- Email: [email protected]
Development of TaqMan real-time RT-PCR for sensitive detection of diverse Raspberry ringspot virus isolates
Journal Pre-proof Development of TaqMan real-time RT-PCR for sensitive detection of diverse Raspberry ringspot virus isolates Joe Tang (Conceptualization) (Methodology) (Investigation) (Writing - original draft), Filomena Ng (Methodology) (Investigation) (Validation) (Writing - original draft), Deepika Kanchiraopally (Investigation) (Validation), Lisa Ward (Writing - review and editing) (Supervision)
PII:
S0166-0934(19)30413-6
DOI:
https://doi.org/10.1016/j.jviromet.2020.113821
Reference:
VIRMET 113821
To appear in:
Journal of Virological Methods
Received Date:
13 September 2019
Revised Date:
15 January 2020
Accepted Date:
15 January 2020
Please cite this article as: Tang J, Ng F, Kanchiraopally D, Ward L, Development of TaqMan real-time RT-PCR for sensitive detection of diverse Raspberry ringspot virus isolates, Journal of Virological Methods (2020), doi: https://doi.org/10.1016/j.jviromet.2020.113821
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier.
Development of TaqMan real-time RT-PCR for sensitive detection of diverse Raspberry ringspot virus isolates Joe Tang, Filomena Ng, Deepika Kanchiraopally, Lisa Ward Plant Health and Environment Laboratory, Ministry for Primary Industries, P.O. Box 2095, Auckland, 1140, New Zealand. Corresponding author: Filomena Ng Email: [email protected]
ro of
Highlights A TaqMan real-time RT-PCR assay was developed for RpRSV detection
RpRSV isolates from a broad range of plant hosts could be detected
This assay is more specific and sensitive than previously published RT-PCR methods
re
-p
lP
Abstract
Raspberry ringspot virus (RpRSV) is an important virus that infects horticultural crops including grapevine, cherry, berry fruit and rose. The genome sequences of RpRSV are highly
na
diverse between isolates and this makes the design of a PCR-based detection method difficult. In this study, a TaqMan real-time RT-PCR assay was developed for the rapid and sensitive detection of RpRSV. Primers and probes targeting the most conserved region of the
ur
movement protein gene were designed to amplify a 229 bp fragment of RpRSV RNA-2. The assay was able to amplify all RpRSV isolates tested. The detection limit of the RpRSV target
Jo
region was estimated to be 61-98 copies, depending on the RpRSV strain. The sensitivity was about 100 times greater than the conventional RT-PCR assay using the same primers as the real-time RT-PCR assay. A comparison with published conventional RT-PCR assays indicated that both published assays lacked reliability and sensitivity, as neither were able to amplify all RpRSV isolates tested, and both were at least 1,000 times less sensitive than the novel TaqMan real-time RT-PCR assay. The assay can also be run as a duplex reaction with the nad5 plant internal control primers and probe to simultaneously verify the PCR competency of the
samples. The amplicon obtained with the real-time RT-PCR assay is suitable for direct sequencing if it is necessary to further confirm the RpRSV identity or determine the RpRSV strain.
Keywords: Raspberry ringspot virus; Nepovirus; reverse transcriptase PCR; real-time 1. Introduction Raspberry ringspot virus (RpRSV), previously also known as Raspberry Scottish leaf curl virus and Red currant ringspot virus, was first reported in 1956 from Rubus idaeus (raspberry) in
ro of
Scotland (Cadman, 1956). RpRSV is a member of the genus Nepovirus (subgroup A) in the family Secoviridae. Like other nepoviruses, the genome of RpRSV consists of two singlestranded positive-sense RNA sequences, which are composed of 7,935 and 3,914 nucleotides for RNA-1 and RNA-2, respectively. This virus infects a wide range of economically important
-p
crops and ornamental plants such as berry fruit (raspberry, strawberry, currant), sweet cherry, grapevine and rose, and causes serious diseases which have resulted in decline of plant growth and fruit yield in Europe (CABI and EPPO datasheets, 2018). Symptoms can be
re
especially severe when RpRSV co-infects with other nepoviruses. For example, grapevine fanleaf disease, which is one of the most widespread and damaging virus diseases in
lP
grapevine in Germany, is caused by RpRSV along with two other nepoviruses, Arabis mosaic virus and Grapevine fanleaf virus (Bercks, 1968). There are several RpRSV strains or serotypes
na
which are serologically distinct and transmitted by different nematode species, notably the cherry strain (RpRSV-ch), the grapevine strain (RpRSV-g) and the raspberry strain (RpRSV-r, includes the English serotype and Scottish serotype). The cherry strain (RpRSV-ch) and the
ur
grapevine strain (RpRSV-g) are transmitted by Longidorus macrosoma and Paralongidorus maximus, respectively (Wetzel et al., 2006), while the raspberry strain is transmitted by either
Jo
Longidorus macrosoma or Longidorus elongatus, depending on the serotype (Scott et al., 2000).
RpRSV is present in Europe, and it also occurs in part of West Asia (Iran, Kazakhstan, Turkey and Uzbekistan) (CABI, 2018). Due to its potential impact on horticulture, RpRSV is listed as an A2 quarantine pest in Europe (EPPO datasheet) even though it is already widespread in the region. RpRSV is also a regulated virus in New Zealand. As such, it is one of the viruses that
requires mandatory testing as part of the import health standard requirements for nursery stock of Fragaria, Prunus, Ribes, Rosa and Vitis species.
Currently, most laboratories rely on serological methods (e.g. ELISA) to detect RpRSV for phytosanitary or crop survey purposes, but these methods are generally less sensitive than PCR-based techniques. To our knowledge, there are currently only two published protocols for endpoint detection of RpRSV by conventional RT-PCR (Ochoa-Corona et al., 2005; Morimoto et al., 2011). Here, we have developed a one-step TaqMan real-time RT-PCR assay for rapid detection of RpRSV. The specificity, sensitivity and reliability of this assay were
ro of
evaluated and compared to extant RT-PCR methods of RpRSV.
-p
2. Materials and methods
2.1 Virus isolates and RNA extraction
re
Virus isolates of RpRSV and non-target nepoviruses were obtained from a range of commercial suppliers and research institutes. Virus-free plant samples which are known to be
lP
hosts of RpRSV were obtained from the post-entry quarantine greenhouse at the Plant Health and Environment Laboratory (PHEL) (Table 1). Total RNA was extracted from all samples using the Kingfisher mL workstation (ThermoFisher; Waltham, MA, USA) with an InviMag Plant Kit
na
(Invitek GmbH, Berlin, Germany). To confirm PCR competency of the samples, a real-time RTPCR was done for all RNA extracts using nad5 plant internal control primers and probe (Khan
Jo
ur
et al., 2015).
f
Table 1. Raspberry ringspot virus (RpRSV) isolates, non-target nepoviruses and healthy host species used in this study.
3
Jo ur
na l
Pr
e-
pr
oo
Sample number Virus species Isolate Original host 1 RpRSV Himalaya Rubus spp. 2 RpRSV Lloyd George Rubus spp. 3 RpRSV MX Rubus spp. 4 RpRSV Orr Rubus spp. 5 RpRSV Shepherd Rubus spp. 6 RpRSV Tarvit Rubus spp. 7 RpRSV Loewe - 07142PC (cherry str) Prunus avium 8 RpRSV Loewe - 07144PC (grapevine str) Vitis vinifera 9 RpRSV Loewe - 07143PC (raspberry str) Rubus spp. 10 RpRSV CFIA 1916-04Z1, cherry Prunus avium 11 RpRSV CFIA 1916-05Z1, cherry Prunus avium 12 RpRSV CFIA 3182-02Z1, Vitis Vitis vinifera 13 RpRSV CFIA unmarked isolate Unknown 14 RpRSV CFIA 2228-05Z1 Ribes nigrum 15 RpRSV PHEL T16_00794 S13 Lavandula “Grosso” 16 RpRSV DSMZ PV-1159 Rosa "Leonardo da Vinci" 17 RpRSV DSMZ PV-1160 Rosa "Alea" 18 RpRSV DSMZ PV-0429 Vitis vinifera 19 Tobacco ringspot virus Agdia C1561 Unknown 20 Grapevine fanleaf virus INRA A17d Vitis vinifera 21 Arabis mosaic virus DSMZ PV-0045 Vitis vinifera 22 N/A N/A Healthy Fragaria 23 N/A N/A Healthy Prunus 24 N/A N/A Healthy Ribes 25 N/A N/A Healthy Rosa 26 N/A N/A Healthy Rubus 27 N/A N/A Healthy Vitis 1 James Hutton Institute (previously Scottish Crop Research Institute), Dundee, UK. 2Loewe Biochemica GmbH, Sauerlach, Germany. Canadian Food Inspection Agency, Sidney, Canada. All CFIA isolates were originally acquired from the Netherlands.
Source James Hutton1 James Hutton James Hutton James Hutton James Hutton James Hutton Loewe2 Loewe Loewe CFIA3 CFIA CFIA CFIA CFIA PHEL, Auckland, New Zealand DSMZ, Braunschweig, Germany DSMZ, Braunschweig, Germany DSMZ, Braunschweig, Germany Agdia, Elkhart, IN, USA INRA, France DSMZ, Braunschweig, Germany PHEL, Auckland, New Zealand PHEL, Auckland, New Zealand PHEL, Auckland, New Zealand PHEL, Auckland, New Zealand PHEL, Auckland, New Zealand PHEL, Auckland, New Zealand
2.2 Primers and probes The primers and probes for the TaqMan real-time RT-PCR assay were manually designed based on an alignment of 15 existing RpRSV RNA-2 sequences containing the movement protein region from GenBank, and 10 additional sequences of the same region obtained in this study using primers 942F (Table 2) and reverse primer 5’-TCCTTCTCCCAGGTCTGCAC-3’. RpRSV nucleotide sequence alignment with primers and probes binding sites are shown in Fig. 1. OligoAnalyzer® was used to check for non-specific interactions between oligonucleotides (Integrated DNA Technologies; IA, USA). The predicted ΔG values for primer/primer and primer/probe pairs were weaker than -7.0 kcal/mole; therefore, heterodimer formation is unlikely. The 10 unique RNA-2 sequences of RpRSV (759 bp)
ro of
obtained in this study have been deposited in GenBank under the accession numbers MK951741 to MK951750.
Table 2. RpRSV primers and probes used in this study. Primer/probe
TaqMan Realtime RT-PCR
RpRSV target
Sequence (5'-3')*
Reference
-p
Assay
CAGAGTATGGGTGATTTCTGG (forward primer, 942-962)
RpRSV-1170R
CAATATTCATGTCCATGGTCAC (reverse primer, 1149-1170)
This study
RpRSV-1058R
ACTCTTWGTGAAGCCAACTTTGTT (reverse primer, 1035-1058)
This study
RpRSV-p1
FAM-TGAGAGTCAGGWATTTTCTTTCC-MGBNFQ (probe, 987-1009)
This study
RpRSV-p2
FAM-CGCACTCTTWGTGAAGCCAACTTT-BHQ1 (probe, 1038-1061)
lP
re
RpRSV-942F
This study
This study
Plant RNA internal control
GCTTCTTGGGGCTTCTTGTT
Khan et al. (2015)
NAD5-JM-R
CCAGTCACCAACATTGGCATAA
Khan et al. (2015)
na
NAD5-JM-F NAD5-610-P
CAL Red 610-AGGATCCGCATAGCCCTCGATTTATGTG-BHQ
Khan et al. (2015)
RpRSV-942F
CAGAGTATGGGTGATTTCTGG (forward primer 942-962)
This study
RpRSV-1170R
CAATATTCATGTCCATGGTCAC (reverse primer, 1149-1170)
This study
RpRSV target
ur
Conventional RT-PCR
TGTGTCTGGCTTTTGATGCT
Ochoa-Corona et al. (2005)
RpRSV-R1
GAGTGCGATAGGGGCTGTT
Ochoa-Corona et al. (2005)
Rp-F1
CTATGAGGTAGATCCATTAC
Morimoto et al. (2011)
Jo
RpRSV-F1
Rp-R1 GCGAGATCGATATCCCAT Morimoto et al. (2011) *The nucleotide positions of the primers and probes shown in brackets refer to the area of the genome of RNA-2 of RpRSV (GenBank accession AY303788).
2.3 Reaction optimisation Different primer concentrations (300 nM vs. 500 nM), probe concentrations (125 nM vs. 250 nM), and annealing/extension temperatures (58 °C vs. 60 °C vs. 62 °C) were compared for simplex real-time RT-PCR using a qScript XLT 1-step RT-qPCR ToughMix Kit (Quanta
Biosciences; MA, USA). The optimized reaction for a 20 µL final volume simplex real-time RTPCR contained: 10 µL qScript XLT 1-step RT-qPCR ToughMix, 500 nM forward and reverse primers, 250 nM FAM-labelled probes, 0.5 µg/µL bovine serum albumin (BSA) and 2 µl total RNA extract. For the duplex real-time RT-PCR assay with plant RNA internal control, the composition of the 20 µL reactions was as stated in the simplex assay, with the addition of 150 nM forward primer NAD-JM-F, 200 nM reverse primer NAD-JM-R, and 150 nM CAL Red 610-labelled probe NAD-610-P (Khan et al., 2015). The duplex reaction allows RpRSV and the plant NADH dehydrogenase subunit 5 RNA to be detected simultaneously. Thermal cycling conditions were: reverse transcription at 50°C for 15 min, initial denaturation at 95°C for
ro of
3 min, then 40 cycles of 94°C for 15 s, and 58°C for 45 s. All real-time RT-PCR reactions were run on a CFX96 real-time thermocycler (Bio-Rad, Hercules, CA, USA).
-p
2.4 Specificity
Assay specificity was evaluated against RNA samples extracted from 18 RpRSV isolates and
re
three other virus species from Nepovirus group A, as well as RNA extracted from six healthy host species (Table 1). All samples were tested in duplicate wells and repeated twice. The
lP
baseline threshold values and reaction efficiency values were calculated automatically by the CFX96 real-time thermocycler software (Bio-Rad). Samples with a threshold cycle (Ct) value greater than 36 were considered negative, as a Ct value greater than 36 was not so reliable
na
(e.g., the fluorescence was observed to be low and varied, and the Ct deviation between
ur
replicates were often greater than 0.5).
Jo
2.5 Sensitivity
In order to produce positive control plasmids, RT-PCR products were generated from a
representative isolate of three RpRSV strains (i.e. cherry, grapevine and raspberry strains from Loewe) using conventional RT-PCR with RpRSV primers 942F and 1170R. The PCR product of each RpRSV strain was cloned using the TOPO-TA Cloning kit (Life Technologies) as per the manufacturer’s instructions. The plasmid DNA concentration was determined by a NanoDrop®ND-2000 spectrophotometer (Thermo Scientific). The target copy number was calculated using the formula: copies/µL = (concentration in ng × 6.023 × 1023)/ (genome length
× 1×109 × 650). Each plasmid with an approximate 107 copies/µl was 10-fold serially diluted in RNA extracted from healthy grapevine leaf tissue to simulate matrix effects of PCR inhibition. The sensitivity and detection limit of the assay was assessed by generating a standard curve using the plasmid DNA with a known copy number of each of the RpRSV inserts. The standard curve was then used to extrapolate the copy number for each RNA dilution series of the three RpRSV strains (RNA extracts of each RpRSV strain was 10-fold serially diluted in RNA extracted from healthy grapevine).
ro of
2.6 Comparison to conventional RpRSV RT-PCR assay Both specificity and sensitivity of the TaqMan real-time RT-PCR assay were compared with conventional RpRSV RT-PCR assays including 942F/1170R (this study), as well as previously published assays RpRSV-F1/RpRSV-R1 (Ochoa-Corona et al., 2005)
and Rp-F1/Rp-R1
-p
(Morimoto et al., 2011). The comparisons were made using RNA extracts from the 18 RpRSV isolates listed in Table 1. The one-step conventional RT-PCR was performed in 20 µL reactions
re
using 2 µL of RNA template, and contained 10 µL GoTaq® Green Master Mix (Promega; Madison, WI, USA), 1 µL each of 10 µM forward primer and reverse primer, 1 µL of a
lP
10 mg/mL BSA solution in water, 1 µL of 100 mM DTT, 0.25 µL each of RNasin Plus (Promega), and SuperScript III reverse transcriptase (ThermoFisher). The following thermal cycling conditions were used: reverse transcription at 50°C for 30 min, initial denaturation at 94°C for
na
5 min, then 40 cycles of 94°C for 30 s; 58°C (942F/1170R), 61°C (RpRSV-F1/R1) or 48°C (RpF1/R1) for 30 s; 72°C for 30 s, followed by final extension of 72°C for 5 min and the target
ur
amplicon sizes are 229 bp, 385 bp, and 355 bp, respectively. PCR reactions were subject to electrophoresis on 1.5% TAE-agarose gel containing SYBR safe stain (ThermoFisher) and then
Jo
visualized under a UV transilluminator.
2.7 Duplex assay with RpRSV and nad5 internal control The nad5 internal control was used to validate the PCR competency for a plant RNA sample
so that the risk of false negatives can be minimised (Menzel et al., 2002). In order to save time and cost, duplex reactions with the RpRSV and nad5 primers were performed and compared
to the results of the simplex assay. The concentrations of nad5 primers and probe were as per Khan et al. (2015), without the use of NAD5-Block.
3. Results
3.1 Primer design Initial comparison of forward primer 942F and probe p1 with reverse primers 1058R and
ro of
1170R, respectively, was performed. Although both combinations successfully amplified all RpRSV isolates tested (data not shown), the combination with 1170R showed greater sensitivity (Ct values 10.68-23.66) than the 1058R combination (Ct values 14.95-27.12). However, the relative fluorescence units (RFU) generated by the assay (942F/1170R/p1) for
-p
some RpRSV isolates were much lower (2000-2500 RFU) than the others (3500-5000 RFU). A second probe (p2) which was modified from reverse primer 1058R was then added to form a
re
double probe assay. Comparison of the single probe assay (p1 only) and double probe assay (p1+p2) showed that the latter produced a much stronger signal and amplification was about
lP
2.5 cycles earlier for the majority of samples tested (Fig. 2). The double probe assay was therefore chosen for further optimisation. Note that a degenerate base is present in both
na
probe p1 and p2 to capture the sequence diversity amongst RpRSV isolates (Table 2).
3.2 Reaction optimization
Reaction optimization was performed with template RNA isolated from a representative of
ur
each RpRSV strain (cherry, grapevine and raspberry). There was negligible difference in Ct values obtained for all RpRSV RNA templates between different concentrations of primers
Jo
(300 nM and 500 nM) or probes (125 nM and 250 nM), but the fluorescence signal was consistently higher when 500 nM primers and 250 nM probes were present. Greater sensitivity and stronger fluorescence signal were observed for all samples tested when the assay was run with annealing and extension temperature of 58°C (approximately 0.5 to 1 cycle and 1 to 3.5 cycles earlier than 60°C and 62°C, respectively). The fluorescence curves generated using different annealing/extension temperatures for a selected sample is shown in Fig. 3. Based on the comparison of reaction performance, the optimised reaction conditions
are set as follows: 500 nM forward primer 942F and reverse primer 1170R, 250 nM probes p1 and p2, with the following thermal cycling parameters: reverse transcription at 50°C for 15 min, initial denaturation at 95°C for 3 min, followed by 40 cycles of 95°C for 15 s, and 58°C for 45 s.
3.3 Assay specificity The specificity of the real-time RT-PCR assay was compared to the conventional RT-PCR assay designed in this study (942F/1170R), as well as assays published previously by OchoaCorona et al. (2005) (RpRSV-F1/R1) and Morimoto et al. (2011) (Rp-F1/R1). All 18 RpRSV were
ro of
successfully amplified with the TaqMan real-time RT-PCR (Ct values ranged from 7.87 to 20.72) and conventional RT-PCR assays developed in this study. No amplification was observed for non-target nepoviruses or healthy host plants. In contrast, none of previously published assays were able to detect all RpRSV isolates. The assay of Ochoa-Corona et al. (2005) failed
-p
to detect samples 5 and 18 (isolates Shepherd and CFIA 2228-05Z1), and only weak amplification obtained for six isolates. Meanwhile, the assay of Morimoto et al. (2011) failed
re
to detect samples 8 and 16 (isolates Loewe-07144PC and DSMZ PV-0429). Furthermore, nonspecific amplification resulting in a band of a similar size to the target was observed for
lP
healthy Rubus (sample 24) and Rosa (sample 27) for the assays of Morimoto et al. (2011) and Ochoa-Corona et al. (2005), respectively (Fig. 4).
na
3.4 Assay sensitivity
A standard curve was generated individually for three RpRSV isolates representing cherry,
ur
grapevine and raspberry strains (Fig. 5). The values of efficiency and Y-intercept for RpRSV-ch, RpRSV-g and RpRSV-r were 1.024/39.52, 0.963/42.48 and 0.945/42.26, respectively. The
Jo
TaqMan real-time RT-PCR assay was able to detect RpRSV RNA samples down to the lowest serial dilution of 10-5 with average Ct values of 33.67 and 35.51 for the cherry strain and raspberry strain respectively, and down to 10-4 with a Ct value of 35.66 for the grapevine strain. The target RNA copy numbers at these dilutions were estimated to be about 61, 91 and 98 for RpRSV-ch, RpRSV-r and RpRSV-g, respectively. Greater reliability and consistency of detection were observed at 10 times the detection limit, i.e. 10-4 (RpRSV-ch, RpRSV-r) or 10-3 (RpRSV-g) dilutions with Ct values of 30.46-31.89 (Table 4).
RpRSV RNA samples diluted to 10-2 and 10-3 could be detected using the conventional RTPCR assay developed in this study, which was about 100 times less sensitive than the realtime RT-PCR assay. The sensitivity of the Ochoa-Corona et al. (2005) and Morimoto et al. (2011) assays was much poorer. The end point detections for the assay of Ochoa-Corona et al. (2005) were up to 10-2 for RpRSV-r, 10-1 for RpRSV-g and only a weak band observed for undiluted RNA of RpRSV-ch. The assay of Morimoto et al. (2011) failed to amplify RpRSV-g, and only detected RpRSV on undiluted RNA (RpRSV-r) or 10 times diluted RNA (RpRSV-ch).
Table 4.
ro of
Sensitivity of the TaqMan real-time RT-PCR compared to the conventional assays. Positive is indicated by “+”, negative by “-“. Ct values for the real-time RT-PCR assay are an average of three replicates; Ct values ≥ 36 cycles were considered negative.
Conventional RT-PCR (Ochoa-Corona et al., 2005) + (weak) + + (weak) + + + (weak) -
-p
17.28 ± 0.12 20.78 ± 0.08 24.10 ± 0.05 27.22 ± 0.21 30.46 ± 0.20 33.67 ± 0.15 20.96 ± 0.14 24.20 ± 0.05 27.43 ± 0.03 30.77 ± 0.15 35.66 ± 0.47 18.38 ± 0.16 21.82 ± 0.02 25.07 ± 0.17 28.56 ± 0.14 31.89 ± 0.07 35.51 ± 0.26
+ + + + (weak) + + + (weak) + + + -
Conventional RT-PCR (Morimoto et al., 2011) + + (weak) + -
Jo
ur
RpRSV-r
6,180,370 527,575 51,111 5,699 584 61 1,946,931 220,009 25,029 2,644 98 N/A 8,433,862 847,827 96,760 9,407 1,018 91
Conventional RT-PCR (this study)
re
RpRSV-g
Undiluted 10-1 10-2 10-3 10-4 10-5 Undiluted 10-1 10-2 10-3 10-4 10-5 Undiluted 10-1 10-2 10-3 10-4 10-5
Real-time RTPCR (this study)
na
RpRSV-ch
Estimated copy number of template
lP
RpRSV RNA dilution
3.5 Duplex with nad5 internal control The TaqMan real-time RT-PCR was demonstrated to perform consistently well under both
simplex and duplex conditions. The Ct values obtained from RpRSV only and RpRSV + nad5 for all 18 RpRSV isolates tested were very similar, with the greatest difference of about 1 cycle which was only observed for sample 6 (isolate “Tarvit”). The results were also consistent on
the serial dilution test, where the variation in Ct values obtained for simplex and duplex formats was less than 0.5 cycle for each 10-fold dilution down to 10-4 (Table 4).
4. Discussion The sequences of RpRSV are highly diverse between isolates, e.g. the RNA-2 genome sequences share only 78.0-81.2% between four published isolates (currently only two RNA-1 genome sequences are available). This makes the design of a PCR-based assay difficult for a
ro of
generic detection of all RpRSV isolates. Among the available RpRSV sequences in GenBank, the majority are from various fragments of RNA-2 (23 out of 28, excluding the additional 10 sequences obtained in this study). We selected the movement protein region for design of the real-time RT-PCR assay because this region was found to be the most conserved within
-p
the RNA-2 genome sequence after analysis of all RpRSV sequence data, and this has also been observed by Wetzel et al. (2006). Furthermore, the sequences used in this study were isolated from various host species which included most of the important genera such as Prunus, Ribes,
re
Rosa, Rubus and Vitis. This suggests that the diversity of RpRSV sequences could have been well represented. Indeed, the real-time RT-PCR assay developed in this study has
lP
demonstrated its reliable specificity by sound amplification of all 18 RpRSV isolates, including three distinct strains RpRSV-ch, RpRSV-g and RpRSV-r. In contrast, none of the published RT-
na
PCR assays were able to detect all RpRSV isolates tested.
Real-time PCR results could be influenced by the amplicon size. Earlier detection (lower Ct
ur
value) and a higher fluorescence level have been observed for shorter amplicons, e.g. the Ct value for an amplicon of 81 bp was found to be 2.1 to 2.4 less than the 228 bp amplicon
Jo
(Debode et al., 2017). Due to the limited availability of conserved sites, we had to design the RpRSV real-time RT-PCR assay with a product size of 229 bp. The negative effect of a larger amplicon was overcome by using two probes, which resulted in a Ct reduction of 2.5 cycles and a two-fold increase in fluorescence level. Although the larger amplicon is not ideal for real-time PCR, it enables direct sequencing of the amplicons for further confirmation and/or RpRSV strain identification. Furthermore, it provides an alternative option for laboratories that lack real-time PCR equipment or TaqMan probe reagents. They can perform conventional
RT-PCR by using the primers only, or the real-time RT-PCR can be performed as a SYBR Greenbased assay. Although the conventional RT-PCR with primers 942F/1170R is about 100 times less sensitive than the real-time RT-PCR assay, this conventional assay still performed better than the published assays in terms of both specificity and sensitivity.
Integration of nad5 internal control primers and probe with the target real-time RT-PCR assay to run simultaneously as a duplex reaction has previously been reported by Khan et al. (2015). In the Khan et al. (2015) study, it was found that sensitive detection of the amplification of the target viroid was affected by the efficiency of the nad5 reaction so that a
ro of
reagent (NAD-BLOCK) to weaken the nad5 assay performance had to be added. In this study, however, the negative effect of nad5 internal control in duplex assay was not observed, i.e. when the RNA dilution was down to near the detection limit, the Ct values obtained for the duplex assay was about the same as the simplex assay. This allows us to exclude the use of
-p
NAD-BLOCK in the duplex assay. The consistent performance of this real-time RT-PCR assay in
re
both simplex and duplex formats also supports the assay’s reliability.
In summary, a TaqMan real-time RT-PCR assay was designed for the detection of diverse
lP
RpRSV isolates. This assay was demonstrated to be highly sensitive, specific and reliable, in both simplex (RpRSV only) and duplex (RpRSV and nad5) formats. The obtained PCR products are suitable for direct sequencing if required. It is expected that the implementation of this
na
TaqMan real-time RT-PCR assay will facilitate efficient and fast phytosanitary certification of nursery stock requiring testing of RpRSV by regulatory agencies, and will also have wider uses
ur
for the general detection of RpRSV in a range of hosts.
Jo
Authorship contribution statement Joe Tang: Conceptualization, Methodology, Investigation, Writing-Original Draft; Filomena Ng: Methodology, Investigation, Validation, Writing-Original Draft; Deepika Kanchiropally: Investigation, Validation; Lisa Ward: Writing-Reviewing and Editing, Supervision
Acknowledgements
We sincerely thank all colleagues and institutes mentioned in Table 1 for sharing their RpRSV isolates for this study.
References CABI. 2018. Raspberry ringspot virus (ringspot of raspberry). Crop Protection Compendium: https://www.cabi.org/cpc/datasheet/48120. Retrieved 29th March 2018.
ro of
Cadman, C.H. 1956. Studies on the etiology and mode of spread of Scottish raspberry leaf curl disease. J. Hortic. Sci. 31, 111. Bercks, R. 1968. Über den Nachweis des Himbeerringflecken Virus (raspberry ringspot virus) in Reben. Phytopath. Z. 65, 169-173.
-p
Debode, F., Marien, A., Janssen, E., Bragard, C., Berben, G. 2017. The influence of amplicon length on real-time PCR results. Biotechnol. Agron. Soc. Environ. 21, 3-11.
re
EPPO Data Sheets on Quarantine Pests - Raspberry ringspot nepovirus. https://gd.eppo.int/download/doc/232_datasheet_RPRSV0.pdf. Retrieved 6th Sep 2019.
lP
Khan, S., Mackay, J., Liefting, L., Ward, L. 2015. Development of a duplex one-step RT-qPCR assay for the simultaneous detection of Apple scar skin viroid and plant RNA internal control. J. Virol. Methods. 221, 100-105.
na
Menzel, W., Jelkmann, W., Maiss, E., 2002. Detection of four apple viruses by multi-plex RTPCR assays with co-amplification of plant mRNA as internal control. J. Virol. Methods. 99, 8192.
ur
Morimoto, K., Tsutsui, Y., Maekawa, A., Fujiwara, Y., Ohara, T. 2011. Detection of Raspberry ringspot virus using reverse transcription loop-mediated isothermal amplification. Res. Bull. Plant Prot. 47, 19-24.
Jo
Ochoa-Corona, F.M., Lebas, B.S.M., Tang, J.Z., Bootten, T.J., Stewart, F.J., Harris, R., Elliott, D.R., Alexander, B.J.R. 2006. RT-PCR detection and strain typing of Raspberry ringspot virus. Proceedings of the XXth International Symposium on Virus and Virus-like Diseases of Temperate Fruit Crops & XIth International Symposium on Small Fruit Virus Diseases, Antalya, Turkey., May 22-26, 2006. Scott, S.W., Zimmerman M.T., Jones A.T., Le Gall, O. (2000) Differences between the coat protein amino acid sequences of English and Scottish serotypes of Raspberry ringspot virus exposed on the surface of virus particles: Virus Res. 68, 119-126. Wetzel, T., Ebel, R., Moury, B., Le Gall, O., Endisch, S., Reustle, G.M., Krczal, G. 2006. Sequence analysis of grapevine isolates of Raspberry ringspot nepovirus. Arch. Virol. 151, 599-606.
ro of -p re
lP
Fig. 1. RpRSV nucleotide sequence alignment for binding regions of the primers/probes. Only SNPs present in the alignment are shown whereas ( − ) indicates nucleotide identical to the
Jo
ur
na
primer/probe sequence.
Fig. 2. Fluorescence curves generated by single probe (blue) and double probe (red) for selected samples.
ro of
Fig. 3. Fluorescence curves generated using different annealing/extension temperatures for a selected
Jo
ur
na
lP
re
-p
sample.
Fig. 4. RpRSV conventional RT-PCR results on samples listed in Table 1, using primer pairs 942F/1170R (A), RpRSV-F1/R1 (B) and Rp-F1/R1 (C). Samples 1-18: RpRSV isolates, 19-21: non-RpRSV nepoviruses, 22-27:
healthy host species, 28 is water (negative control). The expected amplicon sizes of each primer pair are indicated against the 100 bp DNA marker.
Fig. 5. Standard curve generated using plasmid with a known copy number of the insert from three RpRSV
Jo
ur
na
lP
re
-p
ro of
isolates. A: cherry str; B: grapevine str; C: raspberry str.
PII:
S0166-0934(19)30413-6
DOI:
https://doi.org/10.1016/j.jviromet.2020.113821
Reference:
VIRMET 113821
To appear in:
Journal of Virological Methods
Received Date:
13 September 2019
Revised Date:
15 January 2020
Accepted Date:
15 January 2020
Please cite this article as: Tang J, Ng F, Kanchiraopally D, Ward L, Development of TaqMan real-time RT-PCR for sensitive detection of diverse Raspberry ringspot virus isolates, Journal of Virological Methods (2020), doi: https://doi.org/10.1016/j.jviromet.2020.113821
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier.
Development of TaqMan real-time RT-PCR for sensitive detection of diverse Raspberry ringspot virus isolates Joe Tang, Filomena Ng, Deepika Kanchiraopally, Lisa Ward Plant Health and Environment Laboratory, Ministry for Primary Industries, P.O. Box 2095, Auckland, 1140, New Zealand. Corresponding author: Filomena Ng Email: [email protected]
ro of
Highlights A TaqMan real-time RT-PCR assay was developed for RpRSV detection
RpRSV isolates from a broad range of plant hosts could be detected
This assay is more specific and sensitive than previously published RT-PCR methods
re
-p
lP
Abstract
Raspberry ringspot virus (RpRSV) is an important virus that infects horticultural crops including grapevine, cherry, berry fruit and rose. The genome sequences of RpRSV are highly
na
diverse between isolates and this makes the design of a PCR-based detection method difficult. In this study, a TaqMan real-time RT-PCR assay was developed for the rapid and sensitive detection of RpRSV. Primers and probes targeting the most conserved region of the
ur
movement protein gene were designed to amplify a 229 bp fragment of RpRSV RNA-2. The assay was able to amplify all RpRSV isolates tested. The detection limit of the RpRSV target
Jo
region was estimated to be 61-98 copies, depending on the RpRSV strain. The sensitivity was about 100 times greater than the conventional RT-PCR assay using the same primers as the real-time RT-PCR assay. A comparison with published conventional RT-PCR assays indicated that both published assays lacked reliability and sensitivity, as neither were able to amplify all RpRSV isolates tested, and both were at least 1,000 times less sensitive than the novel TaqMan real-time RT-PCR assay. The assay can also be run as a duplex reaction with the nad5 plant internal control primers and probe to simultaneously verify the PCR competency of the
samples. The amplicon obtained with the real-time RT-PCR assay is suitable for direct sequencing if it is necessary to further confirm the RpRSV identity or determine the RpRSV strain.
Keywords: Raspberry ringspot virus; Nepovirus; reverse transcriptase PCR; real-time 1. Introduction Raspberry ringspot virus (RpRSV), previously also known as Raspberry Scottish leaf curl virus and Red currant ringspot virus, was first reported in 1956 from Rubus idaeus (raspberry) in
ro of
Scotland (Cadman, 1956). RpRSV is a member of the genus Nepovirus (subgroup A) in the family Secoviridae. Like other nepoviruses, the genome of RpRSV consists of two singlestranded positive-sense RNA sequences, which are composed of 7,935 and 3,914 nucleotides for RNA-1 and RNA-2, respectively. This virus infects a wide range of economically important
-p
crops and ornamental plants such as berry fruit (raspberry, strawberry, currant), sweet cherry, grapevine and rose, and causes serious diseases which have resulted in decline of plant growth and fruit yield in Europe (CABI and EPPO datasheets, 2018). Symptoms can be
re
especially severe when RpRSV co-infects with other nepoviruses. For example, grapevine fanleaf disease, which is one of the most widespread and damaging virus diseases in
lP
grapevine in Germany, is caused by RpRSV along with two other nepoviruses, Arabis mosaic virus and Grapevine fanleaf virus (Bercks, 1968). There are several RpRSV strains or serotypes
na
which are serologically distinct and transmitted by different nematode species, notably the cherry strain (RpRSV-ch), the grapevine strain (RpRSV-g) and the raspberry strain (RpRSV-r, includes the English serotype and Scottish serotype). The cherry strain (RpRSV-ch) and the
ur
grapevine strain (RpRSV-g) are transmitted by Longidorus macrosoma and Paralongidorus maximus, respectively (Wetzel et al., 2006), while the raspberry strain is transmitted by either
Jo
Longidorus macrosoma or Longidorus elongatus, depending on the serotype (Scott et al., 2000).
RpRSV is present in Europe, and it also occurs in part of West Asia (Iran, Kazakhstan, Turkey and Uzbekistan) (CABI, 2018). Due to its potential impact on horticulture, RpRSV is listed as an A2 quarantine pest in Europe (EPPO datasheet) even though it is already widespread in the region. RpRSV is also a regulated virus in New Zealand. As such, it is one of the viruses that
requires mandatory testing as part of the import health standard requirements for nursery stock of Fragaria, Prunus, Ribes, Rosa and Vitis species.
Currently, most laboratories rely on serological methods (e.g. ELISA) to detect RpRSV for phytosanitary or crop survey purposes, but these methods are generally less sensitive than PCR-based techniques. To our knowledge, there are currently only two published protocols for endpoint detection of RpRSV by conventional RT-PCR (Ochoa-Corona et al., 2005; Morimoto et al., 2011). Here, we have developed a one-step TaqMan real-time RT-PCR assay for rapid detection of RpRSV. The specificity, sensitivity and reliability of this assay were
ro of
evaluated and compared to extant RT-PCR methods of RpRSV.
-p
2. Materials and methods
2.1 Virus isolates and RNA extraction
re
Virus isolates of RpRSV and non-target nepoviruses were obtained from a range of commercial suppliers and research institutes. Virus-free plant samples which are known to be
lP
hosts of RpRSV were obtained from the post-entry quarantine greenhouse at the Plant Health and Environment Laboratory (PHEL) (Table 1). Total RNA was extracted from all samples using the Kingfisher mL workstation (ThermoFisher; Waltham, MA, USA) with an InviMag Plant Kit
na
(Invitek GmbH, Berlin, Germany). To confirm PCR competency of the samples, a real-time RTPCR was done for all RNA extracts using nad5 plant internal control primers and probe (Khan
Jo
ur
et al., 2015).
f
Table 1. Raspberry ringspot virus (RpRSV) isolates, non-target nepoviruses and healthy host species used in this study.
3
Jo ur
na l
Pr
e-
pr
oo
Sample number Virus species Isolate Original host 1 RpRSV Himalaya Rubus spp. 2 RpRSV Lloyd George Rubus spp. 3 RpRSV MX Rubus spp. 4 RpRSV Orr Rubus spp. 5 RpRSV Shepherd Rubus spp. 6 RpRSV Tarvit Rubus spp. 7 RpRSV Loewe - 07142PC (cherry str) Prunus avium 8 RpRSV Loewe - 07144PC (grapevine str) Vitis vinifera 9 RpRSV Loewe - 07143PC (raspberry str) Rubus spp. 10 RpRSV CFIA 1916-04Z1, cherry Prunus avium 11 RpRSV CFIA 1916-05Z1, cherry Prunus avium 12 RpRSV CFIA 3182-02Z1, Vitis Vitis vinifera 13 RpRSV CFIA unmarked isolate Unknown 14 RpRSV CFIA 2228-05Z1 Ribes nigrum 15 RpRSV PHEL T16_00794 S13 Lavandula “Grosso” 16 RpRSV DSMZ PV-1159 Rosa "Leonardo da Vinci" 17 RpRSV DSMZ PV-1160 Rosa "Alea" 18 RpRSV DSMZ PV-0429 Vitis vinifera 19 Tobacco ringspot virus Agdia C1561 Unknown 20 Grapevine fanleaf virus INRA A17d Vitis vinifera 21 Arabis mosaic virus DSMZ PV-0045 Vitis vinifera 22 N/A N/A Healthy Fragaria 23 N/A N/A Healthy Prunus 24 N/A N/A Healthy Ribes 25 N/A N/A Healthy Rosa 26 N/A N/A Healthy Rubus 27 N/A N/A Healthy Vitis 1 James Hutton Institute (previously Scottish Crop Research Institute), Dundee, UK. 2Loewe Biochemica GmbH, Sauerlach, Germany. Canadian Food Inspection Agency, Sidney, Canada. All CFIA isolates were originally acquired from the Netherlands.
Source James Hutton1 James Hutton James Hutton James Hutton James Hutton James Hutton Loewe2 Loewe Loewe CFIA3 CFIA CFIA CFIA CFIA PHEL, Auckland, New Zealand DSMZ, Braunschweig, Germany DSMZ, Braunschweig, Germany DSMZ, Braunschweig, Germany Agdia, Elkhart, IN, USA INRA, France DSMZ, Braunschweig, Germany PHEL, Auckland, New Zealand PHEL, Auckland, New Zealand PHEL, Auckland, New Zealand PHEL, Auckland, New Zealand PHEL, Auckland, New Zealand PHEL, Auckland, New Zealand
2.2 Primers and probes The primers and probes for the TaqMan real-time RT-PCR assay were manually designed based on an alignment of 15 existing RpRSV RNA-2 sequences containing the movement protein region from GenBank, and 10 additional sequences of the same region obtained in this study using primers 942F (Table 2) and reverse primer 5’-TCCTTCTCCCAGGTCTGCAC-3’. RpRSV nucleotide sequence alignment with primers and probes binding sites are shown in Fig. 1. OligoAnalyzer® was used to check for non-specific interactions between oligonucleotides (Integrated DNA Technologies; IA, USA). The predicted ΔG values for primer/primer and primer/probe pairs were weaker than -7.0 kcal/mole; therefore, heterodimer formation is unlikely. The 10 unique RNA-2 sequences of RpRSV (759 bp)
ro of
obtained in this study have been deposited in GenBank under the accession numbers MK951741 to MK951750.
Table 2. RpRSV primers and probes used in this study. Primer/probe
TaqMan Realtime RT-PCR
RpRSV target
Sequence (5'-3')*
Reference
-p
Assay
CAGAGTATGGGTGATTTCTGG (forward primer, 942-962)
RpRSV-1170R
CAATATTCATGTCCATGGTCAC (reverse primer, 1149-1170)
This study
RpRSV-1058R
ACTCTTWGTGAAGCCAACTTTGTT (reverse primer, 1035-1058)
This study
RpRSV-p1
FAM-TGAGAGTCAGGWATTTTCTTTCC-MGBNFQ (probe, 987-1009)
This study
RpRSV-p2
FAM-CGCACTCTTWGTGAAGCCAACTTT-BHQ1 (probe, 1038-1061)
lP
re
RpRSV-942F
This study
This study
Plant RNA internal control
GCTTCTTGGGGCTTCTTGTT
Khan et al. (2015)
NAD5-JM-R
CCAGTCACCAACATTGGCATAA
Khan et al. (2015)
na
NAD5-JM-F NAD5-610-P
CAL Red 610-AGGATCCGCATAGCCCTCGATTTATGTG-BHQ
Khan et al. (2015)
RpRSV-942F
CAGAGTATGGGTGATTTCTGG (forward primer 942-962)
This study
RpRSV-1170R
CAATATTCATGTCCATGGTCAC (reverse primer, 1149-1170)
This study
RpRSV target
ur
Conventional RT-PCR
TGTGTCTGGCTTTTGATGCT
Ochoa-Corona et al. (2005)
RpRSV-R1
GAGTGCGATAGGGGCTGTT
Ochoa-Corona et al. (2005)
Rp-F1
CTATGAGGTAGATCCATTAC
Morimoto et al. (2011)
Jo
RpRSV-F1
Rp-R1 GCGAGATCGATATCCCAT Morimoto et al. (2011) *The nucleotide positions of the primers and probes shown in brackets refer to the area of the genome of RNA-2 of RpRSV (GenBank accession AY303788).
2.3 Reaction optimisation Different primer concentrations (300 nM vs. 500 nM), probe concentrations (125 nM vs. 250 nM), and annealing/extension temperatures (58 °C vs. 60 °C vs. 62 °C) were compared for simplex real-time RT-PCR using a qScript XLT 1-step RT-qPCR ToughMix Kit (Quanta
Biosciences; MA, USA). The optimized reaction for a 20 µL final volume simplex real-time RTPCR contained: 10 µL qScript XLT 1-step RT-qPCR ToughMix, 500 nM forward and reverse primers, 250 nM FAM-labelled probes, 0.5 µg/µL bovine serum albumin (BSA) and 2 µl total RNA extract. For the duplex real-time RT-PCR assay with plant RNA internal control, the composition of the 20 µL reactions was as stated in the simplex assay, with the addition of 150 nM forward primer NAD-JM-F, 200 nM reverse primer NAD-JM-R, and 150 nM CAL Red 610-labelled probe NAD-610-P (Khan et al., 2015). The duplex reaction allows RpRSV and the plant NADH dehydrogenase subunit 5 RNA to be detected simultaneously. Thermal cycling conditions were: reverse transcription at 50°C for 15 min, initial denaturation at 95°C for
ro of
3 min, then 40 cycles of 94°C for 15 s, and 58°C for 45 s. All real-time RT-PCR reactions were run on a CFX96 real-time thermocycler (Bio-Rad, Hercules, CA, USA).
-p
2.4 Specificity
Assay specificity was evaluated against RNA samples extracted from 18 RpRSV isolates and
re
three other virus species from Nepovirus group A, as well as RNA extracted from six healthy host species (Table 1). All samples were tested in duplicate wells and repeated twice. The
lP
baseline threshold values and reaction efficiency values were calculated automatically by the CFX96 real-time thermocycler software (Bio-Rad). Samples with a threshold cycle (Ct) value greater than 36 were considered negative, as a Ct value greater than 36 was not so reliable
na
(e.g., the fluorescence was observed to be low and varied, and the Ct deviation between
ur
replicates were often greater than 0.5).
Jo
2.5 Sensitivity
In order to produce positive control plasmids, RT-PCR products were generated from a
representative isolate of three RpRSV strains (i.e. cherry, grapevine and raspberry strains from Loewe) using conventional RT-PCR with RpRSV primers 942F and 1170R. The PCR product of each RpRSV strain was cloned using the TOPO-TA Cloning kit (Life Technologies) as per the manufacturer’s instructions. The plasmid DNA concentration was determined by a NanoDrop®ND-2000 spectrophotometer (Thermo Scientific). The target copy number was calculated using the formula: copies/µL = (concentration in ng × 6.023 × 1023)/ (genome length
× 1×109 × 650). Each plasmid with an approximate 107 copies/µl was 10-fold serially diluted in RNA extracted from healthy grapevine leaf tissue to simulate matrix effects of PCR inhibition. The sensitivity and detection limit of the assay was assessed by generating a standard curve using the plasmid DNA with a known copy number of each of the RpRSV inserts. The standard curve was then used to extrapolate the copy number for each RNA dilution series of the three RpRSV strains (RNA extracts of each RpRSV strain was 10-fold serially diluted in RNA extracted from healthy grapevine).
ro of
2.6 Comparison to conventional RpRSV RT-PCR assay Both specificity and sensitivity of the TaqMan real-time RT-PCR assay were compared with conventional RpRSV RT-PCR assays including 942F/1170R (this study), as well as previously published assays RpRSV-F1/RpRSV-R1 (Ochoa-Corona et al., 2005)
and Rp-F1/Rp-R1
-p
(Morimoto et al., 2011). The comparisons were made using RNA extracts from the 18 RpRSV isolates listed in Table 1. The one-step conventional RT-PCR was performed in 20 µL reactions
re
using 2 µL of RNA template, and contained 10 µL GoTaq® Green Master Mix (Promega; Madison, WI, USA), 1 µL each of 10 µM forward primer and reverse primer, 1 µL of a
lP
10 mg/mL BSA solution in water, 1 µL of 100 mM DTT, 0.25 µL each of RNasin Plus (Promega), and SuperScript III reverse transcriptase (ThermoFisher). The following thermal cycling conditions were used: reverse transcription at 50°C for 30 min, initial denaturation at 94°C for
na
5 min, then 40 cycles of 94°C for 30 s; 58°C (942F/1170R), 61°C (RpRSV-F1/R1) or 48°C (RpF1/R1) for 30 s; 72°C for 30 s, followed by final extension of 72°C for 5 min and the target
ur
amplicon sizes are 229 bp, 385 bp, and 355 bp, respectively. PCR reactions were subject to electrophoresis on 1.5% TAE-agarose gel containing SYBR safe stain (ThermoFisher) and then
Jo
visualized under a UV transilluminator.
2.7 Duplex assay with RpRSV and nad5 internal control The nad5 internal control was used to validate the PCR competency for a plant RNA sample
so that the risk of false negatives can be minimised (Menzel et al., 2002). In order to save time and cost, duplex reactions with the RpRSV and nad5 primers were performed and compared
to the results of the simplex assay. The concentrations of nad5 primers and probe were as per Khan et al. (2015), without the use of NAD5-Block.
3. Results
3.1 Primer design Initial comparison of forward primer 942F and probe p1 with reverse primers 1058R and
ro of
1170R, respectively, was performed. Although both combinations successfully amplified all RpRSV isolates tested (data not shown), the combination with 1170R showed greater sensitivity (Ct values 10.68-23.66) than the 1058R combination (Ct values 14.95-27.12). However, the relative fluorescence units (RFU) generated by the assay (942F/1170R/p1) for
-p
some RpRSV isolates were much lower (2000-2500 RFU) than the others (3500-5000 RFU). A second probe (p2) which was modified from reverse primer 1058R was then added to form a
re
double probe assay. Comparison of the single probe assay (p1 only) and double probe assay (p1+p2) showed that the latter produced a much stronger signal and amplification was about
lP
2.5 cycles earlier for the majority of samples tested (Fig. 2). The double probe assay was therefore chosen for further optimisation. Note that a degenerate base is present in both
na
probe p1 and p2 to capture the sequence diversity amongst RpRSV isolates (Table 2).
3.2 Reaction optimization
Reaction optimization was performed with template RNA isolated from a representative of
ur
each RpRSV strain (cherry, grapevine and raspberry). There was negligible difference in Ct values obtained for all RpRSV RNA templates between different concentrations of primers
Jo
(300 nM and 500 nM) or probes (125 nM and 250 nM), but the fluorescence signal was consistently higher when 500 nM primers and 250 nM probes were present. Greater sensitivity and stronger fluorescence signal were observed for all samples tested when the assay was run with annealing and extension temperature of 58°C (approximately 0.5 to 1 cycle and 1 to 3.5 cycles earlier than 60°C and 62°C, respectively). The fluorescence curves generated using different annealing/extension temperatures for a selected sample is shown in Fig. 3. Based on the comparison of reaction performance, the optimised reaction conditions
are set as follows: 500 nM forward primer 942F and reverse primer 1170R, 250 nM probes p1 and p2, with the following thermal cycling parameters: reverse transcription at 50°C for 15 min, initial denaturation at 95°C for 3 min, followed by 40 cycles of 95°C for 15 s, and 58°C for 45 s.
3.3 Assay specificity The specificity of the real-time RT-PCR assay was compared to the conventional RT-PCR assay designed in this study (942F/1170R), as well as assays published previously by OchoaCorona et al. (2005) (RpRSV-F1/R1) and Morimoto et al. (2011) (Rp-F1/R1). All 18 RpRSV were
ro of
successfully amplified with the TaqMan real-time RT-PCR (Ct values ranged from 7.87 to 20.72) and conventional RT-PCR assays developed in this study. No amplification was observed for non-target nepoviruses or healthy host plants. In contrast, none of previously published assays were able to detect all RpRSV isolates. The assay of Ochoa-Corona et al. (2005) failed
-p
to detect samples 5 and 18 (isolates Shepherd and CFIA 2228-05Z1), and only weak amplification obtained for six isolates. Meanwhile, the assay of Morimoto et al. (2011) failed
re
to detect samples 8 and 16 (isolates Loewe-07144PC and DSMZ PV-0429). Furthermore, nonspecific amplification resulting in a band of a similar size to the target was observed for
lP
healthy Rubus (sample 24) and Rosa (sample 27) for the assays of Morimoto et al. (2011) and Ochoa-Corona et al. (2005), respectively (Fig. 4).
na
3.4 Assay sensitivity
A standard curve was generated individually for three RpRSV isolates representing cherry,
ur
grapevine and raspberry strains (Fig. 5). The values of efficiency and Y-intercept for RpRSV-ch, RpRSV-g and RpRSV-r were 1.024/39.52, 0.963/42.48 and 0.945/42.26, respectively. The
Jo
TaqMan real-time RT-PCR assay was able to detect RpRSV RNA samples down to the lowest serial dilution of 10-5 with average Ct values of 33.67 and 35.51 for the cherry strain and raspberry strain respectively, and down to 10-4 with a Ct value of 35.66 for the grapevine strain. The target RNA copy numbers at these dilutions were estimated to be about 61, 91 and 98 for RpRSV-ch, RpRSV-r and RpRSV-g, respectively. Greater reliability and consistency of detection were observed at 10 times the detection limit, i.e. 10-4 (RpRSV-ch, RpRSV-r) or 10-3 (RpRSV-g) dilutions with Ct values of 30.46-31.89 (Table 4).
RpRSV RNA samples diluted to 10-2 and 10-3 could be detected using the conventional RTPCR assay developed in this study, which was about 100 times less sensitive than the realtime RT-PCR assay. The sensitivity of the Ochoa-Corona et al. (2005) and Morimoto et al. (2011) assays was much poorer. The end point detections for the assay of Ochoa-Corona et al. (2005) were up to 10-2 for RpRSV-r, 10-1 for RpRSV-g and only a weak band observed for undiluted RNA of RpRSV-ch. The assay of Morimoto et al. (2011) failed to amplify RpRSV-g, and only detected RpRSV on undiluted RNA (RpRSV-r) or 10 times diluted RNA (RpRSV-ch).
Table 4.
ro of
Sensitivity of the TaqMan real-time RT-PCR compared to the conventional assays. Positive is indicated by “+”, negative by “-“. Ct values for the real-time RT-PCR assay are an average of three replicates; Ct values ≥ 36 cycles were considered negative.
Conventional RT-PCR (Ochoa-Corona et al., 2005) + (weak) + + (weak) + + + (weak) -
-p
17.28 ± 0.12 20.78 ± 0.08 24.10 ± 0.05 27.22 ± 0.21 30.46 ± 0.20 33.67 ± 0.15 20.96 ± 0.14 24.20 ± 0.05 27.43 ± 0.03 30.77 ± 0.15 35.66 ± 0.47 18.38 ± 0.16 21.82 ± 0.02 25.07 ± 0.17 28.56 ± 0.14 31.89 ± 0.07 35.51 ± 0.26
+ + + + (weak) + + + (weak) + + + -
Conventional RT-PCR (Morimoto et al., 2011) + + (weak) + -
Jo
ur
RpRSV-r
6,180,370 527,575 51,111 5,699 584 61 1,946,931 220,009 25,029 2,644 98 N/A 8,433,862 847,827 96,760 9,407 1,018 91
Conventional RT-PCR (this study)
re
RpRSV-g
Undiluted 10-1 10-2 10-3 10-4 10-5 Undiluted 10-1 10-2 10-3 10-4 10-5 Undiluted 10-1 10-2 10-3 10-4 10-5
Real-time RTPCR (this study)
na
RpRSV-ch
Estimated copy number of template
lP
RpRSV RNA dilution
3.5 Duplex with nad5 internal control The TaqMan real-time RT-PCR was demonstrated to perform consistently well under both
simplex and duplex conditions. The Ct values obtained from RpRSV only and RpRSV + nad5 for all 18 RpRSV isolates tested were very similar, with the greatest difference of about 1 cycle which was only observed for sample 6 (isolate “Tarvit”). The results were also consistent on
the serial dilution test, where the variation in Ct values obtained for simplex and duplex formats was less than 0.5 cycle for each 10-fold dilution down to 10-4 (Table 4).
4. Discussion The sequences of RpRSV are highly diverse between isolates, e.g. the RNA-2 genome sequences share only 78.0-81.2% between four published isolates (currently only two RNA-1 genome sequences are available). This makes the design of a PCR-based assay difficult for a
ro of
generic detection of all RpRSV isolates. Among the available RpRSV sequences in GenBank, the majority are from various fragments of RNA-2 (23 out of 28, excluding the additional 10 sequences obtained in this study). We selected the movement protein region for design of the real-time RT-PCR assay because this region was found to be the most conserved within
-p
the RNA-2 genome sequence after analysis of all RpRSV sequence data, and this has also been observed by Wetzel et al. (2006). Furthermore, the sequences used in this study were isolated from various host species which included most of the important genera such as Prunus, Ribes,
re
Rosa, Rubus and Vitis. This suggests that the diversity of RpRSV sequences could have been well represented. Indeed, the real-time RT-PCR assay developed in this study has
lP
demonstrated its reliable specificity by sound amplification of all 18 RpRSV isolates, including three distinct strains RpRSV-ch, RpRSV-g and RpRSV-r. In contrast, none of the published RT-
na
PCR assays were able to detect all RpRSV isolates tested.
Real-time PCR results could be influenced by the amplicon size. Earlier detection (lower Ct
ur
value) and a higher fluorescence level have been observed for shorter amplicons, e.g. the Ct value for an amplicon of 81 bp was found to be 2.1 to 2.4 less than the 228 bp amplicon
Jo
(Debode et al., 2017). Due to the limited availability of conserved sites, we had to design the RpRSV real-time RT-PCR assay with a product size of 229 bp. The negative effect of a larger amplicon was overcome by using two probes, which resulted in a Ct reduction of 2.5 cycles and a two-fold increase in fluorescence level. Although the larger amplicon is not ideal for real-time PCR, it enables direct sequencing of the amplicons for further confirmation and/or RpRSV strain identification. Furthermore, it provides an alternative option for laboratories that lack real-time PCR equipment or TaqMan probe reagents. They can perform conventional
RT-PCR by using the primers only, or the real-time RT-PCR can be performed as a SYBR Greenbased assay. Although the conventional RT-PCR with primers 942F/1170R is about 100 times less sensitive than the real-time RT-PCR assay, this conventional assay still performed better than the published assays in terms of both specificity and sensitivity.
Integration of nad5 internal control primers and probe with the target real-time RT-PCR assay to run simultaneously as a duplex reaction has previously been reported by Khan et al. (2015). In the Khan et al. (2015) study, it was found that sensitive detection of the amplification of the target viroid was affected by the efficiency of the nad5 reaction so that a
ro of
reagent (NAD-BLOCK) to weaken the nad5 assay performance had to be added. In this study, however, the negative effect of nad5 internal control in duplex assay was not observed, i.e. when the RNA dilution was down to near the detection limit, the Ct values obtained for the duplex assay was about the same as the simplex assay. This allows us to exclude the use of
-p
NAD-BLOCK in the duplex assay. The consistent performance of this real-time RT-PCR assay in
re
both simplex and duplex formats also supports the assay’s reliability.
In summary, a TaqMan real-time RT-PCR assay was designed for the detection of diverse
lP
RpRSV isolates. This assay was demonstrated to be highly sensitive, specific and reliable, in both simplex (RpRSV only) and duplex (RpRSV and nad5) formats. The obtained PCR products are suitable for direct sequencing if required. It is expected that the implementation of this
na
TaqMan real-time RT-PCR assay will facilitate efficient and fast phytosanitary certification of nursery stock requiring testing of RpRSV by regulatory agencies, and will also have wider uses
ur
for the general detection of RpRSV in a range of hosts.
Jo
Authorship contribution statement Joe Tang: Conceptualization, Methodology, Investigation, Writing-Original Draft; Filomena Ng: Methodology, Investigation, Validation, Writing-Original Draft; Deepika Kanchiropally: Investigation, Validation; Lisa Ward: Writing-Reviewing and Editing, Supervision
Acknowledgements
We sincerely thank all colleagues and institutes mentioned in Table 1 for sharing their RpRSV isolates for this study.
References CABI. 2018. Raspberry ringspot virus (ringspot of raspberry). Crop Protection Compendium: https://www.cabi.org/cpc/datasheet/48120. Retrieved 29th March 2018.
ro of
Cadman, C.H. 1956. Studies on the etiology and mode of spread of Scottish raspberry leaf curl disease. J. Hortic. Sci. 31, 111. Bercks, R. 1968. Über den Nachweis des Himbeerringflecken Virus (raspberry ringspot virus) in Reben. Phytopath. Z. 65, 169-173.
-p
Debode, F., Marien, A., Janssen, E., Bragard, C., Berben, G. 2017. The influence of amplicon length on real-time PCR results. Biotechnol. Agron. Soc. Environ. 21, 3-11.
re
EPPO Data Sheets on Quarantine Pests - Raspberry ringspot nepovirus. https://gd.eppo.int/download/doc/232_datasheet_RPRSV0.pdf. Retrieved 6th Sep 2019.
lP
Khan, S., Mackay, J., Liefting, L., Ward, L. 2015. Development of a duplex one-step RT-qPCR assay for the simultaneous detection of Apple scar skin viroid and plant RNA internal control. J. Virol. Methods. 221, 100-105.
na
Menzel, W., Jelkmann, W., Maiss, E., 2002. Detection of four apple viruses by multi-plex RTPCR assays with co-amplification of plant mRNA as internal control. J. Virol. Methods. 99, 8192.
ur
Morimoto, K., Tsutsui, Y., Maekawa, A., Fujiwara, Y., Ohara, T. 2011. Detection of Raspberry ringspot virus using reverse transcription loop-mediated isothermal amplification. Res. Bull. Plant Prot. 47, 19-24.
Jo
Ochoa-Corona, F.M., Lebas, B.S.M., Tang, J.Z., Bootten, T.J., Stewart, F.J., Harris, R., Elliott, D.R., Alexander, B.J.R. 2006. RT-PCR detection and strain typing of Raspberry ringspot virus. Proceedings of the XXth International Symposium on Virus and Virus-like Diseases of Temperate Fruit Crops & XIth International Symposium on Small Fruit Virus Diseases, Antalya, Turkey., May 22-26, 2006. Scott, S.W., Zimmerman M.T., Jones A.T., Le Gall, O. (2000) Differences between the coat protein amino acid sequences of English and Scottish serotypes of Raspberry ringspot virus exposed on the surface of virus particles: Virus Res. 68, 119-126. Wetzel, T., Ebel, R., Moury, B., Le Gall, O., Endisch, S., Reustle, G.M., Krczal, G. 2006. Sequence analysis of grapevine isolates of Raspberry ringspot nepovirus. Arch. Virol. 151, 599-606.
ro of -p re
lP
Fig. 1. RpRSV nucleotide sequence alignment for binding regions of the primers/probes. Only SNPs present in the alignment are shown whereas ( − ) indicates nucleotide identical to the
Jo
ur
na
primer/probe sequence.
Fig. 2. Fluorescence curves generated by single probe (blue) and double probe (red) for selected samples.
ro of
Fig. 3. Fluorescence curves generated using different annealing/extension temperatures for a selected
Jo
ur
na
lP
re
-p
sample.
Fig. 4. RpRSV conventional RT-PCR results on samples listed in Table 1, using primer pairs 942F/1170R (A), RpRSV-F1/R1 (B) and Rp-F1/R1 (C). Samples 1-18: RpRSV isolates, 19-21: non-RpRSV nepoviruses, 22-27:
healthy host species, 28 is water (negative control). The expected amplicon sizes of each primer pair are indicated against the 100 bp DNA marker.
Fig. 5. Standard curve generated using plasmid with a known copy number of the insert from three RpRSV
Jo
ur
na
lP
re
-p
ro of
isolates. A: cherry str; B: grapevine str; C: raspberry str.