Development of organoid-based drug metabolism model

Journal Pre-proof Development of organoid-based drug metabolism model

Enoch Park, Han Kyung Kim, JooHyun Jee, Soojung Hahn, Sukin Jeong, Jongman Yoo PII:

S0041-008X(19)30398-9

DOI:

https://doi.org/10.1016/j.taap.2019.114790

Reference:

YTAAP 114790

To appear in:

Toxicology and Applied Pharmacology

Received date:

26 March 2019

Revised date:

27 August 2019

Accepted date:

22 October 2019

Please cite this article as: E. Park, H.K. Kim, J. Jee, et al., Development of organoid-based drug metabolism model, Toxicology and Applied Pharmacology (2018), https://doi.org/ 10.1016/j.taap.2019.114790

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2018 Published by Elsevier.

Journal Pre-proof

Development of organoid-based drug metabolism model

Enoch Park1, Han Kyung Kim1, JooHyun Jee1, Soojung Hahn1, Sukin Jeong1, Jongman Yoo1,*

1

Department of Microbiology and CHA Organoid Research Center, School of Medicine, CHA

oo

f

University, South Korea

*Corresponding author

pr

Jongman Yoo, M.D, Ph.D. Assistant Professor,

e-

CHA University

Department of Microbiology and Organoid Research Center, School of Medicine

Pr

719 CHA Bio Complex, 335 Pangyo-Ro, Sampyeong-Dong, Bundang-Gu, Seongnam-si, GyeonggiDo, Korea 463-400

Fax : +82-31-811-7114

Jo u

rn

Email : [email protected]

al

Tel : +82-10-9444-4915, +82-31-881-7269

Running Title: Organoid Toxicological Model Word Count: 7,668

11

Journal Pre-proof Abstract Cytochrome P450 (CYP) gene superfamily catalyzes oxidative metabolism of a wide variety of drugs, carcinogens, and endogenous biomolecules in the liver and intestinal organs. In vitro assay platforms such as primary hepatocyte and immortalized liver-derived cell lines have been developed to evaluate drug effects. However, several limitations have been suggested regarding discrepancies between in vitro and in vivo assays. In this study, we aimed to investigate drug metabolism and toxicity based on mouse small intestinal and liver

oo

f

organoids derived from resident stem cells. At first, expressions and activities of CYP subfamilies (CYPs) in intestinal and liver organoids were investigated. Organoids treated

pr

with three CYPs-inducers dexamethasone (Dex), β-naphthoflavone (BNF), and 1,4-bis-2-(3,

e-

5-dichloropyridyloxy)-benzene (TCPOBOP) were evaluated for CYPs activities. The CYPs-

Pr

induced intestinal and liver organoids were confirmed to digest more docetaxel, as colon cancer cell-line survived more in CYPs-induced organoid’s medium than in non-induced

al

organoid’s medium. Then, the activity of docetaxel in a co-culture platform of mouse liver

rn

organoids and human pancreatic tumoroids was measured. We obtained significant statistical

Jo u

values on CYPs-induced metabolic activities: cell survival rates of pancreatic tumoroids cocultured with docetaxel-treated undifferentiated, differentiated, and CYPs-induced differentiated organoids were 66.05±2.14%, 89.20±2.67%, and 101.90±0.94%, respectively. To sum up, gene expression modification and drug metabolism evaluation were able to be done with organoids as done with tissues. In vivo-like in vitro investigation on drug toxicity may potentially be done with organoids as a stepping bridge to the clinical trial.

Keywords: Organoid, CYP, Drug metabolism, Toxicological model

12

Journal Pre-proof Introduction Liver and intestines are the principal organs responsible for drug metabolism and druginduced toxicity [1, 2]. Due to its function, liver-based systems are widely used to identify potential toxicity of anti-cancer drugs and their metabolites. By means of traditional in vitro experimental methods, two-dimensional (2D) culture systems of human cell lines and animal models are utilized [3-5]. However, 2D cultured human cell lines easily lose their original function, and animal models have limitations due to potential differences in drug metabolism

oo

f

versus that of humans [5, 6]. Thus, it has been difficult to produce accurate data on drug toxicity and metabolism using the methods above. These limitations of conventional models

pr

have brought the demands for new drug screening model.

e-

Cytochrome P450 (CYP) is an enzyme which is responsible for biotransformation of

Pr

foreign substances including drugs in clinical use [7, 8]. Among CYP subfamilies (CYPs), 1, 2, and 3 subfamilies are responsible for the metabolism of majority of drugs [8]. Various in

al

vitro assays, such as primary hepatocyte and immortalized liver derived cell lines, have been

rn

valuable methods for studying the effect of chemicals on CYP forms, but several limitations

Jo u

of these systems have been suggested [4, 9, 10]. In particular, in vitro cell lines often exhibit CYPs at much lower levels than that of in vivo. For example, key enzymes such as CYP1A2, CYP2A6, and CYP2B6 are expressed at low levels, and the most important CYP3A4 is not detected in HepG2 cell line at all [11, 12]. Recently, three-dimensional (3D) in vitro organoid technology has been developed to mimic physical and biochemical features of in vivo tissues [13, 14]. As an organoid is derived from specific organ, it can reproduce physiology of its origin [15]. Several researchers have suggested that intestinal- and liver-specific expression of human CYP3A4 has a profound impact on systemic exposure during oral administration of anticancer drug docetaxel [16, 17]. Especially, CYP3A11-expressed crypt organoids, which maintain absorptive and digestive 13

Journal Pre-proof functions, are an excellent model for examining drug uptake and metabolism [18]. Notably, Huch et al. proposed that human liver organoids showed stronger hepatocyte functions when compared to the HepG2 cell line [19]. In this study, we propose in vitro platforms to investigate drug metabolism and toxicity based on intestinal and liver organoids from mouse tissue-resident stem cells. We compared tissues and organoids with respect to expression of CYPs mRNA and further investigated CYPs activity dependent on the differentiation status of the organoids. Finally, we evaluated

oo

f

undifferentiated, differentiated, and CYP-induced organoids’ function to metabolize anticancer drug, docetaxel, by transferring the drug-digested media to cancer cell line. Here we

pr

suggest potential role of organoid in in vitro model for drug metabolism to the end goal of

Pr

e-

safe and agreeable toxicological assessment.

Animals

al

Materials and methods

rn

This study was approved by and followed the guidelines of the CHA University

Jo u

Institutional Animal Care and Use Committee (IACUC). The IACUC number for our study is 170092. All the experiments were done to minimize animal suffering. Male C57Bl/6 mice were obtained from the Orient Bio (Seongnam, Korea) and maintained in the animal facility at CHA University Institutional Animal Care under a 12-h light/dark cycle with food and water ad libitum. Preparation of mouse small intestinal organoids The mouse small intestine was isolated and cut into 5 mm pieces. The tissue was washed with Dulbecco’s Phosphate-Buffered Saline (DPBS) until the supernatant was clear. Small intestine crypts were isolated from tissues using Gentle Cell Dissociation Reagent (STEMCELL Technologies, CANADA). The isolated crypts were filtered through a 70 µm 14

Journal Pre-proof cell strainer and centrifuged at 260g for 10 min in a 4℃. The crypt pellets were mixed with growth reduced basement membrane Matrigel (CORNING, NY, USA) at a ratio of 1:1, then embedded in Advanced DMEM F/12 (Thermo Fisher Scientific, CA, USA) supplemented with 10 mM HEPES (Thermo Fisher Scientific, CA, USA), 2 mM Glutamax (Thermo Fisher Scientific, CA, USA), 1 x penicillin/streptomycin (Thermo Fisher Scientific, CA, USA), 1 mM N-acetylcysteine (Sigma-Aldrich, MO, USA), 1 x N2 (Thermo Fisher Scientific, CA,

oo

f

USA), 1 x B-27 (Thermo Fisher Scientific, CA, USA), 10% R-spondin conditioned medium, 50 ng/ml EGF (PeproTech, Inc., NJ, USA) , 100 ng/ml noggin (PeproTech, Inc.). The

pr

medium was changed every two days.

e-

Preparation of mouse liver organoids

The mouse liver tissue was isolated and washed clearly with ice-cold wash buffer (DMEM

Pr

high glucose supplemented with 1% fetal bovine serum and 1% penicillin/streptomycin).

al

After the supernatant of wash buffer become clear, the tissue was moved to a digestion buffer

rn

(0.125mg/ml dispase II and collagenase, 0.1 mg/ml DNase I in wash medium) and incubated at 37 °C for 40 minutes under conditions of vigorous shaking. The ductal structures and other

Jo u

hepatocytes were obtained from the supernatant. The supernatant was collected and centrifuged under 200 g for 10 minutes. The pellets were collected and mixed with Matrigel at a ratio of 1:1. The cells were embedded in Advanced DMEM F/12 supplemented with 10 mM HEPES, 2 mM Glutamax, 1 mM N-acetylcysteine, 1 x B-27, 5% R-spondin conditioned medium, 50 ng/ml EGF, 100 ng/ml noggin, 50 ng/ml murine HGF (PeproTech, Inc.), 200 ng/ml FGF10 (ATGEN, Korea), 10 mM nicotinamide (Sigma-Aldrich), and 10 nM gastrin. The medium was changed every two days. The mouse liver differentiation medium was Advanced DMEM F/12 supplemented with 10 mM HEPES, 2 mM Glutamax, 1 mM Nacetylcysteine, 1 x penicillin/streptomycin, 1 x B-27, 50 ng/ml EGF, 100 ng/ml FGF10, 10 nM recombinant human [𝐿𝑒𝑢15 ]-gastrin I (Sigma-Aldrich), 50 nM A83-01 (Sigma-Aldrich), 15

Journal Pre-proof and 10 µM DAPT. The differentiation step was done for 13 days and CYP inducers were added at day 13. HT-29 cell line culture A colon adenocarcinoma-derived HT-29 cell line (#30038, Korean Cell Line Bank, South Korea) was cultured in 10% fetal bovine serum and 1% penicillin/streptomycin in RPMI1640. The HT-29 cells were moved to the new culture ware by treating trypsin-EDTA. The HT-29 cell line was mixed with Matrigel at a ratio of 1:1 for mouse intestinal organoids drug tests.

oo

f

Immunostaining

The organoids were fixed with 4% paraformaldehyde (PFA) for 10 minutes at room

pr

temperature. The fixed organoids were washed for 5 minutes, 3 times using DPBS. The

e-

permeabilization was performed with 0.1% Triton X-100 and 0.2% Tween-20 mixed in

Pr

DPBS, and then, 5% normal goat serum in DPBS was used to reduce non-specific binding.

al

After the fixed organoids were treated with primary antibodies at 4℃ overnight, the samples

rn

were bound with secondary antibodies at room temperature for 2 hours. The following antibodies used for the staining: E-cadherin (Santa Cruz, CA, USA), Lgr5 (Santa Cruz),

Jo u

Lysozyme (Diagnostic Biosystems, CA, USA), Chromogranin A (Santa Cruz), Albumin (Santa Cruz), Sox9 (Santa Cruz), and HNF4 (Santa Cruz). The following secondary antibodies were used: Alexa Flour 488 conjugated anti-mouse IgG and Alexa Flour 594 conjugated anti-rabbit IgG (Thermo Fisher Scientific, CA, USA). Microscopic instruments Olympus CKX41 inverted phase contrast tissue culture microscope was utilized to observe organoid and cell line growth, progression, and cell death. Zeiss Axiovert 200M inverted microscope with fluorescence / phase or DIC (Nomarski) imaging was used to capture stained objects. Real-time RT-PCR analysis 16

Journal Pre-proof The organoids were treated with cell recovery solution (Corning) to remove Matrigel and total RNA was extracted using the MagListo™ 5M Cell Total RNA Extraction Kit (Bioneer, Daejeon, Korea). The manufacturer’s guideline was followed. RNA was synthesized to cDNA using PrimeScript™ RT Master Mix (TaKaRa, Japan) and quantitative polymerase chain reaction was performed by mixing cDNA with SYBR® Premix Ex Taq™ II (TaKaRa, Japan). The mRNA expression level was measured by using Thermal Cycler Dice® Real Time System III (Takara, Shiga, Japan) and data was exported from the MRQ system

leucine-rich

repeat-containing

oo

f

(Takara). The primer pairs used for qRT-PCR were as followed: a primer pair for mouse G-protein

coupled

(Lgr5),

-3’,

forward

5’5’-

reverse

pr

GACGCTGGGTTATTTCAAGTTCAA

receptor

5’-

ACCACTGCCCTCGTAATCGAA

-3’,

reverse

5’-

Pr

forward

e-

CAGCCAGCTACCAAATAGGTGCTC -3’; a primer pair for mouse E-cadherin (Ecad),

CGTCCTGCCAATCCTGATGAA -3’; a primer pair for mouse Mucin-2 (Muc2), forward

a

primer

pair

for

mouse

Lysozyme

(Lyz),

forward

5’-

rn

-3’;

al

5’- ATGCCCACCTCCTCAAAGAC -3’, reverse 5’- GTAGTTTCCGTTGGAACAGTGAA

Jo u

GAGACCGAAGCACCGACTATG -3’, reverse 5’- CGGTTTTGACATTGTGTTCGC -3’; a primer pair for mouse Villin-1 (Vill), forward 5’-GACGTTTTCACTGCCAATACCA-3’, reverse 5’- CCCAAGGCCCTAGTGAAGTCTT -3’; a primer pair for mouse Chromogranin A

(ChgA),

forward

5’-

AAGGTGATGAAGTGCGTCCT

GGTGTCGCAGGATAGAGAGG (HNF4),

forward

5’-

-3’,

reverse

5’-

-3’; a primer pair for mouse hepatocyte nuclear factor 4

GCTAAGGCGTGGGTAGGG

-3’,

reverse

5’-

AGGCTGTTGGATGAATTGAGG -3’; a primer pair for mouse albumin (Alb), forward 5’GCGCAGATGACAGGGCGGAA -3’, reverse 5’- GTGCCGTAGCATGCGGGAGG -3’; a primer pair for mouse cytochrome P450 subfamily 3A11 (CYP3A11), forward 5’TGGTCAAACGCCTCTCCTTGCTG -3’, reverse 5’- ACTGGGCCAAAATCCCGCCG-3’; 17

Journal Pre-proof a primer pair for mouse sex-determining region Y box 9 (Sox9), forward 5’TACGACTGGACGCTGGTGCC-3’, reverse 5’- CCGTTCTTCACCGACTTCCTCC-3’; a primer pair for mouse cytochrome P450 subfamily 1A2 (CYP1A2), forward 5’AAGATCCATGAGGAGCTGGA-3’, reverse 5’- TCCCCAATGCACCGGCGCTTTCC -3’; a primer pair for mouse glyceraldehyde-3 phosphate dehydrogenase (GAPDH), forward 5’AACTTTGGCATTGTGGAAGG

-3’, reverse 5’- ACACATTGGGGGTAGGAACA -3’.

Induction of cytochrome P450 family

oo

f

Mouse liver organoids from ductal structures were cultured under either an undifferentiated or a differentiated medium for induction of CYP450. For mouse small intestinal and liver

pr

organoids’ CYPs induction, known CYP450 inducers dexamethasone (Dex)[20-22], β-

e-

naphthoflavone (BNF)[23], and 1,4-bis-2-(3, 5-dichloropyridyloxy)-benzene (TCPOBOP)[24,

Pr

25] were selected, and each component’s concentration was defined referring to that of

organoids [26].

al

previously used in other literatures. Inducers were treated for 24 hours to induce mouse

rn

Cell viability assay with anti-cancer drug and CYP-induced organoids

Jo u

To confirm CYPs’ metabolic activity in intestinal and liver organoids, 3D cultured organoids in Matrigel were treated with 10 μM dexamethasone, a CYP inducer. Then, the medium of prepared HT-29 cell line embedded in Matrigel was replaced by the medium of the organoids. The experimental scheme was shown in Fig. 5A and 6A. Docetaxel concentration range 0 nM to 10 nM was set according to suitable concentrations for cell-line experiment, referring previous literatures[27, 28]. For intestinal organoid experiment, docetaxel concentrations of 0 nM, 1 nM, 5 nM, and 10 nM were applied to 3D cultured HT-29 cells in the medium passed through differentiated liver organoids (i.e. ‘Differentiation’), and HT-29 cells in the medium passed through CYPinduced differentiated liver organoids (i.e. ‘Induction’). To measure cell viability, 1 µg/ml 18

Journal Pre-proof propidium iodide (PI) and 2.5 µM Calcein AM were treated in HT-29 cell line for 30 minutes. The results were observed using fluorescence microscopy and then analyzed with fluorescence-activated cell sorting (FACS) (Fig. 5B and 5C). For liver organoid experiment, docetaxel concentrations of 0 nM, 1 nM, 3 nM, 5 nM, and 10 nM were applied to 3D cultured HT-29 cells directly (i.e. ‘Direct’), HT-29 cells in the medium passed through undifferentiated liver organoids (i.e. ‘Undifferentiation’), HT-29 cells in the medium passed through differentiated liver organoids (i.e. ‘Differentiation’), and

oo

f

HT-29 cells in the medium passed through CYP-induced differentiated liver organoids (i.e. ‘Induction’). To measure cell viability, 1 µg/ml PI and 2.5 µM Calcein AM were treated in

pr

HT-29 cell line for 30 minutes. The results were observed using microscope and fluorescence

e-

microscopy and then analyzed with FACS (Fig. 6B and 6C).

Pr

Human pancreatic tumoroid survival assay

To evaluate the anti-cancer drug metabolism of the mouse ductal-derived liver organoids,

al

liver organoids treated with docetaxel were co-cultured with human pancreatic cancer

rn

organoids (i.e. tumoroids). A schematic of co-cultured mouse liver organoids and human

Jo u

pancreatic tumoroids was presented (Fig. 7A). Cultured groups were divided into three: (1) undifferentiated mouse liver organoid with 3 nM docetaxel only (i.e. ‘Undifferentiation’), (2) differentiated organoid with 3 nM docetaxel only (i.e. ‘Differentiation’), and (3) 1 uM DexCYP induced differentiated organoid with 3 nM docetaxel (i.e. ‘Induction’). Individual organoid groups were cultured in separate culture ware, and then the liver organoids were moved with their insert into pancreatic tumoroids’ culture ware. The experiment was observed using specified microscope and fluorescence microscope. Statistical Analysis GraphPad Prism software ver.8.0.2 (MachineID 5983572D865) was used for graphic visualization and statistical analysis. Unpaired-two-tailed t-test was done to analyze the 19

Journal Pre-proof differences between two independent groups. Three or more experimental groups were analyzed using one-way ANOVA followed by Dunnett’s multiple comparison test and twoway ANOVA followed by Tukey’s post hoc test. Confidence interval on the difference between means was set at 95%. All data were presented as mean ± SEM, and the differences between groups were considered statistically significant at p < 0.05. qPCR Ct[x] value was presented as ΔCt[x] which indicated relative expression of a gene compared to expression of

oo

f

GAPDH.

Results

pr

Cellular marker mRNA expression in mouse small intestinal and liver organoids

e-

To begin with, intestinal and liver organoids were constructed from adult mouse tissues to

Pr

validate organoid’s cellular similarity to that of normal tissue. Progression of small intestinal and liver organoids was observed in time-dependent manner (Fig. 1A and 1B).

al

mRNA expressions of characteristic genes Lgr5, Ecad, Muc2, Lyz, Vill, and ChgA were

rn

compared between cultured intestinal tissues and organoids with qPCR (Fig. 2A): tissue Lgr5

Jo u

expression (n = 3, mean ΔCt[0.1592]) was significantly lower than organoid Lgr5 expression (n = 3, mean ΔCt[0.7141]; p < 0.0001); tissue Ecad expression (n = 3, mean ΔCt[0.1891]) was significantly lower than organoid Ecad expression (n = 3, mean ΔCt[0.6223]; p < 0.0001); tissue Muc2 expression (n = 3, mean ΔCt[0.0085]) was significantly lower than organoid Muc2 expression (n = 3, mean ΔCt[0.2435]; p < 0.0001); tissue Lyz expression (n = 3, mean ΔCt[0.1429]) was significantly greater than organoid Lyz expression (n = 3, mean ΔCt[0.0006]; p < 0.0001); tissue Vill expression (n = 3, mean ΔCt[0.2292]) was significantly greater than organoid Vill expression (n = 3, mean ΔCt[0.0933]; p < 0.0001); tissue ChgA expression (n = 3, mean ΔCt[0.1213]) was not significantly greater than tissue ChgA expression (n = 3, mean ΔCt[0.1022]; p = 0.5795). Moreover, expression of several tissue20

Journal Pre-proof specific markers such as ChgA, Ki67, Lyz, and Muc2 were expressed via fluorescence microscopy (Fig. 2C). All of the marker expressions were successfully visualized. mRNA expressions of characteristic genes Lgr5, Ecad, Alb, HNF4, Sox9, CYP1A2, and CYP3A11 were compared among undifferentiated liver organoids, differentiated liver organoids, and tissues (Fig. 2B). Lgr5 expression was not significantly different among the groups (p = 0.0627); Ecad expression was not significantly different among the groups (p = 0.5277); tissue Alb expression (n = 3, mean ΔCt[26.52]) was significantly higher than that of

oo

f

both undifferentiated (n = 3, mean ΔCt[2.386*10-6]; p < 0.0001) and differentiated organoids (n = 3, mean ΔCt[3.246 *10-6]; p < 0.0001); tissue HNF4 expression (n = 3, mean

pr

ΔCt[0.1107]) was significantly higher than that of both undifferentiated (n = 3, mean

e-

ΔCt[0.0045]; p = 0.0015) and differentiated organoids (n = 3, mean ΔCt[0.0134]; p =

Pr

0.0024). Sox9 expression was not significantly different among the groups (p = 0.2882); tissue CYP1A2 expression (n = 3, mean ΔCt[0.2114]) was not significantly higher than that of

al

both undifferentiated (n = 3, mean ΔCt[2.956*10-6]; p = 0.0537) and differentiated organoids

rn

(n = 3, mean ΔCt[5.386 *10-6]; p = 0.0537); tissue CYP3A11 expression (n = 3, mean

Jo u

ΔCt[0.3059]) was significantly higher than that of both undifferentiated (n = 3, mean ΔCt[1.421*10-5]; p < 0.0001) and differentiated organoids (n = 3, mean ΔCt[0.0356]; p < 0.0001). Expression of tissue-specific markers such as Alb, Sox9, HNF4, and Ecad were expressed in undifferentiated and differentiated liver organoids and presented using Fluorescence microscopy (Fig. 2D). All of the marker expressions were successfully visualized. CYPs expression in mouse small intestinal and liver organoids The mRNA expressions of CYPs in intestinal tissues and organoids were compared (Fig. 3A): tissue CYP1A1 expression (n = 3, mean ΔCt[0.7955]) was significantly greater than organoid CYP1A1 expression (n = 3, mean ΔCt[0.3115]; p = 0.0291); tissue CYP1A2 21

Journal Pre-proof expression (n = 3, mean ΔCt[0.0388]) was significantly lower than organoid CYP1A2 expression (n = 3, mean ΔCt[0.1648]; p = 0.0007); tissue CYP2A12 expression (n = 3, mean ΔCt[0.5108]) was not significantly lower than organoid CYP2A12 expression (n = 3, mean ΔCt[0.3731]; p = 0.4517); tissue CYP2C37 expression (n = 3, mean ΔCt[0.6939]) was significantly greater than organoid CYP2C37 expression (n = 3, mean ΔCt[0.0029]; p = 0.0029); tissue CYP3A11 expression (n = 3, mean ΔCt[0.1230]) was significantly lower than organoid CYP3A11 expression (n = 3, mean ΔCt[0.2129]; p = 0.0083); tissue CYP3A13

expression (n = 3, mean ΔCt[0.5380]; p = 0.9876).

oo

f

expression (n = 3, mean ΔCt[0.5341]) was not significantly lower than organoid CYP3A13

pr

The mRNA expressions of CYPs in liver tissues and organoids were compared (Fig. 3B):

e-

tissue CYP1A1 expression (n = 3, mean ΔCt[0.2427]) was not significantly greater than

Pr

organoid CYP1A1 expression (n = 3, mean ΔCt[0.0258]; p = 0.2008); tissue CYP1A2 expression (n = 3, mean ΔCt[0.0237]) was significantly lower than organoid CYP1A2

al

expression (n = 3, mean ΔCt[0.1512]; p = 0.0562); tissue CYP2A12 expression (n = 3, mean

rn

ΔCt[0.3258]) was significantly greater than organoid CYP2A12 expression (n = 3, mean

Jo u

ΔCt[0.0001]; p = 0.0006); tissue CYP2C37 expression (n = 3, mean ΔCt[0.4739]) was significantly greater than organoid CYP2C37 expression (n = 3, mean ΔCt[0.0139]; p = 0.0029); tissue CYP3A11 expression (n = 3, mean ΔCt[1.1460]) was significantly greater than organoid CYP3A11 expression (n = 3, mean ΔCt[0.0001]; p = 0.0014); tissue CYP3A13 expression (n = 3, mean ΔCt[0.2598]) was not significantly lower than organoid CYP3A13 expression (n = 3, mean ΔCt[0.0724]; p = 0.1678). Induction of CYPs in mouse small intestinal organoids To evaluate the mRNA expression and activities of CYPs, intestinal organoids were induced by CYP inducers Dex, BNF, and TCPOBOP (Fig. 4A). Data analyzed with one-way ANOVA followed by post-test compared CYPs expression levels between vehicle and CYPs22

Journal Pre-proof induced organoids. As a result, CYP1A1 was significantly induced by 10 uM BNF (n = 3, mean ΔCt[0.7501]; p = 0.0003); CYP1A2 was not significantly induced by any inducers including 1 uM BNF (n = 3, mean ΔCt[0.6855]; p = 0.1455) and 10 uM BNF (n = 3, mean ΔCt[0.7721]; p = 0.0849) but showed significant difference among means (p = 0.0472); CYP2C37 was significantly induced by 1 uM TCPOBOP (n = 3, mean ΔCt[2.543]; p = 0.0490); CYP3A11 was significantly induced by 1 uM Dex (n = 3, mean ΔCt[0.1404]; p = 0.0353), 10 uM Dex (n = 3, mean ΔCt[0.1463]; p = 0.0267), 1 uM TCPOBOP (n = 3, mean

oo

f

ΔCt[0.2027]; p = 0.0018), and 10 uM TCPOBOP (n = 3, mean ΔCt[0.1546]; p = 0.0180). Anti-cancer drug metabolism of CYPs-induced intestinal organoid

pr

To investigate the effect of intestinal organoids on drug metabolism in cancer cells, the

e-

cultured medium in the organoids treated with various concentrations of docetaxel was

Pr

applied to HT-29 cells embedded in Matrigel. An experimental scheme was followed as shown in Fig. 5A. Count of dead cells stained with PI was decreased in ‘Induction’ compared

al

to that of ‘Differentiation’ (Fig. 5B). In numbers, the percentage of surviving HT-29 cells in

rn

‘Induction’ was significantly higher than that of HT-29 cells in ‘Differentiation’ (p = 0.0354)

Jo u

along 1 nM (‘Induction’ 87.4% vs. ‘Differentiation’ 74.6%), 3 nM (81.7% vs. 60.9%), and 5 nM (60.3% vs. 40.6%) docetaxel concentrations, and mean slope of ‘Differentiation’ bestfitted linear regression (-6.668 ± 0.073, r2 = 0.84) was steeper than that of ‘Induction’ (-7.642 ± 0.406, r2 = 0.94) (Fig. 5C).

Induction of CYPs in mouse ductal-derived liver organoids CYPs induction of liver organoids was performed with Dex, BNF, and TCPOBOP (Fig. 4B). Data analyzed with one-way ANOVA followed by post-test compared CYPs expression levels between differentiated organoids and CYPs-induced organoids. As a result, CYP1A1 was significantly induced by 1 uM BNF (n = 2, mean ΔCt[0.1279]; p = 0.0344) and 10 uM BNF (n = 2, mean ΔCt[0.1624]; p = 0.0063); CYP1A2 was not significantly induced by any 23

Journal Pre-proof inducers (p = 0.4519); CYP2A12 was significantly induced by 10 uM BNF (n = 3, mean ΔCt[0.0971]; p = 0.0014); CYP2C37 was not significantly induced by any inducers (p = 0.1340); CYP3A11 was significantly induced by 1 uM Dex (n = 3, mean ΔCt[20.30]; p < 0.0001), 10 uM Dex (n = 3, mean ΔCt[11.53]; p = 0.0013), and 1 uM TCPOBOP (n = 3, mean ΔCt[11.05]; p = 0.0022); CYP3A13 was significantly induced by 10 uM Dex (n = 3, mean ΔCt[0.6637]; p = 0.0308). Anti-cancer drug metabolism of CYPs-induced liver organoid

oo

f

The effect of mouse liver organoids on drug metabolism in cancer cells was observed. The cultured medium in the organoids treated with various concentrations of docetaxel was

pr

applied to HT-29 cells embedded in Matrigel. Experiment was followed as shown in Fig. 6A.

e-

Docetaxel-induced cancer cell death was observed with fluorescence microscopy (Fig. 6B).

Pr

The number of dead cells stained with PI was increased at 1nM docetaxel for ‘Direct’; cell death in ‘Undifferentiation’ was observed in 3 nM or more docetaxel concentration; cell

al

death in ‘Differentiation’ and ‘Induction’ was observed majorly at 10 nM docetaxel. Statistic

rn

showed that the mean percentages of surviving HT-29 cells were significantly different

Jo u

among the groups (p = 0.0003), and the survived HT-29 cells in ‘Induction’ was higher than that of ‘Differentiation’ along all drug concentrations: 1 nM (‘Induction’ 106.0% vs. ‘Differentiation’ 102.3%), 3 nM (97.1% vs. 92.8%), 5 nM (91.8% vs. 84.6%), and 10 nM (79.8% vs. 67.1%) docetaxel. Mean slope of ‘Differentiation’ best-fitted linear regression (3.552 ± 0.305, r2 = 0.98) was steeper than that of ‘Induction’ (-2.382 ± 0.435, r2 = 0.91) (Fig. 6C). Human pancreatic tumoroid survival assay In Fig. 7B, comparable amount of survived human pancreatic tumoroids were found in ‘Induction’, and intact mouse liver organoids were shown. Then, fluorescence microscopy of co-culture visualized human pancreatic tumoroids (Fig. 7C). At a glance, ‘Induction’ showed 24

Journal Pre-proof the most tumoroid survival, and ‘Differentiation’ and ‘Undifferentiation’ resulted in more cancer cell death. With statistical tool, pancreatic cancer survival was compared and analyzed among the three groups (Fig. 7D): mean survival rates of ‘Undifferentiation’ (66.05 ± 2.138, n = 3) and ‘Differentiation’ (89.20 ± 2.673, n = 3) had significant difference (p = 0.0025); mean survival rates of ‘Undifferentiation’ (66.05 ± 2.138, n = 3) and ‘Induction (101.90 ± 0.943, n = 3) had significant difference (p = 0.0001); mean survival rates of ‘Differentiation’ (89.20 ± 2.673, n = 3) and ‘Induction (101.90 ± 0.943, n = 3) had significant difference (p =

oo

f

0.0111).

pr

Discussion

e-

Cellular differentiation using stem cell sources has many advantages in terms of continuous

Pr

growth, availability, preserved original functionality and less ethical restrictions [29]. Recently, Siller et al. demonstrated efficient differentiation of hESC and hiPSC into

al

hepatocyte-like cells which had key hepatic functions including cytochrome P450 and

rn

showed significant metabolic activity of pluripotent cells compared to the control group [30].

Jo u

Likewise, this experiment also showed the expression and activities of CYPs in small intestinal and ductal-derived liver organoids and further aimed to create in vivo-like in vitro model for reliable platform in medical development [31]. Integrity and properties of organoid At first shown in Fig. 1 and 2, mouse small intestinal and liver organoids constructed from adult mouse tissues were to mimic the function of original organ tissue. While maintaining basic cellular morphologies (Fig. 1A and 1B), the organoids also expressed cellular markers. As depicted in bar graph (Fig. 2A and 2B), the intestinal organoid expressed Lgr5, Ecad, and Muc2 more than the intestinal tissue did; the liver organoid expressed only Ecad and Sox9 more than the liver tissue did. Although all of expected markers were expressed by intestinal 25

Journal Pre-proof and liver organoids, the magnitude of expression differed from that of tissues. To confirm the presence and the location of expressed markers, visualized expressions of ChgA, Ki67, Lyz, and Muc2 in intestinal organoid (Fig. 2C) and expressions of Alb, HNF4, Sox9, and Ecad in liver organoid (Fig. 2D) were individually presented and merged with the silhouette of nucleus. Further investigation on the organoids to prove CYPs expression showed that all six CYPs (CYP1A1, CYP1A2, CYP2A12, CYP2C37, CYP3A11, and CYP3A13) were expressed by intestinal and liver organoids. The relative expressions of CYPs were presented as bar

oo

f

graph (Fig. 3A and 3B). Intestinal organoid’s expressions of CYP1A1, CYP1A2, and CYP3A11 were greater than that of tissue, but liver organoid’s expressions of CYPs were

pr

lower than that of tissue except CYP1A2.

e-

Anti-cancer drug metabolism of CYPs-induced intestinal organoid

Pr

Before designing experiment followed by schematic Fig. 5A, induction of CYPs was done to see which subfamily(s) was induced by which substance(s) and to compare with previous

al

literatures. Zhang et al. previously reported that CYP1A1 was induced to a high level by BNF

rn

in C57BL/6 mice [32]. In our study with C57BL/6 mouse-originated intestinal organoid,

Jo u

CYP1A1 was significantly induced by BNF (Fig. 4A). However, although Zhang et al. did not detect CYP1A2 in the mouse intestine, CYP1A2 was significantly induced by BNF in the organoid. On the other hand, CYP2A12, CYP2C37, and CYP3A11 were induced by TCPOBOP. However, lack of reference on CYPs induction of CYP2A12, CYP2C37, and CYP3A11 in C57BL/6 mouse or organoid required duplicate studies or future experiments to cross-check and confirm our findings. Using the CYPs-induced intestinal organoid, the effect of the organoid on drug metabolism was investigated. ‘Differentiation’ showed below 50% survival at 5 nM docetaxel while ‘Induction’ showed at 10 nM as much docetaxel was metabolized by CYPs-induced organoid (Fig. 5C). From the observation, docetaxel concentrations seemed to be more bearable with 26

Journal Pre-proof the CYPs-induced organoid, and the cancer cell survival rate at 5 nM docetaxel had significant difference between ‘Differentiation’ and ‘Induction’ (p = 0.0193). Therefore, CYPs-induced intestinal organoid showed larger drug-metabolic capacity when compared to that of non-induced organoid. Anti-cancer drug metabolism of CYPs-induced liver organoid Regarding liver cell cytochrome P450 expression, CYP1A1/2 were known to be induced by BNF in rattus norvegicus [33]; CYP2C37 was known to be induced by phenobarbital and

oo

f

phenytoin in C3H/HeNCrlBR(C3H) mouse [34]; CYP3A11/13 were known to be induced by Dex in C57BL/6J mouse [35]. In this study with C57BL/6 mouse ductal-derived liver

pr

organoid (Fig. 4B), both CYP1A1/2 were induced by BNF with significant variable difference;

e-

CYP2A12 was significantly induced by BNF; CYP2C37 was significantly induced by Dex,

Pr

BNF, and TCPOBOP; CYP3A11 was significantly induced by Dex and TCPOBOP; CYP3A13 was significantly induced by Dex. Nonetheless, few papers experimented on CYPs

al

induction in C57BL/6 mouse hepatocyte or liver organoid. Duplicate study or more

rn

references on C57BL/6 mouse should be made to confirm our result and to match the

Jo u

inducers with corresponding CYP subfamilies. Figure 6B visualized cancer cell death by different docetaxel concentrations: ‘Direct’, ‘Undifferentiation’, ‘Differentiation’, and ‘Induction’. With the microscope, the number of HT-29 cells in all groups seemed to be decreased from 3 nM docetaxel onwards. When analyzed with FACS, percentage of cancer cell survival and concentrations of docetaxel were considered, and two-way ANOVA for duplicate experiments of ‘Undifferentiation’, ‘Differentiation’, and ‘Induction’ was done and showed statistically significant differences among the groups (p = 0.0004) (Fig. 6C). In particular, ‘Differentiation’ had steeper slope (3.552 ± 0.305, r2 = 0.98) than that of ‘Induction’ (-2.382 ± 0.435, r2 = 0.91) with 49.1% slope

27

Journal Pre-proof difference. Therefore, CYPs-induced liver organoid indeed showed larger drug-metabolic capacity compared to that of non-induced organoid. Human pancreatic tumoroid survival assay With the established functioning organoid and CYPs induction, toxicological model for human cell was made in vitro using human and mouse resident stem cells. 3D organoid was developed to mimic physical and biochemical properties of tissues. With the organoid, the activity of anti-cancer drug docetaxel was regulated under the co-culture platform of

oo

f

pancreatic tumoroids (Fig. 7A). In a desirable condition, CYPs-induced organoids should not be damaged with docetaxel treatment but to remain alive and to metabolize drug.

pr

Morphologically, the liver organoids used in our co-culture platform were intact in all three

e-

groups, ‘Undifferentiation’, ‘Differentiation’, and ‘Induction’ (Fig. 7B). Unlike the organoids,

Pr

human pancreatic tumoroids expanded or died in ‘Undifferentiation’ or ‘Differentiation’ by docetaxel treatment. However, tumoroids in ‘Induction’ remained relatively healthy and

al

numerous after docetaxel treatment (Fig. 7B). Fluorescent microscopic images also depicted

rn

more survived pancreatic tumoroids (with Calcein AM stain) in ‘Induction’ than in the other

Jo u

two groups (Fig. 7C). After the visual confirmation, analysis on FACS showed significantly higher pancreatic tumoroid survival in ‘Induction’ versus that of ‘Undifferentiation’ (p = 0.0001) or ‘Differentiation’ (p = 0.0111) (Fig. 7D). Therefore, this analytic tumoroid survival assay done with organoid-based toxicological model very well proposed development of traditional experimental methods. Merits of advanced similarity to human tissue and softer ethical restrictions drew attention. Moreover, the organoid model offered collection of accurate data on drug toxicity and metabolism. For the reason, stem cell-derived organoids can potentially be used for pharmacokinetics and pharmacodynamics evaluation for trials with animal models, before entering clinical trials. Limitations 28

Journal Pre-proof Though the use of organoids for assay platforms had many advantages, there were limitations to overcome. In particular, liver organoids’ cytochrome P450 enzyme expression and activities had lower drug inducibility compared to actual organ [36] and the expression levels of metabolism genes were not equal to those in whole liver primary hepatocytes [4, 37]. Today, optimal growing conditions have been developed to generate stable organoid models, but the size of organoid culture and gene expression may vary by sample tissue, nutrients, oxygen diffusion, technician, etc. [38]. In this research, cultured organoid did express all

oo

f

target genes, but almost none of the cellular markers (Fig. 2A and 2B) and CYPs (Fig. 3) was expressed by organoids in the same magnitude as to that of tissue. This agreed with the

pr

findings of Ramachandran et al. and Soldatow et al. [4, 28]. Therefore, the organoid’s

e-

variability had to be taken into account when analyzing data and has to be resolved in future.

Pr

Furthermore, there exist the species-specific isoforms of CYPs that showed different catalytic performances, while there were few inter-species-conserved isoforms.[39] We performed

al

CYPs induction in human colonoids and human liver organoids, but the gene expression

rn

modification was not the same as that of mouse stem cell-driven organoids. For the reason,

Jo u

attempt to extrapolate current animal data to predict clinical consequences of human hepatic or intestinal CYPs induction should not be made, and further investigation to see-whether human organoids and tissues show similar gene expression modification and drug metabolism-should be done.[40] Prospects In 2D cancer cell line experiment, the association between pharmacodynamic assessment and clinical outcome depended on comprehensiveness and reliable prediction to quantize the link [41, 42]. Therefore, new toxicological prediction model was ever-demanding to fill out the gap between in vitro and in vivo. As proposed in this study, accurate data could be attained by toxicological model made of co-cultured mouse liver organoids and human 29

Journal Pre-proof pancreatic tumoroids. Furthermore, we suspected that even better in vivo-like milieu could be designed if functioning human liver organoids

were integrated instead of mouse liver

organoids.[43] With wholly human cell-derived prediction model, sharper prediction of clinical outcome could be expected. However, vigorous questioning on improvement, data reliability, organoid model’s functional similarities to actual organ system, etc. should be continued to develop meaningful toxicological model.

oo

f

Acknowledgements

This work was supported by the Basic Science Research Program through the National

pr

Research Foundation of Korea funded by the Ministry of Science, ICT & future Planning,

e-

Republic of Korea (NRF-2018R1D1A102050030), by the Bio & Medical Technology

Pr

Development Program (NRF-2017M3A9E4047243) funded by the Ministry of Science, ICT and Future Planning, Republic of Korea, and by a grant of the Korea Health Technology

al

R&D Project through the Korea Health Industry Development Institute, funded by the

Jo u

rn

Ministry of Health & Welfare, Republic of Korea (HI16C0002, HI17C2094, HI18C2458).

Conflicts of interest

The authors indicate no potential conflicts of interest.

Reference 1.

Watkins PB. Drug metabolism by cytochromes P450 in the liver and small bowel.

Gastroenterol Clin North Am. 1992;21(3):511-26. Epub 1992/09/01. PubMed PMID: 1516957. 2.

Galetin A, Houston JB. Intestinal and hepatic metabolic activity of five cytochrome

P450 enzymes: impact on prediction of first-pass metabolism. J Pharmacol Exp Ther. 2006;318(3):1220-9. Epub 2006/06/10. doi: 10.1124/jpet.106.106013. PubMed PMID: 16763093. 30

Journal Pre-proof 3.

Godoy P, Hewitt NJ, Albrecht U, Andersen ME, Ansari N, Bhattacharya S, et al.

Recent advances in 2D and 3D in vitro systems using primary hepatocytes, alternative hepatocyte sources and non-parenchymal liver cells and their use in investigating mechanisms of hepatotoxicity, cell signaling and ADME. Arch Toxicol. 2013;87(8):1315530. Epub 2013/08/27. doi: 10.1007/s00204-013-1078-5. PubMed PMID: 23974980; PubMed Central PMCID: PMCPMC3753504. 4.

Soldatow VY, Lecluyse EL, Griffith LG, Rusyn I. In vitro models for liver toxicity

testing.

Toxicol

Res

10.1039/C2TX20051A.

(Camb). PubMed

2013;2(1):23-39.

PMID:

23495363;

Central

doi:

PMCID:

oo

5.

PubMed

2013/03/16.

f

PMCPMC3593300.

Epub

Bale SS, Moore L, Yarmush M, Jindal R. Emerging In Vitro Liver Technologies for

Drug Metabolism and Inter-Organ Interactions. Tissue Eng Part B Rev. 2016;22(5):383-94.

pr

Epub 2016/04/07. doi: 10.1089/ten.TEB.2016.0031. PubMed PMID: 27049038; PubMed

6.

e-

Central PMCID: PMCPMC5065030.

Olson H, Betton G, Robinson D, Thomas K, Monro A, Kolaja G, et al. Concordance

Pr

of the toxicity of pharmaceuticals in humans and in animals. Regul Toxicol Pharmacol. 2000;32(1):56-67. Epub 2000/10/13. doi: 10.1006/rtph.2000.1399. PubMed PMID:

7.

al

11029269.

Ogu CC, Maxa JL. Drug interactions due to cytochrome P450. Proc (Bayl Univ Med

rn

Cent). 2000;13(4):421-3. Epub 2006/01/04. PubMed PMID: 16389357; PubMed Central

8.

Jo u

PMCID: PMCPMC1312247.

Zanger UM, Schwab M. Cytochrome P450 enzymes in drug metabolism: regulation

of gene expression, enzyme activities, and impact of genetic variation. Pharmacol Ther. 2013;138(1):103-41. Epub 2013/01/22. doi: 10.1016/j.pharmthera.2012.12.007. PubMed PMID: 23333322. 9.

Gerets HH, Tilmant K, Gerin B, Chanteux H, Depelchin BO, Dhalluin S, et al.

Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biol Toxicol. 2012;28(2):69-87. Epub 2012/01/20. doi: 10.1007/s10565-011-9208-4. PubMed PMID: 22258563; PubMed Central PMCID: PMCPMC3303072. 10.

Ramboer E, Vanhaecke T, Rogiers V, Vinken M. Immortalized Human Hepatic Cell

Lines for In Vitro Testing and Research Purposes. Methods Mol Biol. 2015;1250:53-76. 31

Journal Pre-proof Epub 2015/08/15. doi: 10.1007/978-1-4939-2074-7_4. PubMed PMID: 26272134; PubMed Central PMCID: PMCPMC4579543. 11.

Guo L, Dial S, Shi L, Branham W, Liu J, Fang JL, et al. Similarities and differences

in the expression of drug-metabolizing enzymes between human hepatic cell lines and primary human hepatocytes. Drug Metab Dispos. 2011;39(3):528-38. Epub 2010/12/15. doi: 10.1124/dmd.110.035873.

PubMed

PMID:

21149542;

PubMed

Central

PMCID:

PMCPMC3061558. 12.

Antherieu S, Chesne C, Li R, Camus S, Lahoz A, Picazo L, et al. Stable expression,

activity, and inducibility of cytochromes P450 in differentiated HepaRG cells. Drug Metab

oo

f

Dispos. 2010;38(3):516-25. Epub 2009/12/19. doi: 10.1124/dmd.109.030197. PubMed PMID: 20019244. 13.

Nam KH, Smith AS, Lone S, Kwon S, Kim DH. Biomimetic 3D Tissue Models for

pr

Advanced High-Throughput Drug Screening. J Lab Autom. 2015;20(3):201-15. Epub

e-

2014/11/12. doi: 10.1177/2211068214557813. PubMed PMID: 25385716; PubMed Central PMCID: PMCPMC4459652.

Fang Y, Eglen RM. Three-Dimensional Cell Cultures in Drug Discovery and

Development.

SLAS

Discov.

Pr

14.

2017;22(5):456-72.

Epub

2017/05/19.

doi:

al

10.1177/1087057117696795. PubMed PMID: 28520521; PubMed Central PMCID: PMCPMC5448717.

Chen Y, Zhou W, Roh T, Estes MK, Kaplan DL. In vitro enteroid-derived three-

rn

15.

responses.

Jo u

dimensional tissue model of human small intestinal epithelium with innate immune PLoS

One.

2017;12(11):e0187880.

Epub

2017/12/01.

doi:

10.1371/journal.pone.0187880. PubMed PMID: 29186150; PubMed Central PMCID: PMCPMC5706668. 16.

van Waterschoot RA, van Herwaarden AE, Lagas JS, Sparidans RW, Wagenaar E,

van der Kruijssen CM, et al. Midazolam metabolism in cytochrome P450 3A knockout mice can be attributed to up-regulated CYP2C enzymes. Mol Pharmacol. 2008;73(3):1029-36. Epub 2007/12/25. doi: 10.1124/mol.107.043869. PubMed PMID: 18156313; PubMed Central PMCID: PMCPMC2391091. 17.

van Waterschoot RA, Rooswinkel RW, Wagenaar E, van der Kruijssen CM, van

Herwaarden AE, Schinkel AH. Intestinal cytochrome P450 3A plays an important role in the regulation of detoxifying systems in the liver. FASEB J. 2009;23(1):224-31. Epub 2008/09/17. doi: 10.1096/fj.08-114876. PubMed PMID: 18794335. 32

Journal Pre-proof 18.

Sato T, Vries RG, Snippert HJ, van de Wetering M, Barker N, Stange DE, et al.

Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 2009;459(7244):262-5. Epub 2009/03/31. doi: 10.1038/nature07935. PubMed PMID: 19329995. 19.

Huch M, Gehart H, van Boxtel R, Hamer K, Blokzijl F, Verstegen MM, et al. Long-

term culture of genome-stable bipotent stem cells from adult human liver. Cell. 2015;160(12):299-312. Epub 2014/12/24. doi: 10.1016/j.cell.2014.11.050. PubMed PMID: 25533785; PubMed Central PMCID: PMCPMC4313365. 20.

Cooper BW, Cho TM, Thompson PM, Wallace AD. Phthalate induction of CYP3A4

oo

f

is dependent on glucocorticoid regulation of PXR expression. Toxicological sciences. 2008;103(2):268-77. 21.

Martignoni M, De Kanter R, Grossi P, Saturno G, Barbaria E, Monshouwer M. An in

pr

vivo and in vitro comparison of CYP gene induction in mice using liver slices and

22.

e-

quantitative RT-PCR. Toxicology in vitro. 2006;20(1):125-31. Maruyama M, Matsunaga T, Harada E, Ohmori S. Comparison of basal gene

Pr

expression and induction of CYP3As in HepG2 and human fetal liver cells. Biological and pharmaceutical bulletin. 2007;30(11):2091-7.

Chang S-Y, Voellinger JL, Van Ness KP, Chapron B, Shaffer RM, Neumann T, et al.

al

23.

Characterization of rat or human hepatocytes cultured in microphysiological systems (MPS)

Hrycay E, Bandiera S. Expression, function and regulation of mouse cytochrome

Jo u

24.

rn

to identify hepatotoxicity. Toxicology in Vitro. 2017;40:170-83.

P450 enzymes: comparison with human cytochrome P450 enzymes. Current drug metabolism. 2009;10(10):1151-83. 25.

Smith G, Henderson CJ, Parker M, White R, Bars RG, Wolf CR. 1, 4-Bis [2-(3, 5-

dichloropyridyloxy)] benzene, an extremely potent modulator of mouse hepatic cytochrome P-450 gene expression. Biochemical Journal. 1993;289(3):807-13. 26.

Maher JM, Cheng X, Slitt AL, Dieter MZ, Klaassen CD. Induction of the multidrug

resistance-associated protein family of transporters by chemical activators of receptormediated pathways in mouse liver. Drug metabolism and disposition. 2005;33(7):956-62. 27.

Iida S, Shimada J, Sakagami H. Cytotoxicity induced by docetaxel in human oral

squamous cell carcinoma cell lines. in vivo. 2013;27(3):321-32.

33

Journal Pre-proof 28.

Guo L, Dial S, Shi L, Branham W, Liu J, Fang J-L, et al. Similarities and differences

in the expression of drug-metabolizing enzymes between human hepatic cell lines and primary human hepatocytes. Drug metabolism and disposition. 2011;39(3):528-38. 29.

Zeilinger K, Freyer N, Damm G, Seehofer D, Knospel F. Cell sources for in vitro

human liver cell culture models. Exp Biol Med (Maywood). 2016;241(15):1684-98. Epub 2016/07/08. doi: 10.1177/1535370216657448. PubMed PMID: 27385595; PubMed Central PMCID: PMCPMC4999620. 30.

Siller R, Greenhough S, Naumovska E, Sullivan GJ. Small-molecule-driven

hepatocyte differentiation of human pluripotent stem cells. Stem Cell Reports. 2015;4(5):939-

oo

f

52. Epub 2015/05/06. doi: 10.1016/j.stemcr.2015.04.001. PubMed PMID: 25937370; PubMed Central PMCID: PMCPMC4437467. 31.

Nantasanti S, de Bruin A, Rothuizen J, Penning LC, Schotanus BA. Concise Review:

pr

Organoids Are a Powerful Tool for the Study of Liver Disease and Personalized Treatment

e-

Design in Humans and Animals. Stem Cells Transl Med. 2016;5(3):325-30. Epub 2016/01/23. doi: 10.5966/sctm.2015-0152. PubMed PMID: 26798060; PubMed Central

32.

Pr

PMCID: PMCPMC4807664.

Zhang Q-Y, Dunbar D, Kaminsky LS. Characterization of mouse small intestinal

33.

al

cytochrome P450 expression. Drug Metabolism and Disposition. 2003;31(11):1346-51. Lněničková K, Skálová L, Stuchlíková L, Szotáková B, Matoušková P. Induction of

rn

xenobiotic-metabolizing enzymes in hepatocytes by beta-naphthoflavone: Time-dependent

34.

Jo u

changes in activities, protein and mRNA levels. Acta Pharmaceutica. 2018;68(1):75-85. Jackson JP, Ferguson SS, Negishi M, Goldstein JA. Phenytoin induction of the

cyp2c37 gene is mediated by the constitutive androstane receptor. Drug metabolism and disposition. 2006;34(12):2003-10. 35.

Down M, Arkle S, Mills J. Regulation and induction of CYP3A11, CYP3A13 and

CYP3A25 in C57BL/6J mouse liver. Archives of biochemistry and biophysics. 2007;457(1):105-10. 36.

Miyamoto S, Hirata K, Sugimoto S, Harada K, Mitaka T. Expression of cytochrome

P450 enzymes in hepatic organoid reconstructed by rat small hepatocytes. J Gastroenterol Hepatol. 2005;20(6):865-72. Epub 2005/06/11. doi: 10.1111/j.1440-1746.2005.03804.x. PubMed PMID: 15946133. 37.

Ramachandran SD, Schirmer K, Munst B, Heinz S, Ghafoory S, Wolfl S, et al. In

Vitro Generation of Functional Liver Organoid-Like Structures Using Adult Human Cells. 34

Journal Pre-proof PLoS One. 2015;10(10):e0139345. Epub 2015/10/22. doi: 10.1371/journal.pone.0139345. PubMed PMID: 26488607; PubMed Central PMCID: PMCPMC4619350. 38.

Yin X, Mead BE, Safaee H, Langer R, Karp JM, Levy O. Engineering Stem Cell

Organoids.

Cell

Stem

Cell.

2016;18(1):25-38.

Epub

2016/01/11.

doi:

10.1016/j.stem.2015.12.005. PubMed PMID: 26748754; PubMed Central PMCID: PMCPMC4728053. 39.

Martignoni M, Groothuis GM, de Kanter R. Species differences between mouse, rat,

dog, monkey and human CYP-mediated drug metabolism, inhibition and induction. Expert opinion on drug metabolism & toxicology. 2006;2(6):875-94.

f

Graham MJ, Lake BG. Induction of drug metabolism: species differences and

oo

40.

toxicological relevance. Toxicology. 2008;254(3):184-91. 41.

Berchem G, Bosseler M, Mine N, Avalosse B. Nanomolar range docetaxel treatment

pr

sensitizes MCF-7 cells to chemotherapy induced apoptosis, induces G2M arrest and

42.

e-

phosphorylates bcl-2. Anticancer research. 1999;19(1A):535-40. Wienkers LC, Heath TG. Predicting in vivo drug interactions from in vitro drug

43.

Pr

discovery data. Nature reviews Drug discovery. 2005;4(10):825. Fatehullah A, Tan SH, Barker N. Organoids as an in vitro model of human

rn

Figure captions

al

development and disease. Nature cell biology. 2016;18(3):246.

Jo u

Figure 1. Microscopic view of organoid growth (A) Daily tracking of mouse small intestinal organoids was performed and presented at day 0, 1, 4, and 5. (B) Daily tracking of mouse liver organoids was performed and presented at day 0, 1, 4, and 5.

Figure 2. Cell markers expression of organoids and tissues (A) Cellular marker mRNA expression of mouse small intestinal tissue and organoid was compared. Lgr5, leucine-rich repeat-containing G-protein coupled receptor; Ecad, Ecadherin; Muc2, mucin 2; Lyz, lysozyme; Vill, villin-like; ChgA, chromogranin A. (B) Cellular marker mRNA expression of mouse liver tissue and organoid was compared. HNF4, hepatocyte nuclear factor 4; Alb, albumin; Sox9, sex-determining region Y box 9. (C) ChgA, Ki67, Lyz, Muc2 in mouse small intestinal organoid were visualized using fluorescence microscopy, and the position was confirmed with merge image with nucleus. (D) Alb, Sox9, 35

Journal Pre-proof HNF4, and Ecad in undifferentiated and differentiated mouse liver organoids were visualized using fluorescence microscopy, and the position was confirmed with merge image with nucleus. Undiff, undifferentiation; Diff, differentiation.

Figure 3. CYPs expression comparison of organoids and tissues (A) Relative mRNA expressions of CYP450 subfamilies in mouse small intestinal organoids and tissues were compared. (B) Relative mRNA expressions of CYP450 subfamilies in mouse liver organoids and tissues were compared.

oo

**p < 0.01, ***p < 0.001, ****p < 0.0001; t-test analysis.

f

The data in (A) and (B) were presented as mean ± SEM of the triplicate experiment; *p < 0.5,

Figure 4. Induction of CYPs in mouse small intestinal and liver organoids

pr

(A) The mRNA expressions of CYP subfamilies in mouse small intestinal organoids were

e-

induced by 1 uM and 10 uM Dex, 1 uM and 10 uM BNF, and 1 uM and 10 uM TCPOBOP. (B) The mRNA expressions of CYP subfamilies in mouse ductal-derived liver organoids

Pr

were induced by 1 uM and 10 uM Dex, 1 uM and 10 uM BNF, and 1 uM and 10 uM TCPOBOP.

al

The data in (A) and (B) were presented as mean ± SEM of the triplicate experiment; *p < 0.5,

Jo u

rn

**p < 0.01, ***p < 0.001, ****p < 0.0001; one-way ANOVA followed by post-hoc analysis.

Figure 5. Cell viability assay with mouse small intestinal organoids (A) Experimental schematic for CYP-induced intestinal organoid’s docetaxel metabolism. CYPs were induced in fully-matured organoids, and docetaxel was applied in growth media. The docetaxel-metabolized media was then introduced to HT-29 cell line so that the remaining un-metabolized docetaxel to kill cancer cells. (B) Fluorescence microscopy of Differentiation and Induction was shown according to different concentrations of docetaxel, 0, 1, 5, and 10 nM; the live cells were stained with 5 uM calcein AM, and the dead cells were stained with 1 ug/ml propidium iodide. (C) FACS analysis of HT-29 cell line survival (%) was depicted as points and connecting lines. The data in (C) was presented with mean of duplicate experiment and statistically analyzed by columnar statistics and linear regression analysis.

36

Journal Pre-proof Figure 6. Cell viability assay with mouse liver organoids (A) Experimental schematic for CYP-induced liver organoid’s docetaxel metabolism. CYPs were induced in fully-matured organoids, and docetaxel was applied in growth media. The docetaxel-metabolized media was then introduced to HT-29 cell line so that the remaining un-metabolized docetaxel to kill cancer cells. (B) Fluorescence microscopy of Direct, Undifferentiation, Differentiation, and Induction was shown according to different concentrations of docetaxel, 0, 1, 3, 5, and 10 nM; the live cells were stained with 5 uM calcein AM, and the dead cells were stained with 1 ug/ml propidium iodide. (C) FACS analysis of HT-29 cell line survival (%) was depicted as points and connecting lines.

by columnar statistics and linear regression analysis.

oo

f

The data in (C) was presented with mean of duplicate experiment and statistically analyzed

pr

Figure 7. Co-culture platform of mouse liver organoid and human pancreatic tumoroid

e-

(A) Schematic shows platform of co-culturing mouse liver organoids and human pancreatic tumoroids. Three groups were designed: (1) pancreatic tumoroids with undifferentiated liver

Pr

organoids (Undifferentiation), (2) pancreatic tumoroids with differentiated liver organoids (Differentiation), and (3) pancreatic tumoroids with CYPs-induced liver organoids

al

(Induction). Each group was first cultured in separate plate with docetaxel. Then, the groups were transferred and co-cultured with human pancreatic tumoroids, and the drug metabolism

rn

and the effects were assessed. (B) Status and conditions of human pancreatic tumoroids and

Jo u

mouse liver organoids in co-culture were observed using microscopy. (C) Fluorescence microscopy of Undifferentiation, Differentiation, and Induction was shown; the live cells were stained with 5 uM calcein AM, and the dead cells were stained with 1 ug/ml propidium iodide. (D) FACS analysis of pancreatic tumoroids survival (%) was presented as bar graph. Undiff, undifferentiation; Diff, differentiation. The data in (D) was presented as mean ± SEM of the triplicate experiment; *p < 0.5, **p < 0.01, ***p < 0.001; t-test analysis.

37

Journal Pre-proof Title;

Development of organoid-based drug metabolism model

oo

f

Highlights

Constructed organoids express all important cellular markers of its origin

•

Metabolic proteins can be induced in organoids to digest more drugs

•

Pharmacodynamics can be assessed using organoid-based toxicological model

Jo u

rn

al

Pr

e-

pr

•

38

Journal Pre-proof Declaration of interests

☒ The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this

Jo u

rn

al

Pr

e-

pr

oo

f

paper.

39

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7