- Email: [email protected]
Development of the rhythmic melatonin secretion in the embryonic chicken pineal gland
General and Comparative Endocrinology 152 (2007) 148–153 www.elsevier.com/locate/ygcen
Development of the rhythmic melatonin secretion in the embryonic chicken pineal gland Vale´r J. Csernus *, Andra´s D. Nagy, Na´ndor Faluhelyi Department of Anatomy, Medical School, University of Pe´cs, and Neurohumoral Regulations Research Group of the Hungarian Academy of Sciences, Pe´cs, Hungary Received 15 September 2006; revised 3 January 2007; accepted 19 January 2007 Available online 25 January 2007
Abstract In order to elucidate details on the development of the circadian clock, the effects of light on the in vitro melatonin (MT) release and the presence of mRNAs of several clock genes in the embryonic chicken pineal gland were investigated. Chicken embryos of various developmental stages were exposed to stimuli of light in vitro in dynamic, four day long bioassay (perifusion). MT secretion and mRNA levels of Cry1, Cry2, Clock and Bmal2 clock genes were determined. Our conclusions: (1) environmental illumination modified MT secretion from explanted embryonic pineal glands as early as on the 13th embryonic day, (2) daily rhythm of MT release develops between embryonic days 16 and 18 under periodic environmental illumination. (3) Chicken Cry1, Cry2, Clock and Bmal2 clock gene mRNAs were also detected in glands of animals of 15th embryonic day. Although both MT secretion and clock genes have been developed by then, the circadian MT rhythm appears first on the 17th embryonic day. Either the mechanisms coupling the clock with the melatonin output or the synchronization of the individual pinealocytes develop around this age. Rhythmic MT release in the embryonic chicken pineal gland evolves only if the egg is exposed to rhythmic environmental stimuli. Ó 2007 Elsevier Inc. All rights reserved. Keywords: Circadian; In vitro; Perifusion; Ontogeny; Light; Clock genes; Cry1
1. Introduction In contrast to mammals, the avian pineal gland secretes melatonin (MT) in a circadian manner during embryonic life (Zeman et al., 1992). The factors that participate in the emergence of the MT rhythm, however, remain to be clarified. Environmental light even in vitro controls the circadian MT rhythm of the adult chicken pineals (Binkley et al., 1978; Takahashi et al., 1980; Csernus et al., 1998). Rhythmic MT secretion from chicken pineal gland can also be modified by changes in the environmental temperature and the magnetic field in vitro (Csernus et al., 2005). MT was detected first in the chicken embryo on the 10th day of embryonic life (ED10) (Moller and Moller, 1990). An increased nighttime MT content was found in pineal
*
Corresponding author. Fax: +36 72 536393. E-mail address: [email protected] (V.J. Csernus).
0016-6480/$ - see front matter Ó 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.ygcen.2007.01.008
glands of ED18–19 chicken embryos in vivo (Zeman et al., 1992, 1999) and in ED13–18 chickens in vitro kept under a 12:12 light:dark (LD) cycle (Akasaka et al., 1995; Lamosova et al., 1995). Chicken pineal gland explanted on ED13 showed variable MT release in vitro indicating that oscillator units controlling the MT release might be functional at this time, but have not been synchronized yet (Faluhelyi et al., 2004). In contrast, chicken pineal gland, explanted on ED18, secreted MT in a clear circadian manner even under constant darkness (Faluhelyi et al., 2004). These data show that circadian oscillator units, connected to the MT synthesizing machinery, are not only present but are already synchronized to the environment in the embryonic life in the chicken. Environmental factors influence maturation of the pineal functions by targeting components of the intracellular oscillator. Clock genes play key roles in establishing circadian oscillations within the cells. In the pineal gland of the chicken embryo, rhythmic expression of Per2 clock gene
V.J. Csernus et al. / General and Comparative Endocrinology 152 (2007) 148–153
was shown on ED18 (Okabayashi et al., 2003). However, no evidence has been published on the involvement of other well known clock components, i.e. Clock, Bmal and Cryptochrome genes in the development of circadian oscillators of birds. The aim of this study was to collect more information on the development of the circadian oscillator and on the effects of environment on this process in the chicken pineal gland. In vitro MT secretion from the embryonic chicken pineal gland was monitored under reversed illumination. Furthermore, expression of clock genes was investigated in the pineal gland of embryonic chickens. 2. Materials and methods 2.1. Animals and housing conditions Fertilized eggs of domestic chicken were obtained from a local hatchery (Mohacs, Hungary) and were incubated under constant darkness at 37.5 °C, with a relative humidity of 60%. Pineal glands of chicken embryos of embryonic days 13, 15 and 17 (ED13, ED15 and ED17) were collected. Animal housing, care and application of experimental procedures were carried out in accordance with institutional guidelines under approved protocols (No: BA02/2000–31/2001, University of Pe´cs).
2.2. Perifusion system Perifusion technique was used as previously described (Csernus and Schally, 1991; Rekasi et al., 1991). Briefly, fragments of two to five chicken pineal glands were mixed with Sephadex G-10 (Sigma) and distributed into two glass columns. A Medium 199 (Sigma) based tissue culture medium, equilibrated with a mixture of 95% air and 5% carbon dioxide was passed through the columns at a flow rate of 0.1 ml/min, under 37 °C. Samples (180, in each experiment) were collected at 30 min intervals. To ensure complete darkness during the dark periods (D), the perifusion system was placed in a dark room. During the light periods of the experiments (L), the columns were exposed to light of incandescent light bulbs. The light intensity was measured with a L666417 (Extech Instr.) lux-meter.
2.3. Perifusion data analysis Each figure shows data from one of 3–4 similarly designed experiments which resulted in virtually identical graphs. The results of RIA of duplicate samples were processed with the aid of a computer program, written in our laboratory. Perifusion results were analyzed by our computer program (for principles see: Csernus and Schally, 1991).
2.4. Melatonin assay Melatonin concentration of the collected perifusion fluid fractions was determined using a radioimmunoassay (RIA) developed in our laboratory (Rekasi et al., 1991). Briefly: To each assay tube, 200 ll of sample (in duplicates), the MT-antibody (7 nl/tube, at a final dilution of 1/100,000) and 10,000 cpm (125 fmol) tracer (/O-methyl-3H/melatonin, Amersham, TRK 798) were added to the assay buffer (0.5 M phosphate-buffered saline containing 1 g/L sodium azide and 1 g/L gelatine) in a total of 700 ll. For standard curve (ranging 8.6–30 fmol/tube), a nine-step series of 1:2 dilutions from MT was used in triplicate. Following an overnight incubation at 4 °C, 250 ll of ice-cold saturated dextran coated charcoal (Sigma, C5260) was added to each tube. After 20 min, during which time the tubes were mixed twice, the samples were centrifuged (20 min at 3000g, 4 °C). The supernatants were transferred into scintillation vials. One ml dioxane and 5 ml liquid scintillation cocktail (4.3 g PPO and 42 mg POPOP in 1 L toluene) were added and the radioactivity was counted in a b scintillation
149
counter (Beckman, LS-100C) for 10 min. The assay sensitivity was 80 pmol/L. The intra- and interassay coefficients of variation were 5–6 and 7–8%, respectively.
2.5. Semi-quantitative RT-PCR Total RNA was extracted from pineal glands with Sigma’s TRI Reagent following the manufacturer’s protocol. Using 200 ng pineal RNA, one-step RT-PCR was performed with 5 U MMLV Reverse Transcriptase (Applied Biosystems) and 0.2 U RedTaq DNA polymerase (Sigma). After 15 min of incubation at 42 °C and denaturation for 5 min at 94 °C, the reaction was run for 26 cycles (94 °C for 30 s, 60 °C for 30 s then at 72 °C for 1 min). The primers for chicken Clock, Bmal2, Per1, Cry1 and Cry2 mRNAs, were designed earlier in our laboratory and have been published (Csernus et al., 2005). To use a 500 bp fragment of the chicken b-actin mRNA for internal standard, GATGGACTCTGGTGATGGTG and AGGGCTGTGATCTCCTTCTG primer pairs were applied. Products were separated with 3 mm thin, 2% agarose mini-gels (in TAE buffer), which were post-stained with SYBR Green I (Sigma) and trans-illuminated with blue light (Dark Reader, Clare Chemical Ltd., USA). Cry1 expression level was determined by dividing the mean band intensity (measured with Image-J software, NIH) of Cry1 by that of the b-actin. Significant differences between groups were determined with ANOVA followed by Student’s t-test (p < 0.05).
3. Results 3.1. The effects of the environment on the rhythmic MT release form the embryonic chicken pineal gland Fertilized chicken eggs were incubated using standard procedure. The eggs were turned once a day around 7:00. On ED18, the pineal glands of the chickens were explanted to the perifusion system. Regular daily rhythm of the in vitro MT secretion resulted in morning peaks (Fig. 1). In a similar experiment, the eggs were turned every 2 h and the incubator was carefully light-protected. The pineal glands were explanted on ED16. The MT secretion did not show rhythmic changes; only episodic alterations in the MT level were observed (Fig. 2). 3.2. The effects of in vitro illumination on the rhythmic MT release form the embryonic chicken pineal gland After incubation under constant conditions (with egg turnings in every 2 h), the pineal glands were explanted on ED13. During a 5 day perifusion experiment, the tissues were illuminated daily for 8 h (between 20:00 and 4:00) with a 600 lux light. Melatonin secretion was irregular and the illumination slightly compressed the hormone production (Fig. 3). Perifused ED17–20 pineals, after similar incubation, secreted MT in a clear circadian manner. This rhythm could be rapidly inverted using reversed illumination (Fig. 4). The peaks appeared around 13.00. 3.3. The expression of the clock genes in the embryonic chicken pineal gland Fertilized eggs were incubated under standard condition. The eggs were exposed to dim light during the
150
V.J. Csernus et al. / General and Comparative Endocrinology 152 (2007) 148–153
Melatonin (nmol/l)
6
4
2
0 0:00
12:00
0:00
12:00
0:00
12:00
hours
Fig. 1. In vitro melatonin (MT) release from chicken pineal gland, explanted on embryonic day 18 (ED18). During the incubation, the eggs were turned once a day around 7 AM. The perifusion experiment was run in total darkness. The columns represent MT content of consecutive 30 min fractions. The MT was secreted in a clear circadian manner with the peak around 7 AM.
5
Melatonin (nmol/l)
4
3
2
1
0 0:00
12:00
0:00
12:00
0:00
12:00
0:00
hours Fig. 2. In vitro melatonin (MT) release from embryonic chicken pineal gland explanted on ED16. During the incubation, the eggs were turned every 2 h. The other parameters and the structure of the figure are similar to those in Fig. 1. High level of MT release was experienced showing apparently random alterations.
daytime. From total RNA extracts of the pineal glands of ED15 chickens RT-PCR was performed (Fig. 5). Spots of Clock, Bmal2, Cry1 and Cry2 cDNA were detected in the expected molecular weight range. No Per1 was found in similar experiments (data not shown). Chicken embryos kept under similar condition were sacrificed beginning ED18 in a two day period in 4 h intervals. For determination of Cry1-mRNA levels, RT-PCR experiments were performed from the pineal extracts. In each sample the level of b-actin-mRNA was also determined as internal standard. The densities of the clock gene cDNA
spots were compared to the b-actin-cDNA spot in the same sample. Clear circadian rhythm in the Cry1 expression was found. The shape and the phase of the curve were similar to that obtained from 6-week-old chicken in similar experiments (Fig. 6). 4. Discussion The pineal gland plays a key role in controlling the circadian rhythmic activities in most vertebrate species through MT release. In mammals, pineal MT release is
V.J. Csernus et al. / General and Comparative Endocrinology 152 (2007) 148–153
151
0.3
Melatonin (nmol/l)
0.25
0.2
0.15
0.1
0.05
0 0:00
12:00
0:00
12:00
0:00
12:00
0:00
hours Fig. 3. In vitro melatonin (MT) release from embryonic chicken pineal gland explanted on ED13. The perifusion columns were illuminated with a 600 lux light daily from 20:00 to 04:00. White columns represent the illumination periods. The other parameters and the structure of the figure are similar to those in Fig. 1. Periodic illumination did not synchronize the apparently random MT release. During the illumination a tendency to decrease the MT release is seen.
5
Melatonin (nmol/l)
4
3
2
1
0 0:00
12:00
0:00
12:00
0:00
12:00
0:00
hours Fig. 4. In vitro melatonin (MT) release from embryonic chicken pineal gland explanted on ED17. The perifusion columns were illuminated with a 600 lux light daily from 20:00 to 04:00 (white columns). The other parameters and the structure of the figure are similar to those in the previous figures. The circadian rhythm of the MT secretion reverses rapidly following the phase of the illumination.
controlled by the circadian pacemaker in the suprachiasmatic nucleus via the sympathetic nervous system. In contrast, the pineal gland of most non-mammalian vertebrates includes a fully functional circadian clock and possesses direct light sensitivity (Binkley et al., 1978). These features render the pineal gland of these species a complete circadian pacemaker that works without, or interplays with the circadian clock in the suprachiasmatic nucleus. Investigating the mechanisms and development of the circadian clock in the non-mammalian pineal gland provides a tractable model for the study of circadian events.
MT in the chicken pineal gland was detected as early as on ED10 (Moller and Moller, 1990). From ED13, MT production of the explanted chicken pineal glands change episodically but no regular rhythm is detected (Faluhelyi et al., 2004). These data might indicate that the oscillator units controlling the MT release might be functional by this time, but the individual clock units have not been synchronized yet. Based on perifusion studies, circadian rhythm in MT secretion appears first between ED16 and ED18 (Faluhelyi et al., 2004). By this time not only the cellular mechanisms, responsible for the synchronization of the
152
V.J. Csernus et al. / General and Comparative Endocrinology 152 (2007) 148–153
Clock
Bmal2
Cry1
Cry2
1000 bp
400 bp 300 bp 200 bp 150 bp
Fig. 5. Expression of clock genes in the embryonic chicken pineal gland. The gel photo shows bands of RT-PCR products of Clock, Bmal2, Cry1 and Cry2 mRNAs extracted from chicken pineal glands at the age of ED15.
Chicken Cry1/ß-actin mRNA rel. density
oscillator units, seem to be mature, but also circadian signals from the environment reach this system. In birds, various circadian environmental signals might affect the chick during incubation and synchronize its circadian clock before hatching. The stimuli might be rhythmic mechanical, temperature or light stimuli. During the standard artificial incubation procedure, daily egg turning or daily changes of illumination might be such factors. If the eggs are handled under continuous darkness and constant temperature, and the egg-turnings were carried out in 2 h intervals, the hormone production of the pineals did not become rhythmic between ED15 and ED18 (Fig. 2.). Based upon data from similar experiments on chicken pineal gland explanted on various embryonic days (data not shown), it is concluded that no circadian rhythm develops until hatching when no environmental signal of circadian type affects the egg. These data suggest that rhythmic environmental signals are required for maturation of the circadian pacemaker in the avian pineal gland. Our observation, that MT rhythms are not evolved in the pineal glands in vitro when experiments are carried out in constant darkness, is consistent with this suggestion.
Immunoreactivity of pinopsin, the photopigment of the pineal gland, was detected as early as on ED8 in quail (Yamao et al., 1999). In the same species, rod and cone type of photoreceptors seem to be mature by ED13 (Araki et al., 1992) suggesting that the pineal gland might be light sensitive by then. In our experiments, periodic illumination temporarily suppressed the in vitro MT release from the chicken pineal gland on and after ED13 (Fig. 3). These data indicate that the photoreceptors in the embryonic chicken pineal gland are functioning. Although the illumination was applied in a rhythmic circadian manner no synchronization of the MT rhythm could be achieved in this period. In contrast, periodic illumination could entrain the MT release rapidly beginning ED17 (Fig. 4). It seems that the intracellular mechanisms required for the synchronization and entrainment of the pineal oscillators become mature by ED17. The main engine of the circadian oscillators is based on a coordinated interplay of specific transcription factors, the clock genes. Among the clock gene mRNAs, up till now only Per2 was found in the embryonic chicken pineal gland (Okabayashi et al., 2003). In our experiments, Cry1, Cry2, Clock and Bmal2 were shown to be expressed in the pineal gland of chicken as early as on ED15 in vivo (Fig. 5). Comparing these data to those seen on Fig. 2 supports our idea that in this period of embryonic age (ED13-16) the oscillator units controlling MT release might be functioning but the clock elements have not yet been synchronized. On ED 18, the changes in mRNA of the key clock component Cry1 in the pineal gland of chicken shows clear circadian pattern in vivo under normal light/dark conditions. (Fig. 6). The results are similar to those of 6-week-old animals; peak mRNA content was detected approximately at the same time (maxima: between 17:00 and 20:00). Per2 expression showed similar pattern on ED 18 in the chicken pineal gland (Okabayashi et al., 2003). These data support the suggestion that unlike in the mammalian SCN, a functional and synchronized oscillator is present in the pineal clock of chicken embryos (ED 18).These data are consistent with our superfusion data including that the
2.5 2.0 1.5 1.0 0.5 0.0 8:00
12:00
16:00
20:00
0:00
4:00
8:00
12:00
16:00
20:00
Fig. 6. Circadian rhythm of Cry1 expression in the embryonic chicken pineal gland (ED18–19) using semi-quantitative RT-PCR. The eggs were exposed to normal light-dark cycle. The samples were collected for two days in 4 h intervals. Densities of the clock gene cDNA spots relative to that of the b-actin as an internal standard are plotted. Data of similar experiments on 6-week-old chicken are also plotted. Mean and SEM. values of 3–5 parallel samples are shown in each time point. The phase and shape of curves of the ED18 (s) and 6-week-old (h) chicken are similar.
V.J. Csernus et al. / General and Comparative Endocrinology 152 (2007) 148–153
embryonic chicken pineal gland releases MT in a circadian manner if periodic environmental signals synchronizes it. Several studies demonstrated the effects of different bioactive compounds on the embryonic MT secretion from the chicken pineals (Mackova et al., 1998; Faluhelyi et al., 2005a). It was found that pituitary adenylate cyclase activating polypeptide (PACAP) and vasoactive intestinal peptide (VIP) stimulate cAMP production and MT release from chicken pineal gland by ED13 but none of them influenced the development of the circadian MT rhythm (Faluhelyi et al., 2005a,b). Embryonic treatment with the PACAP antagonist PACAP6-38 has been shown to cause transient changes in behavior, and inhibition of olfactory memory formation in chicken (Hollosy et al., 2004; Jozsa et al., 2005) but failed to modify the development of the pineal circadian rhythm (Faluhelyi et al., 2005b). In contrast to light, the phase of the MT rhythm after ED17 could not be altered by periodic PACAP or VIP stimulations (Faluhelyi et al., 2005a,b). Although these peptides play key roles in the development of neural tissues, they have no major effects on the development of the circadian oscillator within the chicken pineal gland. These results suggest that environmental signals, such as light, are necessary for the evolvement of the synchronized MT rhythm in the chicken pineal gland. Acknowledgments The authors thank Beatrix Bruma´n and Tu¨nde Mercz for the excellent technical assistance. This work was supported by the Hungarian National Science Research Fund (OTKA 034491), The Hungarian Medical Research Council (ETT 635/2003) and the Hungarian Academy of Sciences. References Akasaka, K., Nasu, T., Katayama, T., Murakami, N., 1995. Development of regulation of melatonin release in pineal cells in chick embryo. Brain. Res. 692, 283–286. Araki, M., Fukada, Y., Shichida, Y., Yoshizawa, T., Tokunaga, F., 1992. Differentiation of both rod and cone types of photoreceptors in the in vivo and in vitro developing pineal glands of the quail. Brain Res. Dev. Brain Res. 65, 85–92. Binkley, S.A., Riebman, J.B., Reilly, K.B., 1978. The pineal gland. A biological clock in vitro. Science 202, 1198–1200.
153
Csernus, V., Faluhelyi, N., Nagy, A.D., 2005. Features of the circadian clock in the avian pineal gland. Ann. N.Y. Acad. Sci. 1040, 281–287. Csernus, V., Ghosh, M., Mess, B., 1998. Development and control of the circadian pacemaker for melatonin release in the chicken pineal gland. Gen. Comp. Endocrinol. 110, 19–28. Csernus, V.J., Schally, A.V., 1991. The dispersed cell superfusion system. In: Neuroendocrine Research Methods. Harwood Academic Publishers, London, pp. 71–109. Faluhelyi, N., Reglodi, D., Csernus, V., 2005a. Development of the circadian melatonin rhythm and its responsiveness to PACAP in the embryonic chicken pineal gland. Ann. N.Y. Acad. Sci. 1040, 305–309. Faluhelyi, N., Reglodi, D., Csernus, V., 2005b. The effects of PACAP and VIP on the in vitro melatonin secretion from the embryonic chicken pineal gland. Ann. N.Y. Acad. Sci. 1070, 271–275. Faluhelyi, N., Reglodi, D., Lengvari, I., Csernus, V., 2004. Development of the circadian melatonin rhythm and the effect of PACAP on melatonin release in the embryonic chicken pineal gland. An in vitro study. Regul. Pept. 123, 23–28. Hollosy, T., Jozsa, R., Jakab, B., Nemeth, J., Lengvari, I., Reglodi, D., 2004. Effects of in ovo treatment with PACAP antagonist on general activity, motor and social behavior of chickens. Regul. Pept. 123, 99–106. Jozsa, R., Hollosy, T., Tamas, A., Toth, G., Lengvari, I., Reglodi, D., 2005. Pituitary adenylate cyclase activating polypeptide plays a role in olfactory memory formation in chicken. Peptides 26, 2344–2350. Lamosova, D., Zeman, M., Mackova, M., Gwinner, E., 1995. Development of rhythmic melatonin synthesis in cultured pineal glands and pineal cells isolated from chick embryo. Experientia 51, 970–975. Mackova, M., Lamosova, D., Zeman, M., 1998. Regulation of rhythmic melatonin production in pineal cells of chick embryo by cyclic AMP. Cell. Mol. Life. Sci. 54, 461–466. Moller, W., Moller, G., 1990. Structural and functional differentiation of the embryonic chick pineal organ in vivo and in vitro. A scanning electron-microscopic and radioimmunoassay study. Cell. Tissue. Res. 260, 337–348. Okabayashi, N., Yasuo, S., Watanabe, M., Namikawa, T., Ebihara, S., Yoshimura, T., 2003. Ontogeny of circadian clock gene expression in the pineal and the suprachiasmatic nucleus of chick embryo. Brain. Res. 990, 231–234. Rekasi, Z., Csernus, V., Horvath, J., Vigh, S., Mess, B., 1991. Long-term dynamic in vitro system for investigating rat pineal melatonin secretion. J. Neuroendocrinol. 3, 563–568. Takahashi, J.S., Hamm, H., Menaker, M., 1980. Circadian rhythms of melatonin release from individual superfused chicken pineal glands in vitro. Proc. Natl. Acad. Sci. U.S.A 77, 2319–2322. Yamao, M., Araki, M., Okano, T., Fukada, Y., Oishi, T., 1999. Differentiation of pinopsin-immunoreactive cells in the developing quail pineal organ: an in-vivo and in-vitro immunohistochemical study. Cell Tissue Res. 296, 667–671. Zeman, M., Gwinner, E., Herichova, I., Lamosova, D., Kostal, L., 1999. Perinatal development of circadian melatonin production in domestic chicks. J. Pineal. Res. 26, 28–34. Zeman, M., Gwinner, E., Somogyiova, E., 1992. Development of melatonin rhythm in the pineal gland and eyes of chick embryo. Experientia 48, 765–768.
Development of the rhythmic melatonin secretion in the embryonic chicken pineal gland Vale´r J. Csernus *, Andra´s D. Nagy, Na´ndor Faluhelyi Department of Anatomy, Medical School, University of Pe´cs, and Neurohumoral Regulations Research Group of the Hungarian Academy of Sciences, Pe´cs, Hungary Received 15 September 2006; revised 3 January 2007; accepted 19 January 2007 Available online 25 January 2007
Abstract In order to elucidate details on the development of the circadian clock, the effects of light on the in vitro melatonin (MT) release and the presence of mRNAs of several clock genes in the embryonic chicken pineal gland were investigated. Chicken embryos of various developmental stages were exposed to stimuli of light in vitro in dynamic, four day long bioassay (perifusion). MT secretion and mRNA levels of Cry1, Cry2, Clock and Bmal2 clock genes were determined. Our conclusions: (1) environmental illumination modified MT secretion from explanted embryonic pineal glands as early as on the 13th embryonic day, (2) daily rhythm of MT release develops between embryonic days 16 and 18 under periodic environmental illumination. (3) Chicken Cry1, Cry2, Clock and Bmal2 clock gene mRNAs were also detected in glands of animals of 15th embryonic day. Although both MT secretion and clock genes have been developed by then, the circadian MT rhythm appears first on the 17th embryonic day. Either the mechanisms coupling the clock with the melatonin output or the synchronization of the individual pinealocytes develop around this age. Rhythmic MT release in the embryonic chicken pineal gland evolves only if the egg is exposed to rhythmic environmental stimuli. Ó 2007 Elsevier Inc. All rights reserved. Keywords: Circadian; In vitro; Perifusion; Ontogeny; Light; Clock genes; Cry1
1. Introduction In contrast to mammals, the avian pineal gland secretes melatonin (MT) in a circadian manner during embryonic life (Zeman et al., 1992). The factors that participate in the emergence of the MT rhythm, however, remain to be clarified. Environmental light even in vitro controls the circadian MT rhythm of the adult chicken pineals (Binkley et al., 1978; Takahashi et al., 1980; Csernus et al., 1998). Rhythmic MT secretion from chicken pineal gland can also be modified by changes in the environmental temperature and the magnetic field in vitro (Csernus et al., 2005). MT was detected first in the chicken embryo on the 10th day of embryonic life (ED10) (Moller and Moller, 1990). An increased nighttime MT content was found in pineal
*
Corresponding author. Fax: +36 72 536393. E-mail address: [email protected] (V.J. Csernus).
0016-6480/$ - see front matter Ó 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.ygcen.2007.01.008
glands of ED18–19 chicken embryos in vivo (Zeman et al., 1992, 1999) and in ED13–18 chickens in vitro kept under a 12:12 light:dark (LD) cycle (Akasaka et al., 1995; Lamosova et al., 1995). Chicken pineal gland explanted on ED13 showed variable MT release in vitro indicating that oscillator units controlling the MT release might be functional at this time, but have not been synchronized yet (Faluhelyi et al., 2004). In contrast, chicken pineal gland, explanted on ED18, secreted MT in a clear circadian manner even under constant darkness (Faluhelyi et al., 2004). These data show that circadian oscillator units, connected to the MT synthesizing machinery, are not only present but are already synchronized to the environment in the embryonic life in the chicken. Environmental factors influence maturation of the pineal functions by targeting components of the intracellular oscillator. Clock genes play key roles in establishing circadian oscillations within the cells. In the pineal gland of the chicken embryo, rhythmic expression of Per2 clock gene
V.J. Csernus et al. / General and Comparative Endocrinology 152 (2007) 148–153
was shown on ED18 (Okabayashi et al., 2003). However, no evidence has been published on the involvement of other well known clock components, i.e. Clock, Bmal and Cryptochrome genes in the development of circadian oscillators of birds. The aim of this study was to collect more information on the development of the circadian oscillator and on the effects of environment on this process in the chicken pineal gland. In vitro MT secretion from the embryonic chicken pineal gland was monitored under reversed illumination. Furthermore, expression of clock genes was investigated in the pineal gland of embryonic chickens. 2. Materials and methods 2.1. Animals and housing conditions Fertilized eggs of domestic chicken were obtained from a local hatchery (Mohacs, Hungary) and were incubated under constant darkness at 37.5 °C, with a relative humidity of 60%. Pineal glands of chicken embryos of embryonic days 13, 15 and 17 (ED13, ED15 and ED17) were collected. Animal housing, care and application of experimental procedures were carried out in accordance with institutional guidelines under approved protocols (No: BA02/2000–31/2001, University of Pe´cs).
2.2. Perifusion system Perifusion technique was used as previously described (Csernus and Schally, 1991; Rekasi et al., 1991). Briefly, fragments of two to five chicken pineal glands were mixed with Sephadex G-10 (Sigma) and distributed into two glass columns. A Medium 199 (Sigma) based tissue culture medium, equilibrated with a mixture of 95% air and 5% carbon dioxide was passed through the columns at a flow rate of 0.1 ml/min, under 37 °C. Samples (180, in each experiment) were collected at 30 min intervals. To ensure complete darkness during the dark periods (D), the perifusion system was placed in a dark room. During the light periods of the experiments (L), the columns were exposed to light of incandescent light bulbs. The light intensity was measured with a L666417 (Extech Instr.) lux-meter.
2.3. Perifusion data analysis Each figure shows data from one of 3–4 similarly designed experiments which resulted in virtually identical graphs. The results of RIA of duplicate samples were processed with the aid of a computer program, written in our laboratory. Perifusion results were analyzed by our computer program (for principles see: Csernus and Schally, 1991).
2.4. Melatonin assay Melatonin concentration of the collected perifusion fluid fractions was determined using a radioimmunoassay (RIA) developed in our laboratory (Rekasi et al., 1991). Briefly: To each assay tube, 200 ll of sample (in duplicates), the MT-antibody (7 nl/tube, at a final dilution of 1/100,000) and 10,000 cpm (125 fmol) tracer (/O-methyl-3H/melatonin, Amersham, TRK 798) were added to the assay buffer (0.5 M phosphate-buffered saline containing 1 g/L sodium azide and 1 g/L gelatine) in a total of 700 ll. For standard curve (ranging 8.6–30 fmol/tube), a nine-step series of 1:2 dilutions from MT was used in triplicate. Following an overnight incubation at 4 °C, 250 ll of ice-cold saturated dextran coated charcoal (Sigma, C5260) was added to each tube. After 20 min, during which time the tubes were mixed twice, the samples were centrifuged (20 min at 3000g, 4 °C). The supernatants were transferred into scintillation vials. One ml dioxane and 5 ml liquid scintillation cocktail (4.3 g PPO and 42 mg POPOP in 1 L toluene) were added and the radioactivity was counted in a b scintillation
149
counter (Beckman, LS-100C) for 10 min. The assay sensitivity was 80 pmol/L. The intra- and interassay coefficients of variation were 5–6 and 7–8%, respectively.
2.5. Semi-quantitative RT-PCR Total RNA was extracted from pineal glands with Sigma’s TRI Reagent following the manufacturer’s protocol. Using 200 ng pineal RNA, one-step RT-PCR was performed with 5 U MMLV Reverse Transcriptase (Applied Biosystems) and 0.2 U RedTaq DNA polymerase (Sigma). After 15 min of incubation at 42 °C and denaturation for 5 min at 94 °C, the reaction was run for 26 cycles (94 °C for 30 s, 60 °C for 30 s then at 72 °C for 1 min). The primers for chicken Clock, Bmal2, Per1, Cry1 and Cry2 mRNAs, were designed earlier in our laboratory and have been published (Csernus et al., 2005). To use a 500 bp fragment of the chicken b-actin mRNA for internal standard, GATGGACTCTGGTGATGGTG and AGGGCTGTGATCTCCTTCTG primer pairs were applied. Products were separated with 3 mm thin, 2% agarose mini-gels (in TAE buffer), which were post-stained with SYBR Green I (Sigma) and trans-illuminated with blue light (Dark Reader, Clare Chemical Ltd., USA). Cry1 expression level was determined by dividing the mean band intensity (measured with Image-J software, NIH) of Cry1 by that of the b-actin. Significant differences between groups were determined with ANOVA followed by Student’s t-test (p < 0.05).
3. Results 3.1. The effects of the environment on the rhythmic MT release form the embryonic chicken pineal gland Fertilized chicken eggs were incubated using standard procedure. The eggs were turned once a day around 7:00. On ED18, the pineal glands of the chickens were explanted to the perifusion system. Regular daily rhythm of the in vitro MT secretion resulted in morning peaks (Fig. 1). In a similar experiment, the eggs were turned every 2 h and the incubator was carefully light-protected. The pineal glands were explanted on ED16. The MT secretion did not show rhythmic changes; only episodic alterations in the MT level were observed (Fig. 2). 3.2. The effects of in vitro illumination on the rhythmic MT release form the embryonic chicken pineal gland After incubation under constant conditions (with egg turnings in every 2 h), the pineal glands were explanted on ED13. During a 5 day perifusion experiment, the tissues were illuminated daily for 8 h (between 20:00 and 4:00) with a 600 lux light. Melatonin secretion was irregular and the illumination slightly compressed the hormone production (Fig. 3). Perifused ED17–20 pineals, after similar incubation, secreted MT in a clear circadian manner. This rhythm could be rapidly inverted using reversed illumination (Fig. 4). The peaks appeared around 13.00. 3.3. The expression of the clock genes in the embryonic chicken pineal gland Fertilized eggs were incubated under standard condition. The eggs were exposed to dim light during the
150
V.J. Csernus et al. / General and Comparative Endocrinology 152 (2007) 148–153
Melatonin (nmol/l)
6
4
2
0 0:00
12:00
0:00
12:00
0:00
12:00
hours
Fig. 1. In vitro melatonin (MT) release from chicken pineal gland, explanted on embryonic day 18 (ED18). During the incubation, the eggs were turned once a day around 7 AM. The perifusion experiment was run in total darkness. The columns represent MT content of consecutive 30 min fractions. The MT was secreted in a clear circadian manner with the peak around 7 AM.
5
Melatonin (nmol/l)
4
3
2
1
0 0:00
12:00
0:00
12:00
0:00
12:00
0:00
hours Fig. 2. In vitro melatonin (MT) release from embryonic chicken pineal gland explanted on ED16. During the incubation, the eggs were turned every 2 h. The other parameters and the structure of the figure are similar to those in Fig. 1. High level of MT release was experienced showing apparently random alterations.
daytime. From total RNA extracts of the pineal glands of ED15 chickens RT-PCR was performed (Fig. 5). Spots of Clock, Bmal2, Cry1 and Cry2 cDNA were detected in the expected molecular weight range. No Per1 was found in similar experiments (data not shown). Chicken embryos kept under similar condition were sacrificed beginning ED18 in a two day period in 4 h intervals. For determination of Cry1-mRNA levels, RT-PCR experiments were performed from the pineal extracts. In each sample the level of b-actin-mRNA was also determined as internal standard. The densities of the clock gene cDNA
spots were compared to the b-actin-cDNA spot in the same sample. Clear circadian rhythm in the Cry1 expression was found. The shape and the phase of the curve were similar to that obtained from 6-week-old chicken in similar experiments (Fig. 6). 4. Discussion The pineal gland plays a key role in controlling the circadian rhythmic activities in most vertebrate species through MT release. In mammals, pineal MT release is
V.J. Csernus et al. / General and Comparative Endocrinology 152 (2007) 148–153
151
0.3
Melatonin (nmol/l)
0.25
0.2
0.15
0.1
0.05
0 0:00
12:00
0:00
12:00
0:00
12:00
0:00
hours Fig. 3. In vitro melatonin (MT) release from embryonic chicken pineal gland explanted on ED13. The perifusion columns were illuminated with a 600 lux light daily from 20:00 to 04:00. White columns represent the illumination periods. The other parameters and the structure of the figure are similar to those in Fig. 1. Periodic illumination did not synchronize the apparently random MT release. During the illumination a tendency to decrease the MT release is seen.
5
Melatonin (nmol/l)
4
3
2
1
0 0:00
12:00
0:00
12:00
0:00
12:00
0:00
hours Fig. 4. In vitro melatonin (MT) release from embryonic chicken pineal gland explanted on ED17. The perifusion columns were illuminated with a 600 lux light daily from 20:00 to 04:00 (white columns). The other parameters and the structure of the figure are similar to those in the previous figures. The circadian rhythm of the MT secretion reverses rapidly following the phase of the illumination.
controlled by the circadian pacemaker in the suprachiasmatic nucleus via the sympathetic nervous system. In contrast, the pineal gland of most non-mammalian vertebrates includes a fully functional circadian clock and possesses direct light sensitivity (Binkley et al., 1978). These features render the pineal gland of these species a complete circadian pacemaker that works without, or interplays with the circadian clock in the suprachiasmatic nucleus. Investigating the mechanisms and development of the circadian clock in the non-mammalian pineal gland provides a tractable model for the study of circadian events.
MT in the chicken pineal gland was detected as early as on ED10 (Moller and Moller, 1990). From ED13, MT production of the explanted chicken pineal glands change episodically but no regular rhythm is detected (Faluhelyi et al., 2004). These data might indicate that the oscillator units controlling the MT release might be functional by this time, but the individual clock units have not been synchronized yet. Based on perifusion studies, circadian rhythm in MT secretion appears first between ED16 and ED18 (Faluhelyi et al., 2004). By this time not only the cellular mechanisms, responsible for the synchronization of the
152
V.J. Csernus et al. / General and Comparative Endocrinology 152 (2007) 148–153
Clock
Bmal2
Cry1
Cry2
1000 bp
400 bp 300 bp 200 bp 150 bp
Fig. 5. Expression of clock genes in the embryonic chicken pineal gland. The gel photo shows bands of RT-PCR products of Clock, Bmal2, Cry1 and Cry2 mRNAs extracted from chicken pineal glands at the age of ED15.
Chicken Cry1/ß-actin mRNA rel. density
oscillator units, seem to be mature, but also circadian signals from the environment reach this system. In birds, various circadian environmental signals might affect the chick during incubation and synchronize its circadian clock before hatching. The stimuli might be rhythmic mechanical, temperature or light stimuli. During the standard artificial incubation procedure, daily egg turning or daily changes of illumination might be such factors. If the eggs are handled under continuous darkness and constant temperature, and the egg-turnings were carried out in 2 h intervals, the hormone production of the pineals did not become rhythmic between ED15 and ED18 (Fig. 2.). Based upon data from similar experiments on chicken pineal gland explanted on various embryonic days (data not shown), it is concluded that no circadian rhythm develops until hatching when no environmental signal of circadian type affects the egg. These data suggest that rhythmic environmental signals are required for maturation of the circadian pacemaker in the avian pineal gland. Our observation, that MT rhythms are not evolved in the pineal glands in vitro when experiments are carried out in constant darkness, is consistent with this suggestion.
Immunoreactivity of pinopsin, the photopigment of the pineal gland, was detected as early as on ED8 in quail (Yamao et al., 1999). In the same species, rod and cone type of photoreceptors seem to be mature by ED13 (Araki et al., 1992) suggesting that the pineal gland might be light sensitive by then. In our experiments, periodic illumination temporarily suppressed the in vitro MT release from the chicken pineal gland on and after ED13 (Fig. 3). These data indicate that the photoreceptors in the embryonic chicken pineal gland are functioning. Although the illumination was applied in a rhythmic circadian manner no synchronization of the MT rhythm could be achieved in this period. In contrast, periodic illumination could entrain the MT release rapidly beginning ED17 (Fig. 4). It seems that the intracellular mechanisms required for the synchronization and entrainment of the pineal oscillators become mature by ED17. The main engine of the circadian oscillators is based on a coordinated interplay of specific transcription factors, the clock genes. Among the clock gene mRNAs, up till now only Per2 was found in the embryonic chicken pineal gland (Okabayashi et al., 2003). In our experiments, Cry1, Cry2, Clock and Bmal2 were shown to be expressed in the pineal gland of chicken as early as on ED15 in vivo (Fig. 5). Comparing these data to those seen on Fig. 2 supports our idea that in this period of embryonic age (ED13-16) the oscillator units controlling MT release might be functioning but the clock elements have not yet been synchronized. On ED 18, the changes in mRNA of the key clock component Cry1 in the pineal gland of chicken shows clear circadian pattern in vivo under normal light/dark conditions. (Fig. 6). The results are similar to those of 6-week-old animals; peak mRNA content was detected approximately at the same time (maxima: between 17:00 and 20:00). Per2 expression showed similar pattern on ED 18 in the chicken pineal gland (Okabayashi et al., 2003). These data support the suggestion that unlike in the mammalian SCN, a functional and synchronized oscillator is present in the pineal clock of chicken embryos (ED 18).These data are consistent with our superfusion data including that the
2.5 2.0 1.5 1.0 0.5 0.0 8:00
12:00
16:00
20:00
0:00
4:00
8:00
12:00
16:00
20:00
Fig. 6. Circadian rhythm of Cry1 expression in the embryonic chicken pineal gland (ED18–19) using semi-quantitative RT-PCR. The eggs were exposed to normal light-dark cycle. The samples were collected for two days in 4 h intervals. Densities of the clock gene cDNA spots relative to that of the b-actin as an internal standard are plotted. Data of similar experiments on 6-week-old chicken are also plotted. Mean and SEM. values of 3–5 parallel samples are shown in each time point. The phase and shape of curves of the ED18 (s) and 6-week-old (h) chicken are similar.
V.J. Csernus et al. / General and Comparative Endocrinology 152 (2007) 148–153
embryonic chicken pineal gland releases MT in a circadian manner if periodic environmental signals synchronizes it. Several studies demonstrated the effects of different bioactive compounds on the embryonic MT secretion from the chicken pineals (Mackova et al., 1998; Faluhelyi et al., 2005a). It was found that pituitary adenylate cyclase activating polypeptide (PACAP) and vasoactive intestinal peptide (VIP) stimulate cAMP production and MT release from chicken pineal gland by ED13 but none of them influenced the development of the circadian MT rhythm (Faluhelyi et al., 2005a,b). Embryonic treatment with the PACAP antagonist PACAP6-38 has been shown to cause transient changes in behavior, and inhibition of olfactory memory formation in chicken (Hollosy et al., 2004; Jozsa et al., 2005) but failed to modify the development of the pineal circadian rhythm (Faluhelyi et al., 2005b). In contrast to light, the phase of the MT rhythm after ED17 could not be altered by periodic PACAP or VIP stimulations (Faluhelyi et al., 2005a,b). Although these peptides play key roles in the development of neural tissues, they have no major effects on the development of the circadian oscillator within the chicken pineal gland. These results suggest that environmental signals, such as light, are necessary for the evolvement of the synchronized MT rhythm in the chicken pineal gland. Acknowledgments The authors thank Beatrix Bruma´n and Tu¨nde Mercz for the excellent technical assistance. This work was supported by the Hungarian National Science Research Fund (OTKA 034491), The Hungarian Medical Research Council (ETT 635/2003) and the Hungarian Academy of Sciences. References Akasaka, K., Nasu, T., Katayama, T., Murakami, N., 1995. Development of regulation of melatonin release in pineal cells in chick embryo. Brain. Res. 692, 283–286. Araki, M., Fukada, Y., Shichida, Y., Yoshizawa, T., Tokunaga, F., 1992. Differentiation of both rod and cone types of photoreceptors in the in vivo and in vitro developing pineal glands of the quail. Brain Res. Dev. Brain Res. 65, 85–92. Binkley, S.A., Riebman, J.B., Reilly, K.B., 1978. The pineal gland. A biological clock in vitro. Science 202, 1198–1200.
153
Csernus, V., Faluhelyi, N., Nagy, A.D., 2005. Features of the circadian clock in the avian pineal gland. Ann. N.Y. Acad. Sci. 1040, 281–287. Csernus, V., Ghosh, M., Mess, B., 1998. Development and control of the circadian pacemaker for melatonin release in the chicken pineal gland. Gen. Comp. Endocrinol. 110, 19–28. Csernus, V.J., Schally, A.V., 1991. The dispersed cell superfusion system. In: Neuroendocrine Research Methods. Harwood Academic Publishers, London, pp. 71–109. Faluhelyi, N., Reglodi, D., Csernus, V., 2005a. Development of the circadian melatonin rhythm and its responsiveness to PACAP in the embryonic chicken pineal gland. Ann. N.Y. Acad. Sci. 1040, 305–309. Faluhelyi, N., Reglodi, D., Csernus, V., 2005b. The effects of PACAP and VIP on the in vitro melatonin secretion from the embryonic chicken pineal gland. Ann. N.Y. Acad. Sci. 1070, 271–275. Faluhelyi, N., Reglodi, D., Lengvari, I., Csernus, V., 2004. Development of the circadian melatonin rhythm and the effect of PACAP on melatonin release in the embryonic chicken pineal gland. An in vitro study. Regul. Pept. 123, 23–28. Hollosy, T., Jozsa, R., Jakab, B., Nemeth, J., Lengvari, I., Reglodi, D., 2004. Effects of in ovo treatment with PACAP antagonist on general activity, motor and social behavior of chickens. Regul. Pept. 123, 99–106. Jozsa, R., Hollosy, T., Tamas, A., Toth, G., Lengvari, I., Reglodi, D., 2005. Pituitary adenylate cyclase activating polypeptide plays a role in olfactory memory formation in chicken. Peptides 26, 2344–2350. Lamosova, D., Zeman, M., Mackova, M., Gwinner, E., 1995. Development of rhythmic melatonin synthesis in cultured pineal glands and pineal cells isolated from chick embryo. Experientia 51, 970–975. Mackova, M., Lamosova, D., Zeman, M., 1998. Regulation of rhythmic melatonin production in pineal cells of chick embryo by cyclic AMP. Cell. Mol. Life. Sci. 54, 461–466. Moller, W., Moller, G., 1990. Structural and functional differentiation of the embryonic chick pineal organ in vivo and in vitro. A scanning electron-microscopic and radioimmunoassay study. Cell. Tissue. Res. 260, 337–348. Okabayashi, N., Yasuo, S., Watanabe, M., Namikawa, T., Ebihara, S., Yoshimura, T., 2003. Ontogeny of circadian clock gene expression in the pineal and the suprachiasmatic nucleus of chick embryo. Brain. Res. 990, 231–234. Rekasi, Z., Csernus, V., Horvath, J., Vigh, S., Mess, B., 1991. Long-term dynamic in vitro system for investigating rat pineal melatonin secretion. J. Neuroendocrinol. 3, 563–568. Takahashi, J.S., Hamm, H., Menaker, M., 1980. Circadian rhythms of melatonin release from individual superfused chicken pineal glands in vitro. Proc. Natl. Acad. Sci. U.S.A 77, 2319–2322. Yamao, M., Araki, M., Okano, T., Fukada, Y., Oishi, T., 1999. Differentiation of pinopsin-immunoreactive cells in the developing quail pineal organ: an in-vivo and in-vitro immunohistochemical study. Cell Tissue Res. 296, 667–671. Zeman, M., Gwinner, E., Herichova, I., Lamosova, D., Kostal, L., 1999. Perinatal development of circadian melatonin production in domestic chicks. J. Pineal. Res. 26, 28–34. Zeman, M., Gwinner, E., Somogyiova, E., 1992. Development of melatonin rhythm in the pineal gland and eyes of chick embryo. Experientia 48, 765–768.