rounds of the SELEX process were performed (Fig. 3). To select aptamers with high affinity and specificity, rounds of SELEX were performed using the following harsh conditions: increasing salt and detergent concentrations, decreasing binding times, protein and ssDNA library concentrations (Table 1). In particular, the monovalent cations and
detergent in the binding buffer are known to play a role in reducing the nonspecific binding of the aptamer to the target. After completing the SELEX process, nine FtsZ binding aptamers (FBAs), each with a different 30-base sequence, were selected (Table 2). To understand the binding of an individual aptamer to its target, we analyzed the secondary structures using the M Fold program [24,25]. As shown in Fig. 4, all of the predicted structures had a unique stem-and-loop structure and specific Gibbs free energy ( G) indicating structural stability. Among FBAs, FBA 8 had the lowest energy value (G = − 6.93 kcal mol−1 ), whereas FBA 1 had a positive energy value (G = 0.11 kcal mol−1 ). Interestingly, each FBA had its own loop structure formed by the random sequence region of the aptamer. We anticipate that the specific structures of each FBA might play a particularly crucial role in binding to the target.
3.4. Characterization of screened aptamers: binding affinity and specificity Binding affinity of aptamer was measured by ELISA using biotinlabelled FBAs. As described in Table 2 and Fig. 5, the binding affinities (Kd ) of FBAs were calculated to be in the concentration of 44–444 nM range. Among the FBAs, FBA 2 and FBA 6 exhibited lower binding affinities (44.5 nM and 80.6 nM, respectively) than the others we characterized. FBA 1 and FBA 9 showed relatively higher binding affinities (283 nM and 444 nM, respectively). Although the all FBAs had similar structures, their binding affinities are different. Interestingly, in cases of FBA 5 and FBA 7, both aptamers had very close structures, however FBA 5 had an approximately 3-fold increased relative binding affinity. This suggests that the binding of aptamers to the target molecule were affected by structure as well as sequence. The target specificity test was performed with a biotinylated FBAs against B. anthracis FtsZ and BSA. The B. anthracis FtsZ shares 50% sequence identity with X. axonopodis FtsZ, as determined by the NCBI blast program (Fig. S3). B. anthracis FtsZ was purified via E. coli expression system and identified the polymerization activity as the same conditions as X. axonopodis FtsZ (Figs. S1 and S2). Among FBAs, FBA 1, 4, 5–7, and 9 were exhibited similar binding property between X. axonopodis FtsZ and B. anthracis FtsZ. In contrast, FBA 2, 3, and 8 were only showed a high binding ability specifically against X. axonopodis FtsZ. Moreover, in case of BSA, all FBAs exhibited a high binding specificity against X. axonopodis FtsZ (Fig. 6). Consequently, according to the binding affinity and specificity, the FBA 2 and 8 showed an outstanding binding capability against FtsZ protein.
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008
G Model
ARTICLE IN PRESS
PRBI-10554; No. of Pages 10
N.-R. Ha et al. / Process Biochemistry xxx (2015) xxx–xxx
5
Fig. 2. In-vitro polymerization assay of the X. axonopodis FtsZ protein. Polymerization occurred immediately upon addition of 1 mM GTP. Various concentrations of X. axonopodis FtsZ were incubated in a polymerization reaction buffer, and then the absorbance at 350 nm was monitored.
Fig. 3. Overall schematic of the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) method, including the binding, elution, and amplification steps, for the selection of aptamer against FtsZ protein. Table 2 FBAs screened and their binding affinities. No.
Occurrencesa
Aptamer sequences
Binding affinityb (Kd , nM)
FBA 1 FBA 2 FBA 3 FBA 4 FBA 5 FBA 6 FBA 7 FBA 8 FBA 9
2 6 4 2 3 2 2 6 3
GGAGTCGTAGGGTTGTGCGTTGTCTCTGTC GCACAGCAGGGGGCCACCCGCACGTGGTCG CGACGTGAGGAAGGCGCGCTGGTTTGCACC GCACGAAGTGACGCGCCTCCTTGTGTGTCG CACGCAACGAGTGGCGCGCCTTGTTTCGGC CGACGTCAGAGAGGCGCGCTACTGCGTACC GCCGAAACAAGGCGCGCCACTCGTTGCGTG GCAGTGAGGGGCACGCACCCGTGGCGGGTG GCACACCGGAGGGGGGCTGCACTGGCCGTG
283 ± 10.6 44.5 ± 32.6 186 ± 10.0 276 ± 32.3 277 ± 22.9 80.6 ± 13.8 99.1 ± 6.57 176 ± 21.0 444 ± 6.34
a
After eight rounds of SELEX, a total of 30 ssDNA aptamers were selected, and their sequences were determined. Among them, nine unique sequences were identified. Binding affinities were determined as described in the Section 2. FtsZ was immobilized in individual wells of a polystyrene plate, and ssDNA aptamer was added. After extensive washing, the amount of bound ssDNA aptamer was estimated using a streptavidin-conjugated antibody which specifically recognizes the biotin label on each ssDNA aptamer. The dissociation constant (Kd ) was obtained from binding saturation curve fitting from three independent experiments. b
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008
G Model PRBI-10554; No. of Pages 10 6
ARTICLE IN PRESS N.-R. Ha et al. / Process Biochemistry xxx (2015) xxx–xxx
Fig. 4. Predicted secondary structures of the FBAs. All FBAs have a stem-loop structure consisting of a 30-mer of nucleic acid. The structural forming energy of each FBA was as follows; FBA 1 (G = 0.11 kcal mol−1 ), FBA 2 (G = − 4.44 kcal mol−1 ), FBA 3 (G = − 1.61 kcal mol−1 ), FBA 4 (G = − 3.03 kcal mol−1 ), FBA 5 (G = − 2.69 kcal mol−1 ), FBA 6 (G = − 3.50 kcal mol−1 ), FBA 7 (G = − 2.66 kcal mol−1 ), FBA 8 (G = − 6.93 kcal mol−1 ), and FBA 9 (G = − 3.91 kcal mol−1 ).
Fig. 5. Binding affinities of FBAs toward the X. axonopodis FtsZ protein. The Kd value for each FBA was determined using the ELISA method. All assays were performed in triplicate.
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008
G Model PRBI-10554; No. of Pages 10
ARTICLE IN PRESS N.-R. Ha et al. / Process Biochemistry xxx (2015) xxx–xxx
7
Fig. 6. Determination of the binding specificity of FBAs (500 nM) against X. axonopodis FtsZ by ELISA. B. anthracis FtsZ and BSA were used as negative controls and the experiments were performed in triplicate.
3.5. In-vitro inhibition analysis In order to identify potent inhibitory aptamers against X. axonopodis FtsZ, we analyzed the inhibition effect of individual FBAs on FtsZ polymerization. This was done by monitoring the degree of turbidity in the presence of FBAs via UV/vis spectrophotometer. Among FBAs, 3 different aptamers, FBA 2, 8, and 9, showed inhibitory effects with low micromolar IC50 values (2.84 M, 1.25 M and 1.64 M, respectively) (Fig. 7A). To compare the inhibition potency of FBAs, we used berberine well-known chemical inhibitor of E. coli FtsZ [33] as a positive control. We calculated an IC50 value for berberine with approximately 3.84 M, which also had a strong inhibitory effect on X. axonopodis FtsZ. In addition, when we treated the 30 mer randomly scrambled aptamer (Sc-apt) as a negative control, there is no effect on FtsZ polymerization activity (Fig. 7A). Furthermore, in order to identify the inhibitory specificity, two groups of FBAs, the inhibitory FBAs (FBA 2, 8, 9) against X. axonopodis FtsZ and FBA 5, 7 which was considerably bound to B. anthracis FtsZ, were tested. As shown in Fig. 7B, the FBAs are not given any influence on B. anthracis FtsZ polymerization activity as treated up to 30 M. The FBA 2, 8, and 9 exhibited considerably great inhibition ability in X. axonopodis FtsZ polymerization and not in B. anthracis FtsZ. An oligo-nucleic acid based aptamer can discriminate to their targets on the basis of subtle structural differences such as presence or absence of a functional group and enantiomer of the target [34]. Furthermore, a protein targets with a high structural complexity allow aptamer binding by various interactions such as stacking interaction, electrostatic interaction, and hydrogen bonding [35]. Therefore, aptamers can bind to variable region of target. Even though two species of FtsZ protein have 50% sequence identity between their sequences, these inhibitory FBAs might interact with some particular domain of X. axonopodis FtsZ and act as an inhibitor for the FtsZ polymerization. Although FBA 5 and FBA 7 bind both species of FtsZ similarly, these FBAs could not show any inhibition effect against X. axonopodis and B. anthracis FtsZ. It means that the interaction between FBAs and target protein
was unrelated with polymerization activity, and the FBA binding site and FtsZ GTPase activity region is also different. Consequently, the FBA 2, 8, and 9 exhibited high levels of in-vitro inhibition activity. Specifically, FBA 8 showed the best inhibition potency with high binding affinity and specificity against X. axonopodis FtsZ. 3.6. Inhibition potency of FBAs at the cellular level To verify the cellular inhibition effects of candidate FBAs, we carried out a surface viable counting assay with 103 CFU ml−1 of cells on a NYA plate. As shown in Fig. S4, the assay was conducted with 100 M berberine as a positive control, random 30 mer of Sc-apt as a negative control and with various concentrations of inhibitory FBAs (FBA 2, 8, and 9). In the case of berberine, a high level of inhibition of bacterial cell growth was seen (Fig. S4). Although the inhibitory FBAs exhibited inhibitory properties at higher concentrations than berberine, they were shown to be potent inhibitors of bacterial cell growth in a concentration dependent manner. As the concentrations of FBAs increased, the number of colonies dramatically decreased (Fig. S4). As a result, the MIC50 values for each inhibitory FBA were estimated to be 121.84 M for FBA 2, 111.68 M for FBA 8, and 117.49 M for FBA 9 (Fig. 8A and B) corresponding with the previous IC50 values for the FBAs. This result indicates that the antibacterial effect was strong in the presence of the FBAs, as efficient binding of each FBA to the FtsZ protein blocked polymerization. In contrast, random Sc-apt (N30 ) could not show any inhibition effect in bacterial cell growth. It means that the inhibitory FBAs targeted specifically to FtsZ and have a growth inhibition function of X. axonopodis. Furthermore, cell cytotoxicity assay was carried out to confirm that the growth inhibition of X. axonopodis is not caused by the toxic effect of FBAs on the bacterial cells. Cytotoxicity test was performed using murine macrophage cell line Raw 264.7. The inhibitory FBAs are not given any toxic effect on murine macrophage cell line as treated up to 400 M (Fig. S5). It indicates that these candidate FBAs are not influence
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008
G Model PRBI-10554; No. of Pages 10 8
ARTICLE IN PRESS N.-R. Ha et al. / Process Biochemistry xxx (2015) xxx–xxx
Fig. 7. In-vitro inhibition analysis of X. axonopodis FtsZ polymerization by FBAs. (A) Determination of the IC50 values for the candidate FBAs (FBA 2, 8, and 9), berberine. FBA 8 showed the lowest IC50 value which means it had a stronger inhibitory effect on FtsZ polymerization than berberine did. Random Sc-apt had no influence on X. axonopodis FtsZ polymerization. (B) Inhibition analysis of B. anthracis FtsZ polymerization by FBAs (30 M). FBAs had no effect on B. anthracis FtsZ polymerization.
on mammalian cells that does not have FtsZ inside the cell, and only FtsZ targeted inhibitory aptamers cause the growth inhibition of X. axonopodis that express the FtsZ inside the cell. Therefore, FBAs
may serve as efficient regulators of polymerization for FtsZ activity, Z-ring formation and even the bacterial cell growth. In the respect of FBAs characteristics, the FBA 8 exhibited the highest specificity
Fig. 8. Evaluation of the antibacterial ability of candidate FBAs at cellular level using the surface viable counting method. (A) Histogram of bacteria viability after treatment with FBAs, berberine, and Sc-apt. (B) Determination of MIC50 values for each candidate FBA.
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008
G Model PRBI-10554; No. of Pages 10
ARTICLE IN PRESS N.-R. Ha et al. / Process Biochemistry xxx (2015) xxx–xxx
and inhibition potency, and may be an attractive candidate as a citrus canker prevention agent on FtsZ inhibition. Although the FBAs had lower in-vitro IC50 values than berberine at the protein level, berberine showed more potent bacterial growth inhibition at the cellular level. Because the FtsZ protein is localized throughout the cytoplasm in bacteria, thus an inhibitor targeted to FtsZ would need to penetrate the bacterial cell membrane. However, inhibitory FBAs of high molecular weights (MW) and hydrophilicities have a difficult time passing through the bacterial cell membrane. Typically, molecules less than 500 Da can penetrate the membrane more easily than larger molecules [36]. Herein, the average MW of the FBAs used was approximately 9.0 kDa (20-fold larger than berberine (407.84 Da)). This explains why the FBAs, which had lower efficiency in cell penetration, showed less bacterial cell growth inhibition than berberine did. An electrical repulsive force also exists between the hydrophilic properties of oligonucleic acids and gram negative bacterial cell membranes [37], thus FBAs could not penetrate into cell membranes easily. According to Lipinski’s rule, antibacterial compounds should have specific physicochemical properties such as MW, lipophilicity, and hydrogen bond donors and acceptors [36,37]. Actually, the membrane penetration mechanism of aptamer is not clearly understood. As comparing to the small chemical inhibitor, berberine, which have advantages such as small size and membrane permeability, the inhibitory FBAs have a weak point in this aspect [38]. However, the FBAs identified by this study showed significantly specific inhibition against X. axonopodis FtsZ. This remarkable target specificity of FBAs could be superiority above non-selectivity of berberine [26,33]. Therefore, the FBAs could be provided significant basis for development of eco-friendly and target specific anti-citrus canker agent. Further studies will be needed to validate a target identification and improve the inhibitory effect of FBAs of the cellular level by modification of candidate aptamer such as optimum structure by size control and enhancement of hydrophobicity by attaching a chemicals. 4. Conclusion In this study, we identified and evaluated a potent ssDNA aptamers as a potential X. axonopodis FtsZ inhibitors. Specifically, we cloned gene encoding the FtsZ into a pET 28a (+) expression vector and purified the recombinant FtsZ protein using Ni2+ -charged affinity chromatography. Using a SELEX process, 9 aptamers with high affinity and specificity were identified and characterized. The binding affinity of these FBAs toward FtsZ was measured to be in the 44–444 nanomolar range of Kd value. Among these aptamers, FBA 2, 8, and 9 showed strong inhibitory effects on FtsZ polymerization with IC50 values of 1 to 2 M, and on bacterial growth inhibition, with MIC50 values of 100 M. In addition, these candidate aptamers did not show any cytotoxicity against murine macrophage cells. In conclusion, we suggest that the FtsZ protein may play a significant key role in the development of a novel antibacterial agents. The inhibitory FBAs, especially FBA 8, could be viable alternative for the existing chemical-based antibacterial agents as eco-friendly prevention agents for citrus canker. However, the internalization of inhibitory aptamer has yet not clearly understood. Further study would be required for identification of target, evaluation of the FBAs as anti-citrus canker agent via a plant-based inhibition test, and modification of the FBAs structure to improve their inhibitory effects. Acknowledgements This work was supported by the “Cooperative Research Program grants for Agriculture Science & Technology Development (Project
9
No. PJ008264)” funded by the Rural Development Administration, Republic of Korea and by Agricultural Biotechnology Development Program, Ministry of Agriculture, Food and Rural Affairs, Republic of Korea (314013-3). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.procbio.2015.11. 008. References [1] L.M. Rodriguez-R, A. Grajales, M.L. Arrieta-Ortiz, C. Salazar, S. Restrepo, A. Bernal, Genomes-based phylogeny of the genus Xanthomonas, BMC Microbiol. 12 (2012) 43. [2] J. Boch, U. Bonas, Xanthomonas AvrBs3 family-type III. Effectors: discovery and function, Annu. Rev. Phytopathol. 48 (2010) 419–436. [3] S.D. Ellis, M.J. Boehm, D. Coplin, in: K.L. Smith (Ed.), Bacterial Diseases of Plants, The Ohio State University, 2008, 2015, pp. 1–4. [4] H.P. Erickson, D.E. Anderson, M. Osawa, FtsZ in bacterial cytokinesis: cytoskeleton and force generator all in one, Microbiol. Mol. Biol. Rev. 74 (2010) 504–528. [5] S. Kapoor, D. Panda, Targeting FtsZ for antibacterial therapy: a promising avenue, Expert Opin. Ther. Targets 13 (2009) 1037–1051. [6] E. Harry, L. Monahan, L. Thompson, Bacterial cell division: the mechanism and its precison, Int. Rev. Cytol. 253 (2006) 27–94. [7] J. Lutkenhaus, The regulation of bacterial cell division: a time and place for it, Curr. Opin. Microbiol. 1 (1998) 210–215. [8] J. Lutkenhaus, Assembly dynamics of the bacterial MinCDE system and spatial regulation of the Z ring, Annu. Rev. Biochem. 76 (2007) 539–562. [9] C. Schaffner-Barbero, M. Martin-Fontecha, P. Chacon, J.M. Andreu, Targeting the assembly of bacterial cell division protein FtsZ with smll molecules, ACS Chem. Biol. 7 (2012) 269–277. [10] D. Awasthi, K. Kumar, I. Ojima, Therapeutic potential of FtsZ inhibition: a patent perspective, Expert Opin. Ther. Pat. 21 (2011) 657–679. [11] D.J. Haydon, N.R. Stokes, R. Ure, G. Galbraith, J.M. Bennett, D.R. Brown, P.J. Baker, V.V. Barynin, D.W. Rice, S.E. Sedelnikova, J.R. Heal, J.M. Sheridan, S.T. Aiwale, P.K. Chauhan, A. Srivastava, A. Taneja, I. Collins, J. Errington, L.G. Czaplewski, An Inhibitor of FtsZ with potent and selective anti-staphylococcal activity, Science 321 (2008) 1673–1675. [12] B. Vulevic, J.J. Correia, Thermodynamic and structural analysis of microtubule assembly: the role of GTP hydrolysis, Biophys. J. 72 (1997) 1357–1375. [13] W. Vollmer, The prokaryotic cytoskeleton: a putative target for inhibitors and antibiotics? Appl. Microbiol. Biotechnol. 73 (2006) 37–47. [14] Q. Huang, P.J. Tonge, R.A. Slayden, T. Kirikae, I. Ojima, FtsZ: a novel target for tuberculosis drug discovery, Curr. Top. Med. Chem. 7 (2007) 527–543. [15] R.L. Lock, E.J. Harry, Cell-division inhibitors: new insights for future antibiotics, Nat. Rev. Drug Discov. 7 (2008) 324–338. [16] X. Li, S. Ma, Advances in the discovery of novel antimicrobials targeting the assembly of bacterial cell division protein FstZ, Eur. J. Med. Chem. 95 (2015) 1–15. [17] T. Hermann, D.J. Patel, Adaptive recognition by nucleic acid aptamers, Science 287 (2000) 820–825. [18] R. Stoltenburg, C. Reinemann, B. Strehlitz, SELEX-A (r) evolutionary method to generate high-affinity nucleic acid ligands, Biomol. Eng. 24 (2007) 381–403. [19] R. Stoltenburg, C. Reinemann, B. Strehlitz, FulMag-SELEX as an advantageous method for DNA aptamer selection, Anal. Bioanal. Chem. 383 (2005) 83–91. [20] S.K. Kim, B.C. Shin, T.A. Ott, W. Cha, I.J. La, M.Y. Yoon, SELEX. Combinatorial library methodology and applications, Biochip J. 2 (2008) 97–102. [21] J.S. Choi, S.G. Kim, M. Lahousse, H.Y. Park, H.C. Park, B. Jeong, J. Kim, S.K. Kim, M.Y. Yoon, Screening and characterization of high-affinity ssDNA aptamers against anthrax protective antigen, J. Biomol. Screen 16 (2011) 266–271. [22] A. Mukherjee, J. Lutkenhaus, Analysis of FtsZ assembly by light scattering and determination of the role of divalent metal cations, J. Bacteriol. 181 (1999) 823–832. [23] M. Citartan, T.H. Tang, S.C. Tan, C.H. Hoe, R. Saini, J. Tominaga, S. Gopinath, Asymmetric PCR for good quality ssDNA generation towards DNA aptamer production, Songklanakarin J. Sci. Technol. 34 (2012) 125–131. [24] M. Zuker, On finding all suboptimal foldings of an RNA molecule, Science 244 (1989) 48–52. [25] M. Zuker, Mfold web serber for nucleic acid folding and hybridization prediction, Nucleic Acids Res. 31 (2003) 3406–3415. [26] H.C. Park, V. Gedi, J.H. Cho, J.W. Hyun, K.J. Lee, J. Kang, B. So, M.Y. Yoon, Characterization and in vitro inhibition studies of Bacillus anthracis FtsZ: a potential antibacterial target, Appl. Biochem. Biotechnol. 172 (2014) 3263–3270. [27] O.S. Kolovskaya, A.G. Savitskaya, T.N. Zamay, I.T. Reshetneva, G.S. Zamay, E.N. Erkaev, X. Wang, M. Wehbe, A.B. Salmina, O.V. Perianova, O.A. Zubkova, E.A. Spivak, V.S. Mezko, Y.E. Glazyrin, N.M. Titova, M.V. Berezovski, A.S. Zamay, Development of bacteriostatic DNA aptamers for Salmonella, J. Med. Chem. 56 (2013) 1564–1572.
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008
G Model PRBI-10554; No. of Pages 10 10
ARTICLE IN PRESS N.-R. Ha et al. / Process Biochemistry xxx (2015) xxx–xxx
[28] E.L. White, L.J. Ross, R.C. Reynolds, L.E. Seitz, G.D. Moore, D.W. Borhani, Slow polymerization of Mycobacterium tuberculosis FstZ, J. Bacteriol. 182 (2000) 4028–4034. [29] M.A. Jackson, J.S. Frymier, B.J. Wilkinson, P. Zorner, S. Evans, Growth requirements for production of stable cells of the bioherbicidal bacterium Xanthomonas campestris, J. Ind. Microbiol. Biotechnol. 21 (1998) 237–241. [30] G. Sezonov, D. Joseleau-Petit, R. D’Ari, E. coli physiology in Luria-Bertani Broth, J. Bacteriol. 189 (2007) 8746–8749. [31] K.D. Passalacqua, N.H. Bergman, J.Y. Lee, D.H. Sherman, P.C. Hanna, The global transcriptional responses of Bacillus anthracis Sterne (34F2 ) and sodA1 mutant to paraquat reveal metal ion homeostasis imbalances during endogenous superoxide stress, J. Bacteriol. 189 (2007) 3996–4013. [32] T.R. Rustad, K.J. Minch, W. Brabant, J.K. Winkler, D.J. Reiss, N.S. Baliga, D.R. Sherman, Global analysis of mRNA stability in Mycobacterium tuberculosis, Nucleic Acids Res. 41 (2013) 509–517.
[33] P.N. Domadia, A. Bhunia, J. Sivaraman, S. Swarup, D. Dasgupta, Berberine targets assembly of E. coli cell division protein FtsZ, Biochemistry 47 (2008) 3225–3234. [34] S.D. Jayasena, Aptamers an emerging class of molecules that rival antibodies in diagnostics, Clin. Chem. 45 (1999) 1628–1650. [35] B. Strehlitz, N. Nikolaus, R. Stoltenburg, Protein detection with aptamer biosensors, Sensors 8 (2008) 4296–4307. [36] K. Lewis, Platforms for antibiotic discovery, Nat. Rev. Drug Discov. 12 (2013) 371–387. [37] R. O’Shea, H.E. Moser, Physicochemical properties of antibacterial compounds: implications for drug discovery, J. Med. Chem. 51 (2008) 2871–2878. [38] L. Sun, Peptide-based drug development, Modern Chem. Appl. 1 (2013) 1–2.
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008
ARTICLE IN PRESS
PRBI-10554; No. of Pages 10
Process Biochemistry xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Process Biochemistry journal homepage: www.elsevier.com/locate/procbio
Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen Na-Reum Ha a , Sang-Choon Lee a , Jae-Wook Hyun b , Moon-Young Yoon a,∗ a b
Department of Chemistry and Research Institute of Natural Sciences, Hanyang University, Seoul 133-791, Republic of Korea Citrus Research Station, National Institute of Horticultural and Herbal Science, RDA, Jeju 699-946, Republic of Korea
a r t i c l e
i n f o
Article history: Received 11 August 2015 Received in revised form 5 November 2015 Accepted 6 November 2015 Available online xxx Keywords: Citrus canker FtsZ SELEX ssDNA aptamer Antibacterial agent
a b s t r a c t Citrus canker caused by Xanthomonas axonopodis pv. citri (X. axonopodis) is a plant pathogenic bacterial disease infectious to citrus crops, resulting in reduced fruit quality and premature fruit drop. Many chemical substances to prevent citrus canker cannot cure the progressive disease caused by drug resistant pathogens. In this study, we identified the filamentous temperature-sensitive Z (FtsZ) protein of X. axonopodis, a GTPase essential for bacteria cell division, as a new target for anti-citrus canker agent. We found nine single-stranded DNA aptamers with 44–444 nM Kd values against recombinant FtsZ, using SELEX. Among these aptamers, three FtsZ binding aptamers (FBAs) exhibited potent inhibitory effects with IC50 values of 1–2 M similar to berberine, a well-known commercial antibacterial agent. Furthermore, the FBAs also demonstrated high growth inhibitory activity at the cellular level with MIC50 values in the 100 M range. Consequently, this is the first report of a biocompatible inhibitory aptamer as a drug against X. axonopodis FtsZ, and provides a novel strategy for the development of eco-friendly citrus canker prevention agents, thereby replacing the presently used chemical-based drug in near future. © 2015 Elsevier Ltd. All rights reserved.
1. Introduction Of all the agricultural pests which threaten citrus crops, citrus canker, one of the most devastating diseases caused by Xanthomonas axonopodis pv. citri (X. axonopodis), is an economically representative disease of many citrus species such as lime, orange, lemon, pomelo, etc. [1]. At least 4 distinct types (Asiatic canker, Cancrosis B, Mexican lime cancrosis, and Citrus bacteriosis) of citrus canker are currently recognized. Among these types, the Asiatic canker (Canker A) is the most powerfully destructive to major citrus cultivars. Severe infection leads to a variety of effects including defoliation, dieback, severely blemished fruit, reduced fruit quality and premature fruit drop [2]. To prevent the disease, many chemical substances have been used and novel products are being continuously developed. Copper-containing products offer some protection along with field-grade antibiotics, especially streptomycin, used as preventative agents in food crops. Curative
Abbreviations: FtsZ, filamenting temperature sensitive mutantZ; X. axonopodis, Xanthomonas axonopodis pv. citri; SELEX, systematic evolution of ligands by exponential enrichment; IC50 , half maximal inhibitory concentration; MIC50 , half minimum inhibitory concentration. ∗ Corresponding author at: Department of Chemistry and Research institute of Natural Sciences, Hanyang University, 222 Wangsimni-ro, Seongdong-gu, Seoul 133-791, Republic of Korea. Fax: +82 2 2298 0319. E-mail address: [email protected] (M.-Y. Yoon).
applications of chemical-based pesticides reduce bacterial proliferation or spread of the bacterium, however, there is currently no cure for disease that has already progressed [3]. Furthermore, the use of chemical-based drugs for the prevention of citrus canker not only causes resistance to various drugs, it also has harmful effects on human health. Thus, such measures cannot be permanently used, and new approaches such as the development of effective eco-friendly antibiotic drugs that prevent widespread citrus canker need to be investigated. FtsZ (Filamenting temperature sensitive mutant Z) assembles into a highly dynamic ring structure called the Z-ring, and has GTPase activity. It is the major cytoskeletal protein in the bacterial cytokinesis mechanism of cell division in prokaryotic bacteria [4], and is homologous to the eukaryotic cytoskeleton protein (tubulin) [5,6]. The dynamic assembly of FtsZ plays an important role in the regulation of Z-ring formation [7,8]. The Z-ring leads to the constriction of membranes, formation of a septum and division of the cell. Therefore, the use of an FtsZ inhibitor could block Z-ring formation and eventually inhibit bacterial cell division. For last couple of decades, the FtsZ proteins from various species of bacteria, such as Bacillus anthracis (B. anthracis), Bacillus subtilis (B. subtilis), Escherichia coli (E. coli), Pseudomonas aeruginosa (P. aeruginosa), and Mycobacterium tuberculosis (M. tuberculosis), have been studied and many chemical inhibitors have been developed [9–12]. Therefore, it is considered to be a good target for the development of a new class of antibiotics [13–16].
http://dx.doi.org/10.1016/j.procbio.2015.11.008 1359-5113/© 2015 Elsevier Ltd. All rights reserved.
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008
G Model PRBI-10554; No. of Pages 10
ARTICLE IN PRESS N.-R. Ha et al. / Process Biochemistry xxx (2015) xxx–xxx
2
Aptamers are short single-stranded nucleic acid (DNA or RNA) molecules which bind to target molecules with high specificity and binding affinity because of their three-dimensional structure, characterized by stems, loops, hairpins, or quadruplexes, and can be screened for by the systematic evolution of ligands by exponential enrichment (SELEX) method [17,18]. The SELEX method is a widely used against various targets, including small molecules, proteins, cells, tissues and organisms [19]. As aptamers are quite small biological molecule in comparison with large molecules such as proteins, and antibodies, aptamers have various merits including simplicity to be synthesized and modified chemically, being small in size and having low immunogenic property. Consequently, aptamers have recently been used in biological applications, particularly as therapeutic agents [20]. In this study, we cloned and purified the FtsZ protein from X. axonopodis. Through 8 rounds of the SELEX process, we obtained 9 highly specific aptamers and characterized their binding affinity and specificity. Furthermore, we ultimately selected 3 candidate aptamers that showed inhibition of FtsZ polymerization activity within the micromolar range of half maximal inhibitory concentrations (IC50 ) in protein levels using an in-vitro FtsZ polymerization assay and bacterial growth inhibition within the 100 micromolar range of half minimum inhibitory concentration (MIC50 ) values in cellular levels using a surface viable counting assay. We suggest that the FtsZ protein could be a new target for antimicrobial agents, and the FtsZ binding aptamers (FBAs) may represent a novel and potent prevention agent for citrus canker.
Protein expression was induced by addition of 0.5 mM isopropyl-d-thiogalactopyranoside (IPTG) and cells were grown at 37 ◦ C for 6 h. In order to purify the FtsZ protein, the induced cells were harvested by centrifugation at 4,000 rpm for 20 min. The cells were then re-suspended in 50 ml buffer-A containing 20 mM Tris (pH 7.4) and 0.4 M NaCl with 1 mM phenylmethylsulfonyl fluoride (PMSF) dissolved in isopropanol, 0.5 mg ml −1 lysozyme, and sonicated. The induced FtsZ protein was obtained by centrifugation, and loaded onto a Ni2+ -charged chelating sepharose column for affinity chromatography (Vc (column volume) = 8 ml, Amersham Biosciences, Piscataway, NJ, USA). A linear gradient from 20–500 mM imidazole in elution buffer was used to elute the FtsZ protein, and fractions containing protein were concentrated. The final concentration of purified FtsZ protein was determined by Bradford assay, following the manufacturer’s protocol (Bio-Rad, Hercules, CA, USA). 2.4. Activity test of the purified FtsZ with polymerization assay
2. Materials and methods
The measurement of FtsZ activity was conducted by assembly of FtsZ in the presence of GTP using a standard polymerization assay. The FtsZ protein was used in a range of concentrations, 2.3 M (0.1 mg ml−1 ) to 11.1 M (0.5 mg ml−1 ), and was incubated in polymerization buffer containing 50 mM MES (2-(N -morpholino) ethanesulfonic acid, pH 6.5), 50 mM KCl, and 10 mM MgCl2 ) [22]. The polymerization reaction was initiated by adding 1 mM GTP into the reaction mixture for 1 h, and the signal was continuously measured to identify the polymerization of the FtsZ protein at intervals of 20 s at 350 nm by UV-spectrophotometer (Mecasys, Daejeon, Korea).
2.1. Materials
2.5. In-vitro aptamer screening against FtsZ
X. axonopodis pv.citri was obtained from the Citrus Research Station (Jeju Island, Korea) and grown on Nutrient-Yeast extract Agar at 30 ◦ C. Primers and the template for ssDNA library were synthesized by Bioneer (Daejeon, Korea). pfu polymerase was purchased from Solgent (Daejeon, Korea), and restriction endonucleases and DNA ligases from Takara Bio (Shiga, Japan). GTP and berberine were purchased from Sigma (St. Louis, MO, USA), and nutrients (bactotryptone, yeast extract and bacto-agar) were obtained from BD Difco Laboratories (Sparks, NV, USA). All chemicals were obtained from commercial sources and were the highest quality available.
Genomic DNA was isolated from X. axonopodis using a general alkaline lysis protocol, and served as the template in polymerase chain reactions (PCR). The DNA fragment encoding the open reading frame (ORF) of the FtsZ gene from X. axonopodis was amplified by PCR with gene specific primers, (forward: 5 ATATGGATCCATGGCACATTTCGAACTGATTGAAAAAATGGC-3 containing BamH I (bold) and reverse: 5 ATATCTCGAGTCAGTCGGCCTGGCGGCGCAGGAA-3 containing Xho I (bold)), and the amplified PCR product was confirmed on a 1% agarose gel. Then, the amplified FtsZ gene fragment was inserted into a pET28a (+) expression vector (Novagen, Madison, WI, USA) for the production of a recombinant fusion protein that included hexa-histidine tags at the C-terminal end. The cloned sequence of the FtsZ-pET28a gene was analyzed by Macrogen (Seoul, Korea) [21].
In order to prepare the single-stranded DNA (ssDNA) library containing 30 bases of randomized sequence and two primers binding sequences for PCR amplification and cloning, the template for ssDNA library, 5 -ATGCGGATCCCGCGC-(N30 )GCGCAAGCTTCGCGC-3 , was obtained from Bioneer. The template for ssDNA library was amplified by asymmetric PCR with one of the primers in excess, specifically forward primer in this case (forward primer: 5 -ATGCGGATCCCGCGC-3 with BamH I (bold) site and reverse primer: 5 -GCGCAAGCTTCGCGC-3 with Hind III site (bold)). Amplification of ssDNA library was confirmed by 12% native polyacrylamide gel electrophoresis. Product was obtained using a crush-and-soak and ethanol precipitation method and the ssDNA library used for aptamer screening was generated [23]. FtsZ protein dissolved in 50 mM Tris–HCl (pH 7.4) was incubated with 1 g ml−1 ssDNA library at room temperature. To remove the unbound aptamers, membrane filtration using Vivaspin ultrafiltration spin columns with 30 kDa cut-off (Sartorius Stedim Biotech GmbH, Goettingen, Germany) was used, and proteinbound aptamers were separated by centrifugation at 14,000 rpm for 15 min [21]. For the next round, the eluted ssDNA was amplified by asymmetric PCR, and amplified ssDNA was checked by loading on a 12% native polyacrylamide gel. ssDNA in the gel was further purified and recovered by the gel elution and crush-and-soak method, as described above. In order to increase the specificity of the ssDNA aptamer, negative selection was performed with bovine serum albumin (BSA) during round 4 of SELEX, and the unbound ssDNA was collected by centrifugation. A total of 8 rounds of SELEX were performed under harsh conditions (Table 1).
2.3. Expression and purification of the FtsZ protein
2.6. Analysis of aptamer sequences and secondary structures
E. coli BL21 (DE3) cells harboring the FtsZ plasmid were grown in 1.5 L of Luria–Bertani (LB) medium containing 100 mg ml−1 kanamycin until the optical density (OD600 ) reached 0.7 at 37 ◦ C.
To analyze the FtsZ binding aptamers (FBAs) sequence, the ssDNA library pool obtained from the final round of SELEX was amplified by symmetric PCR using 10 M of each primer. The
2.2. Cloning of X. axonopodis FtsZ and plasmid construction
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008
G Model
ARTICLE IN PRESS
PRBI-10554; No. of Pages 10
N.-R. Ha et al. / Process Biochemistry xxx (2015) xxx–xxx
3
Table 1 SELEX conditions used in each round. Round
Protein (g mL−1 )
Buffers
1st 2nd 3nd 4th 5th 6th 7th 8th
Tris [mM]
NaCl [mM]
Tween 20 (%)
50 (pH 7.4)
50 100 150 200 250 300 350 400
0.05 0.1 0.15 0.2 0.25 0.3 0.35 0.4
amplified double-stranded DNA (dsDNA) was digested with restriction endonucleases (BamH I and Hind III), and inserted into the pET28a (+) expression vector. The ligation product was confirmed by electrophoresis on a 1% agarose gel, and the sequence was determined by sequence analysis from Macrogen (Seoul, Korea). The secondary structures of the ssDNA aptamers were predicted by using M-fold free software [24,25]. 2.7. Estimation of binding affinity and specificity The apparent binding affinities of FBAs were measured using an enzyme-linked immunosorbent assay (ELISA) method with 5 biotin-conjugated FBAs (biotin-FBAs) synthesized by Bioneer and streptavidin-conjugated horseradish peroxidase (HRP) antibody (BD Biosciences, Franklin Lakes, NJ, USA) [21]. 22 nM (1 g ml−1 ) FtsZ protein, dissolved in TBS buffer (20 mM Tris–HCl (pH 8.0) and 150 mM NaCl), was immobilized on a 96-well polystyrene plate (SPL, Kyounggi-do, Korea) for 2 h. The wells were washed 3 times with TBST (TBS containing 0.05% Tween-20) and then incubated with 2% bovine serum albumin (BSA) for 1 h to block nonspecific interactions. After 5 gentle washes, each biotin-FBA was added in a concentration dependent manner and incubation was carried out for 2 h. The unbound aptamers were removed through 10 washing steps. Then, streptavidin-conjugated HRP (1:2,000 dilution in TBST) was added for 1 h, and bound FBAs were detected by addition of 3, 3 , 5, 5 -tetramethyl benzidine (TMB) solution (R&D Systems, Minneapolis, MN, USA). After 15 min incubation, the reaction was terminated by adding 1 M H2 SO4 , and the signal was measured using a SpectraMax M2 Multi-Mode Microplate Reader (Molecular Devices, Sunnyvale, CA, USA) at 450 nm. The binding ability of FBAs to X. axonopodis FtsZ and BSA was measured, and apparent binding affinities were estimated with the difference of absorbance value for bound FBA using the Origin Program. The binding specificity of FBAs towards the target protein was also evaluated by using other homologous FtsZ protein from B. anthracis and BSA.
10 10 10 5 5 3 3
ssDNA (g mL−1 )
Incubation (min)
1 1 0.5 0.5 0.3 0.3 0.2 0.2
60 60 45 45 45 30 30 30
2.9. Surface viable counting assay X. axonopodis was cultured on Nutrient-Yeast extract (NY) broth (BD Difco, Sparks, NV, USA) at 30 ◦ C until the OD600 reached 0.59. To determine the number of bacterial cells, 100 L of serial diluted cell cultures were spread on Nutrient-Yeast extract Agar (NYA) plates and incubated for 48 h at 30 ◦ C. The 103 colony-forming unit (CFU) ml−1 cells were selected for the bacterial cell growth inhibition test. To evaluate the antibacterial effect of FBAs, a surface viable counting assay was carried out [27]. A 103 CFU ml−1 of X. axonopodis cells with different concentrations of FBAs were tested for inhibition of cell growth. Samples under each condition were incubated for 3 h at room temperature and spread on NY Agar plates. The plates were then incubated for 48 h at 30 ◦ C and the inhibition effect was identified by counting the number of colonies. 2.10. Cytotoxicity assay Raw 264.7 cells in Dulbecco’s Modified Eagle Medium (DMEM) containing 10% fetal bovine serum (FBS) and 1% antibiotic solution (penicillin-streptomycin) were counted by hemocytometer, and a total 1 × 105 cells were seeded in 96-well plates and incubated with the condition of 5% CO2 at 37 ◦ C overnight. The cells were washed once with PBS (pH 7.5), after fresh media was added. Next, the cells were treated with various concentration of aptamers (from 6.25 M to 400 M) and incubated with the condition of 5% CO2 at 37 ◦ C for 4 h. To analyze the cell viability, a 1 mg ml−1 of the MTT solution (3-(4, 5-Dimethylthiazol-2-yl)-2, 5-Diphenyltetrazolium Bromide) was added on each well and incubated with above mentioned same condition for 4 h. Then, the dimethyl sulfoxide (DMSO) as a solubilization solution for formazan crystal was treated. 10% DMSO was used as a negative control. The absorbance was measured at 570 nm by a microtiter plate reader.
2.8. In-vitro inhibition assay
3. Results and discussion
The evaluation of the inhibition potency of the screened FBAs was conducted in the same manner as the FtsZ polymerization assay. Each FBA was pre-incubated with 11.1 M (0.5 mg ml−1 ) FtsZ protein in polymerization buffer for 30 min, and the reaction was initiated by adding 1 mM GTP. The turbidity, which corresponds to the degree of polymerization, was monitored by measuring the absorbance at 350 nm by UV-spectrophotometer. All data were plotted using the Origin Program. The IC50 was determined by fitting the following equation related with inhibition percentages based on absorbance for turbidity, where V0 is the reaction rate without inhibitor, Vf is the rate at saturating inhibition, and [I] is the inhibitor concentration [26].
3.1. Cloning and purification of X. axonopodis FtsZ protein
=
V0 − Vf × IC50 IC50 + [I]
+ Vf
The X. axonopodis FtsZ gene was amplified by PCR with extracted genomic DNA as a template and the designed primers. Amplification was confirmed on a 1% (w/v) agarose gel. As shown in Fig. 1A, the length of the amplified gene was approximately 1.2 kbp (exactly 1239 bp). To prepare recombinant protein, the gene was inserted into the pET 28a (+) expression vector after treatment with restriction endonucleases, transformed into E. coli BL21 (DE3) cells. The recombinant X. axonopodis FtsZ was expressed, and purified using Ni2+ -charged sepharose resin by histidine-tag affinity chromatography. The purified FtsZ protein was determined to be soluble, more than 95% homogeneous and was approximately 45 kDa by 12% SDS-PAGE (Fig. 1B). The purified protein was concentrated up to 2.5 mg ml−1 and used for further studies.
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008
G Model PRBI-10554; No. of Pages 10 4
ARTICLE IN PRESS N.-R. Ha et al. / Process Biochemistry xxx (2015) xxx–xxx
Fig. 1. Cloning and purification of the X. axonopodis FtsZ protein. (A) PCR product for the FtsZ gene on a 1% (w/v) agarose gel. Lane M, 25/100 bp DNA ladder; lane 1, amplified FtsZ gene (1239 bp). (B) Purified recombinant FtsZ protein on a 12% SDS-PAGE gel. Lane M, Protein ladder; lane 1, BL21(DE3) lysate before expressed; lane 2, BL21(DE3) lysate after expressed; lane 3, lysate before binding on column; lane 4, lysate after binding on column; lane 5, purified FtsZ protein (approximately 45 kDa) after concentration of all of the fractionized solution.
3.2. Characterization of recombinant X. axonopodis FtsZ protein FtsZ is structurally similar to its homologue in eukaryotes, tubulin, and forms polymers in the presence of GTP. The activity of purified recombinant FtsZ was measured by the absorbance value at 350 nm, which means the turbidity of the reaction, and the polymerization of FtsZ was monitored in a protein concentration dependent manner [22]. Various concentrations of FtsZ were pre-incubated in polymerization buffer for 10 min, and 1 mM GTP was added to initiate polymerization. As shown in Fig. 2, the signal, corresponding to turbidity strength, promptly increased with increasing protein concentration and the addition of GTP. In the presence of high concentrations of the FtsZ protein, polymerization progressed more rapidly, and the maximum signal was detected at 11.1 M (0.5 mg ml−1 ) of FtsZ. As the GTP was continually consumed, the absorbance signal was slowly recovered by depolymerization of FtsZ. In comparison with other bacterial FtsZ proteins, the polymerization (20 min) and depolymerization (1 h) of X. axonopodis FtsZ were definitely much slower than those of E. coli FtsZ (within 30 s for polymerization and 25 min for depolymerization) [22], and B. anthracis FtsZ (within 10 s for polymerization and polymerization was maintained for a prolonged period) [26], but faster than M. tuberculosis FtsZ (10 min for polymerization and 5 h for depolymerization) [28]. It is likely that the relatively slow assembly of X. axonopodis FtsZ was due to lower GTPase activity. The degree of FtsZ polymerization activity is not only quite important in bacterial cell growth, but also affects cell division time. The generation time for X. axonopodis cell growth is less than 3 h [29], which is explained by the fact that X. axonopodis has a long cell division time caused by having lower GTPase activity than others, including E. coli (20 min) [30], B. anthracis (50 min) [31]. However, since X. axonopodis FtsZ has higher GTPase activity than M. tuberculosis FtsZ, X. axonopodis has shorter generation time than that of M. tuberculosis (16–22 h) [32]. This growth rate corresponds significantly with the results for FtsZ polymerization activity. Consequently, FtsZ could be a key factor in regulating cell growth in X. axonopodis. 3.3. Identification of FtsZ binding aptamer and structural analysis The purified FtsZ protein and the ssDNA library obtained by asymmetric PCR were used for aptamer screening, and 8 rounds of the SELEX process were performed (Fig. 3). To select aptamers with high affinity and specificity, rounds of SELEX were performed using the following harsh conditions: increasing salt and detergent concentrations, decreasing binding times, protein and ssDNA library concentrations (Table 1). In particular, the monovalent cations and
detergent in the binding buffer are known to play a role in reducing the nonspecific binding of the aptamer to the target. After completing the SELEX process, nine FtsZ binding aptamers (FBAs), each with a different 30-base sequence, were selected (Table 2). To understand the binding of an individual aptamer to its target, we analyzed the secondary structures using the M Fold program [24,25]. As shown in Fig. 4, all of the predicted structures had a unique stem-and-loop structure and specific Gibbs free energy ( G) indicating structural stability. Among FBAs, FBA 8 had the lowest energy value (G = − 6.93 kcal mol−1 ), whereas FBA 1 had a positive energy value (G = 0.11 kcal mol−1 ). Interestingly, each FBA had its own loop structure formed by the random sequence region of the aptamer. We anticipate that the specific structures of each FBA might play a particularly crucial role in binding to the target.
3.4. Characterization of screened aptamers: binding affinity and specificity Binding affinity of aptamer was measured by ELISA using biotinlabelled FBAs. As described in Table 2 and Fig. 5, the binding affinities (Kd ) of FBAs were calculated to be in the concentration of 44–444 nM range. Among the FBAs, FBA 2 and FBA 6 exhibited lower binding affinities (44.5 nM and 80.6 nM, respectively) than the others we characterized. FBA 1 and FBA 9 showed relatively higher binding affinities (283 nM and 444 nM, respectively). Although the all FBAs had similar structures, their binding affinities are different. Interestingly, in cases of FBA 5 and FBA 7, both aptamers had very close structures, however FBA 5 had an approximately 3-fold increased relative binding affinity. This suggests that the binding of aptamers to the target molecule were affected by structure as well as sequence. The target specificity test was performed with a biotinylated FBAs against B. anthracis FtsZ and BSA. The B. anthracis FtsZ shares 50% sequence identity with X. axonopodis FtsZ, as determined by the NCBI blast program (Fig. S3). B. anthracis FtsZ was purified via E. coli expression system and identified the polymerization activity as the same conditions as X. axonopodis FtsZ (Figs. S1 and S2). Among FBAs, FBA 1, 4, 5–7, and 9 were exhibited similar binding property between X. axonopodis FtsZ and B. anthracis FtsZ. In contrast, FBA 2, 3, and 8 were only showed a high binding ability specifically against X. axonopodis FtsZ. Moreover, in case of BSA, all FBAs exhibited a high binding specificity against X. axonopodis FtsZ (Fig. 6). Consequently, according to the binding affinity and specificity, the FBA 2 and 8 showed an outstanding binding capability against FtsZ protein.
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008
G Model
ARTICLE IN PRESS
PRBI-10554; No. of Pages 10
N.-R. Ha et al. / Process Biochemistry xxx (2015) xxx–xxx
5
Fig. 2. In-vitro polymerization assay of the X. axonopodis FtsZ protein. Polymerization occurred immediately upon addition of 1 mM GTP. Various concentrations of X. axonopodis FtsZ were incubated in a polymerization reaction buffer, and then the absorbance at 350 nm was monitored.
Fig. 3. Overall schematic of the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) method, including the binding, elution, and amplification steps, for the selection of aptamer against FtsZ protein. Table 2 FBAs screened and their binding affinities. No.
Occurrencesa
Aptamer sequences
Binding affinityb (Kd , nM)
FBA 1 FBA 2 FBA 3 FBA 4 FBA 5 FBA 6 FBA 7 FBA 8 FBA 9
2 6 4 2 3 2 2 6 3
GGAGTCGTAGGGTTGTGCGTTGTCTCTGTC GCACAGCAGGGGGCCACCCGCACGTGGTCG CGACGTGAGGAAGGCGCGCTGGTTTGCACC GCACGAAGTGACGCGCCTCCTTGTGTGTCG CACGCAACGAGTGGCGCGCCTTGTTTCGGC CGACGTCAGAGAGGCGCGCTACTGCGTACC GCCGAAACAAGGCGCGCCACTCGTTGCGTG GCAGTGAGGGGCACGCACCCGTGGCGGGTG GCACACCGGAGGGGGGCTGCACTGGCCGTG
283 ± 10.6 44.5 ± 32.6 186 ± 10.0 276 ± 32.3 277 ± 22.9 80.6 ± 13.8 99.1 ± 6.57 176 ± 21.0 444 ± 6.34
a
After eight rounds of SELEX, a total of 30 ssDNA aptamers were selected, and their sequences were determined. Among them, nine unique sequences were identified. Binding affinities were determined as described in the Section 2. FtsZ was immobilized in individual wells of a polystyrene plate, and ssDNA aptamer was added. After extensive washing, the amount of bound ssDNA aptamer was estimated using a streptavidin-conjugated antibody which specifically recognizes the biotin label on each ssDNA aptamer. The dissociation constant (Kd ) was obtained from binding saturation curve fitting from three independent experiments. b
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008
G Model PRBI-10554; No. of Pages 10 6
ARTICLE IN PRESS N.-R. Ha et al. / Process Biochemistry xxx (2015) xxx–xxx
Fig. 4. Predicted secondary structures of the FBAs. All FBAs have a stem-loop structure consisting of a 30-mer of nucleic acid. The structural forming energy of each FBA was as follows; FBA 1 (G = 0.11 kcal mol−1 ), FBA 2 (G = − 4.44 kcal mol−1 ), FBA 3 (G = − 1.61 kcal mol−1 ), FBA 4 (G = − 3.03 kcal mol−1 ), FBA 5 (G = − 2.69 kcal mol−1 ), FBA 6 (G = − 3.50 kcal mol−1 ), FBA 7 (G = − 2.66 kcal mol−1 ), FBA 8 (G = − 6.93 kcal mol−1 ), and FBA 9 (G = − 3.91 kcal mol−1 ).
Fig. 5. Binding affinities of FBAs toward the X. axonopodis FtsZ protein. The Kd value for each FBA was determined using the ELISA method. All assays were performed in triplicate.
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008
G Model PRBI-10554; No. of Pages 10
ARTICLE IN PRESS N.-R. Ha et al. / Process Biochemistry xxx (2015) xxx–xxx
7
Fig. 6. Determination of the binding specificity of FBAs (500 nM) against X. axonopodis FtsZ by ELISA. B. anthracis FtsZ and BSA were used as negative controls and the experiments were performed in triplicate.
3.5. In-vitro inhibition analysis In order to identify potent inhibitory aptamers against X. axonopodis FtsZ, we analyzed the inhibition effect of individual FBAs on FtsZ polymerization. This was done by monitoring the degree of turbidity in the presence of FBAs via UV/vis spectrophotometer. Among FBAs, 3 different aptamers, FBA 2, 8, and 9, showed inhibitory effects with low micromolar IC50 values (2.84 M, 1.25 M and 1.64 M, respectively) (Fig. 7A). To compare the inhibition potency of FBAs, we used berberine well-known chemical inhibitor of E. coli FtsZ [33] as a positive control. We calculated an IC50 value for berberine with approximately 3.84 M, which also had a strong inhibitory effect on X. axonopodis FtsZ. In addition, when we treated the 30 mer randomly scrambled aptamer (Sc-apt) as a negative control, there is no effect on FtsZ polymerization activity (Fig. 7A). Furthermore, in order to identify the inhibitory specificity, two groups of FBAs, the inhibitory FBAs (FBA 2, 8, 9) against X. axonopodis FtsZ and FBA 5, 7 which was considerably bound to B. anthracis FtsZ, were tested. As shown in Fig. 7B, the FBAs are not given any influence on B. anthracis FtsZ polymerization activity as treated up to 30 M. The FBA 2, 8, and 9 exhibited considerably great inhibition ability in X. axonopodis FtsZ polymerization and not in B. anthracis FtsZ. An oligo-nucleic acid based aptamer can discriminate to their targets on the basis of subtle structural differences such as presence or absence of a functional group and enantiomer of the target [34]. Furthermore, a protein targets with a high structural complexity allow aptamer binding by various interactions such as stacking interaction, electrostatic interaction, and hydrogen bonding [35]. Therefore, aptamers can bind to variable region of target. Even though two species of FtsZ protein have 50% sequence identity between their sequences, these inhibitory FBAs might interact with some particular domain of X. axonopodis FtsZ and act as an inhibitor for the FtsZ polymerization. Although FBA 5 and FBA 7 bind both species of FtsZ similarly, these FBAs could not show any inhibition effect against X. axonopodis and B. anthracis FtsZ. It means that the interaction between FBAs and target protein
was unrelated with polymerization activity, and the FBA binding site and FtsZ GTPase activity region is also different. Consequently, the FBA 2, 8, and 9 exhibited high levels of in-vitro inhibition activity. Specifically, FBA 8 showed the best inhibition potency with high binding affinity and specificity against X. axonopodis FtsZ. 3.6. Inhibition potency of FBAs at the cellular level To verify the cellular inhibition effects of candidate FBAs, we carried out a surface viable counting assay with 103 CFU ml−1 of cells on a NYA plate. As shown in Fig. S4, the assay was conducted with 100 M berberine as a positive control, random 30 mer of Sc-apt as a negative control and with various concentrations of inhibitory FBAs (FBA 2, 8, and 9). In the case of berberine, a high level of inhibition of bacterial cell growth was seen (Fig. S4). Although the inhibitory FBAs exhibited inhibitory properties at higher concentrations than berberine, they were shown to be potent inhibitors of bacterial cell growth in a concentration dependent manner. As the concentrations of FBAs increased, the number of colonies dramatically decreased (Fig. S4). As a result, the MIC50 values for each inhibitory FBA were estimated to be 121.84 M for FBA 2, 111.68 M for FBA 8, and 117.49 M for FBA 9 (Fig. 8A and B) corresponding with the previous IC50 values for the FBAs. This result indicates that the antibacterial effect was strong in the presence of the FBAs, as efficient binding of each FBA to the FtsZ protein blocked polymerization. In contrast, random Sc-apt (N30 ) could not show any inhibition effect in bacterial cell growth. It means that the inhibitory FBAs targeted specifically to FtsZ and have a growth inhibition function of X. axonopodis. Furthermore, cell cytotoxicity assay was carried out to confirm that the growth inhibition of X. axonopodis is not caused by the toxic effect of FBAs on the bacterial cells. Cytotoxicity test was performed using murine macrophage cell line Raw 264.7. The inhibitory FBAs are not given any toxic effect on murine macrophage cell line as treated up to 400 M (Fig. S5). It indicates that these candidate FBAs are not influence
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008
G Model PRBI-10554; No. of Pages 10 8
ARTICLE IN PRESS N.-R. Ha et al. / Process Biochemistry xxx (2015) xxx–xxx
Fig. 7. In-vitro inhibition analysis of X. axonopodis FtsZ polymerization by FBAs. (A) Determination of the IC50 values for the candidate FBAs (FBA 2, 8, and 9), berberine. FBA 8 showed the lowest IC50 value which means it had a stronger inhibitory effect on FtsZ polymerization than berberine did. Random Sc-apt had no influence on X. axonopodis FtsZ polymerization. (B) Inhibition analysis of B. anthracis FtsZ polymerization by FBAs (30 M). FBAs had no effect on B. anthracis FtsZ polymerization.
on mammalian cells that does not have FtsZ inside the cell, and only FtsZ targeted inhibitory aptamers cause the growth inhibition of X. axonopodis that express the FtsZ inside the cell. Therefore, FBAs
may serve as efficient regulators of polymerization for FtsZ activity, Z-ring formation and even the bacterial cell growth. In the respect of FBAs characteristics, the FBA 8 exhibited the highest specificity
Fig. 8. Evaluation of the antibacterial ability of candidate FBAs at cellular level using the surface viable counting method. (A) Histogram of bacteria viability after treatment with FBAs, berberine, and Sc-apt. (B) Determination of MIC50 values for each candidate FBA.
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008
G Model PRBI-10554; No. of Pages 10
ARTICLE IN PRESS N.-R. Ha et al. / Process Biochemistry xxx (2015) xxx–xxx
and inhibition potency, and may be an attractive candidate as a citrus canker prevention agent on FtsZ inhibition. Although the FBAs had lower in-vitro IC50 values than berberine at the protein level, berberine showed more potent bacterial growth inhibition at the cellular level. Because the FtsZ protein is localized throughout the cytoplasm in bacteria, thus an inhibitor targeted to FtsZ would need to penetrate the bacterial cell membrane. However, inhibitory FBAs of high molecular weights (MW) and hydrophilicities have a difficult time passing through the bacterial cell membrane. Typically, molecules less than 500 Da can penetrate the membrane more easily than larger molecules [36]. Herein, the average MW of the FBAs used was approximately 9.0 kDa (20-fold larger than berberine (407.84 Da)). This explains why the FBAs, which had lower efficiency in cell penetration, showed less bacterial cell growth inhibition than berberine did. An electrical repulsive force also exists between the hydrophilic properties of oligonucleic acids and gram negative bacterial cell membranes [37], thus FBAs could not penetrate into cell membranes easily. According to Lipinski’s rule, antibacterial compounds should have specific physicochemical properties such as MW, lipophilicity, and hydrogen bond donors and acceptors [36,37]. Actually, the membrane penetration mechanism of aptamer is not clearly understood. As comparing to the small chemical inhibitor, berberine, which have advantages such as small size and membrane permeability, the inhibitory FBAs have a weak point in this aspect [38]. However, the FBAs identified by this study showed significantly specific inhibition against X. axonopodis FtsZ. This remarkable target specificity of FBAs could be superiority above non-selectivity of berberine [26,33]. Therefore, the FBAs could be provided significant basis for development of eco-friendly and target specific anti-citrus canker agent. Further studies will be needed to validate a target identification and improve the inhibitory effect of FBAs of the cellular level by modification of candidate aptamer such as optimum structure by size control and enhancement of hydrophobicity by attaching a chemicals. 4. Conclusion In this study, we identified and evaluated a potent ssDNA aptamers as a potential X. axonopodis FtsZ inhibitors. Specifically, we cloned gene encoding the FtsZ into a pET 28a (+) expression vector and purified the recombinant FtsZ protein using Ni2+ -charged affinity chromatography. Using a SELEX process, 9 aptamers with high affinity and specificity were identified and characterized. The binding affinity of these FBAs toward FtsZ was measured to be in the 44–444 nanomolar range of Kd value. Among these aptamers, FBA 2, 8, and 9 showed strong inhibitory effects on FtsZ polymerization with IC50 values of 1 to 2 M, and on bacterial growth inhibition, with MIC50 values of 100 M. In addition, these candidate aptamers did not show any cytotoxicity against murine macrophage cells. In conclusion, we suggest that the FtsZ protein may play a significant key role in the development of a novel antibacterial agents. The inhibitory FBAs, especially FBA 8, could be viable alternative for the existing chemical-based antibacterial agents as eco-friendly prevention agents for citrus canker. However, the internalization of inhibitory aptamer has yet not clearly understood. Further study would be required for identification of target, evaluation of the FBAs as anti-citrus canker agent via a plant-based inhibition test, and modification of the FBAs structure to improve their inhibitory effects. Acknowledgements This work was supported by the “Cooperative Research Program grants for Agriculture Science & Technology Development (Project
9
No. PJ008264)” funded by the Rural Development Administration, Republic of Korea and by Agricultural Biotechnology Development Program, Ministry of Agriculture, Food and Rural Affairs, Republic of Korea (314013-3). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.procbio.2015.11. 008. References [1] L.M. Rodriguez-R, A. Grajales, M.L. Arrieta-Ortiz, C. Salazar, S. Restrepo, A. Bernal, Genomes-based phylogeny of the genus Xanthomonas, BMC Microbiol. 12 (2012) 43. [2] J. Boch, U. Bonas, Xanthomonas AvrBs3 family-type III. Effectors: discovery and function, Annu. Rev. Phytopathol. 48 (2010) 419–436. [3] S.D. Ellis, M.J. Boehm, D. Coplin, in: K.L. Smith (Ed.), Bacterial Diseases of Plants, The Ohio State University, 2008, 2015, pp. 1–4. [4] H.P. Erickson, D.E. Anderson, M. Osawa, FtsZ in bacterial cytokinesis: cytoskeleton and force generator all in one, Microbiol. Mol. Biol. Rev. 74 (2010) 504–528. [5] S. Kapoor, D. Panda, Targeting FtsZ for antibacterial therapy: a promising avenue, Expert Opin. Ther. Targets 13 (2009) 1037–1051. [6] E. Harry, L. Monahan, L. Thompson, Bacterial cell division: the mechanism and its precison, Int. Rev. Cytol. 253 (2006) 27–94. [7] J. Lutkenhaus, The regulation of bacterial cell division: a time and place for it, Curr. Opin. Microbiol. 1 (1998) 210–215. [8] J. Lutkenhaus, Assembly dynamics of the bacterial MinCDE system and spatial regulation of the Z ring, Annu. Rev. Biochem. 76 (2007) 539–562. [9] C. Schaffner-Barbero, M. Martin-Fontecha, P. Chacon, J.M. Andreu, Targeting the assembly of bacterial cell division protein FtsZ with smll molecules, ACS Chem. Biol. 7 (2012) 269–277. [10] D. Awasthi, K. Kumar, I. Ojima, Therapeutic potential of FtsZ inhibition: a patent perspective, Expert Opin. Ther. Pat. 21 (2011) 657–679. [11] D.J. Haydon, N.R. Stokes, R. Ure, G. Galbraith, J.M. Bennett, D.R. Brown, P.J. Baker, V.V. Barynin, D.W. Rice, S.E. Sedelnikova, J.R. Heal, J.M. Sheridan, S.T. Aiwale, P.K. Chauhan, A. Srivastava, A. Taneja, I. Collins, J. Errington, L.G. Czaplewski, An Inhibitor of FtsZ with potent and selective anti-staphylococcal activity, Science 321 (2008) 1673–1675. [12] B. Vulevic, J.J. Correia, Thermodynamic and structural analysis of microtubule assembly: the role of GTP hydrolysis, Biophys. J. 72 (1997) 1357–1375. [13] W. Vollmer, The prokaryotic cytoskeleton: a putative target for inhibitors and antibiotics? Appl. Microbiol. Biotechnol. 73 (2006) 37–47. [14] Q. Huang, P.J. Tonge, R.A. Slayden, T. Kirikae, I. Ojima, FtsZ: a novel target for tuberculosis drug discovery, Curr. Top. Med. Chem. 7 (2007) 527–543. [15] R.L. Lock, E.J. Harry, Cell-division inhibitors: new insights for future antibiotics, Nat. Rev. Drug Discov. 7 (2008) 324–338. [16] X. Li, S. Ma, Advances in the discovery of novel antimicrobials targeting the assembly of bacterial cell division protein FstZ, Eur. J. Med. Chem. 95 (2015) 1–15. [17] T. Hermann, D.J. Patel, Adaptive recognition by nucleic acid aptamers, Science 287 (2000) 820–825. [18] R. Stoltenburg, C. Reinemann, B. Strehlitz, SELEX-A (r) evolutionary method to generate high-affinity nucleic acid ligands, Biomol. Eng. 24 (2007) 381–403. [19] R. Stoltenburg, C. Reinemann, B. Strehlitz, FulMag-SELEX as an advantageous method for DNA aptamer selection, Anal. Bioanal. Chem. 383 (2005) 83–91. [20] S.K. Kim, B.C. Shin, T.A. Ott, W. Cha, I.J. La, M.Y. Yoon, SELEX. Combinatorial library methodology and applications, Biochip J. 2 (2008) 97–102. [21] J.S. Choi, S.G. Kim, M. Lahousse, H.Y. Park, H.C. Park, B. Jeong, J. Kim, S.K. Kim, M.Y. Yoon, Screening and characterization of high-affinity ssDNA aptamers against anthrax protective antigen, J. Biomol. Screen 16 (2011) 266–271. [22] A. Mukherjee, J. Lutkenhaus, Analysis of FtsZ assembly by light scattering and determination of the role of divalent metal cations, J. Bacteriol. 181 (1999) 823–832. [23] M. Citartan, T.H. Tang, S.C. Tan, C.H. Hoe, R. Saini, J. Tominaga, S. Gopinath, Asymmetric PCR for good quality ssDNA generation towards DNA aptamer production, Songklanakarin J. Sci. Technol. 34 (2012) 125–131. [24] M. Zuker, On finding all suboptimal foldings of an RNA molecule, Science 244 (1989) 48–52. [25] M. Zuker, Mfold web serber for nucleic acid folding and hybridization prediction, Nucleic Acids Res. 31 (2003) 3406–3415. [26] H.C. Park, V. Gedi, J.H. Cho, J.W. Hyun, K.J. Lee, J. Kang, B. So, M.Y. Yoon, Characterization and in vitro inhibition studies of Bacillus anthracis FtsZ: a potential antibacterial target, Appl. Biochem. Biotechnol. 172 (2014) 3263–3270. [27] O.S. Kolovskaya, A.G. Savitskaya, T.N. Zamay, I.T. Reshetneva, G.S. Zamay, E.N. Erkaev, X. Wang, M. Wehbe, A.B. Salmina, O.V. Perianova, O.A. Zubkova, E.A. Spivak, V.S. Mezko, Y.E. Glazyrin, N.M. Titova, M.V. Berezovski, A.S. Zamay, Development of bacteriostatic DNA aptamers for Salmonella, J. Med. Chem. 56 (2013) 1564–1572.
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008
G Model PRBI-10554; No. of Pages 10 10
ARTICLE IN PRESS N.-R. Ha et al. / Process Biochemistry xxx (2015) xxx–xxx
[28] E.L. White, L.J. Ross, R.C. Reynolds, L.E. Seitz, G.D. Moore, D.W. Borhani, Slow polymerization of Mycobacterium tuberculosis FstZ, J. Bacteriol. 182 (2000) 4028–4034. [29] M.A. Jackson, J.S. Frymier, B.J. Wilkinson, P. Zorner, S. Evans, Growth requirements for production of stable cells of the bioherbicidal bacterium Xanthomonas campestris, J. Ind. Microbiol. Biotechnol. 21 (1998) 237–241. [30] G. Sezonov, D. Joseleau-Petit, R. D’Ari, E. coli physiology in Luria-Bertani Broth, J. Bacteriol. 189 (2007) 8746–8749. [31] K.D. Passalacqua, N.H. Bergman, J.Y. Lee, D.H. Sherman, P.C. Hanna, The global transcriptional responses of Bacillus anthracis Sterne (34F2 ) and sodA1 mutant to paraquat reveal metal ion homeostasis imbalances during endogenous superoxide stress, J. Bacteriol. 189 (2007) 3996–4013. [32] T.R. Rustad, K.J. Minch, W. Brabant, J.K. Winkler, D.J. Reiss, N.S. Baliga, D.R. Sherman, Global analysis of mRNA stability in Mycobacterium tuberculosis, Nucleic Acids Res. 41 (2013) 509–517.
[33] P.N. Domadia, A. Bhunia, J. Sivaraman, S. Swarup, D. Dasgupta, Berberine targets assembly of E. coli cell division protein FtsZ, Biochemistry 47 (2008) 3225–3234. [34] S.D. Jayasena, Aptamers an emerging class of molecules that rival antibodies in diagnostics, Clin. Chem. 45 (1999) 1628–1650. [35] B. Strehlitz, N. Nikolaus, R. Stoltenburg, Protein detection with aptamer biosensors, Sensors 8 (2008) 4296–4307. [36] K. Lewis, Platforms for antibiotic discovery, Nat. Rev. Drug Discov. 12 (2013) 371–387. [37] R. O’Shea, H.E. Moser, Physicochemical properties of antibacterial compounds: implications for drug discovery, J. Med. Chem. 51 (2008) 2871–2878. [38] L. Sun, Peptide-based drug development, Modern Chem. Appl. 1 (2013) 1–2.
Please cite this article in press as: N.-R. Ha, et al., Development of inhibitory ssDNA aptamers for the FtsZ cell division protein from citrus canker phytopathogen, Process Biochem (2015), http://dx.doi.org/10.1016/j.procbio.2015.11.008