- Email: [email protected]
Developmental and genetic toxicity of stannous chloride in mouse dams and fetuses
Mutation Research 657 (2008) 105–110
Contents lists available at ScienceDirect
Mutation Research/Genetic Toxicology and Environmental Mutagenesis journal homepage: www.elsevier.com/locate/gentox Community address: www.elsevier.com/locate/mutres
Developmental and genetic toxicity of stannous chloride in mouse dams and fetuses Aida I. El-Makawy ∗ , Shenouda M. Girgis, Wagdy K.B. Khalil Cell Biology Department, National Research Center, 12622 Dokki, Cairo, Egypt
a r t i c l e
i n f o
Article history: Received 6 May 2008 Received in revised form 9 July 2008 Accepted 4 August 2008 Available online 22 August 2008 Keywords: Stannous chloride Teratogenicity Genotoxicity RT-PCR Chromosome aberrations Mice
a b s t r a c t Humans are exposed to stannous chloride (SnCl2 ) present in packaged food, soft drinks, biocides, dentifrices, etc. Health effects in children exposed to tin and tin compounds have not been investigated yet. Therefore, we evaluated the possible teratogenic and genotoxic effects of SnCl2 in pregnant female mice and their fetuses. Teratogenic effects including morphological malformation of the fetus and its skeleton were observed. Exposures to environmental stressors including toxic chemicals that have the potential of modulating the immune system can often be linked to ecologically relevant endpoints, such as reduced resistance to disease. Therefore, the semi-quantitative reverse-transcription PCR (RT-PCR) assay was used to evaluate the expression of immune-response genes in the liver of SnCl2 -treated dams and their fetuses. Bone-marrow cells of dams and fetuses were investigated for the presence of aberrant chromosomes. Three oral doses of SnCl2 (2, 10 and 20 mg/kg bw) were tested. The results of the teratological study show that SnCl2 induced a significant decrease in the number of living fetuses and a significant increase in the number of post-implantation losses. The high dose of SnCl2 induced complete post-implantation loss. Furthermore, SnCl2 caused reduction in the ossification of the fetal skeleton. The RT-PCR assay showed that the immune-response genes GARP and SIMP were not expressed in the liver of dams and fetuses in the controls or in the group treated with SnCl2 at 2 mg/kg bw. However, the expression of these genes was up-regulated in the groups treated with the other doses of SnCl2 . Regarding the chromosome analysis, SnCl2 induced a dose-dependent increase in the frequency of individual and total chromosomal aberrations (P ≤ 0.01) in bone-marrow cells of dams. In fetal cells, the 2-mg/kg bw dose of SnCl2 caused a non-significant increase in the total chromosomal aberrations, but the 10-mg/kg bw dose significantly increased the total number of chromosomal aberrations (P ≤ 0.01) compared with the control group. © 2008 Elsevier B.V. All rights reserved.
1. Introduction Tin is a natural element in the earth’s crust. Tin metal is used to line cans for food, beverages, and aerosols. It can combine with chemicals like chlorine, sulfur, or oxygen to form inorganic tin compounds (i.e., stannous chloride, stannous sulfide, stannic oxide). These compounds are used in toothpaste, perfumes, soaps, food additives and dyes. Tin can also combine with carbon to form organotin compounds (i.e., dibutyltin, tributyltin, triphenyltin), which are used to make plastics, food packages, plastic pipes, pesticides, paints, and pest repellents [1]. Inorganic tin compounds are used as pigments in the ceramic and textile industry [2]. In addition, stannous chloride, SnCl2 , is widely used in daily human life to conserve soft drinks, in food manufacturing, processing and packaging, and in biocidal preparations. In nuclear medicine, SnCl2 is used
∗ Corresponding author. Tel.: +20 2 3371433; fax: +20 2 337 0931. E-mail address: [email protected] (A.I. El-Makawy). 1383-5718/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.mrgentox.2008.08.007
as a reducing agent of Technetium-99 m (as sodium pertechnetate), a radionuclide used to label different cells and molecules [3]. As result of the use of tinplate for packaging of food and beverages, there is a probability that traces of tin dissolve in the food content [4]. According to Food and Agriculture Organization and the World Health Organization (UN-FAO/UN-WHO), the maximum limit for tin in canned foods is 250 mg kg−1 [5], but there is evidence suggesting that consumption of food or beverages containing tin above 200 mg kg−1 has caused gastrointestinal effects [6]. Moreover, when the contamination reaches this level the organoleptic properties of the food can be seriously affected. The biological effects of SnCl2 include stimulation followed by depression of the central nervous system in laboratory animals [6]. Early reports showed toxicity of tin chloride in rats, i.e. pathological changes in liver and kidney, brain edema, pancreatic atrophy, increased incidence of changes in fatty acids and vacuoles in the proximal convoluted tubules [7]. There are only few reports regarding the possible genotoxicity of tin compounds. Inorganic tin increased the frequency of chromosomal aberrations, sister chromatid exchange,
106
A.I. El-Makawy et al. / Mutation Research 657 (2008) 105–110
Table 1 Reproductive findings of pregnant mice treated with stannous chloride Treatment (mg/kg day−1 of SnCl2 )
Number of pregnant mice
Number of implantation
Control 2 10 20
10 10 10 10
7.90 9.20 8.70 8.00
± ± ± ±
1.29a 1.55a 1.49a 1.33a
Post-implantation loss 0.30 0.90 3.10 8.00
± ± ± ±
0.48c 1.60c 3.25b 1.33a
Number of live fetuses per litter
Number of fetal death
Fetal body weight (g)
Number of haematoma
7.60 ± 1.43a 8.20 ± 2.10a 5.60 ± 3.47b 0c
0a 0.11 ± 0.33a 0a 0a
1.17 ± 0.05a 0.65 ± 0.06b 0.50 ± 0.13b 0c
1.00 ± 0.30b 2.10 ± 0.50a 0.80 ± 0.47b 0b
Values presented as means ± S.D. Means with different superscript letters (a, b and c) are significantly different (P ≤ 0.05).
and it reduced cell proliferation; it induced rapid and prolonged suppression of DNA synthesis and caused alteration in gene expression, as reported by McLean and Kaplan [8]; Hu [9]; Ganguly et al. [10]; Araújo et al. [11]. In addition, McLean et al. [12] noticed that SnCl2 produced single-strand breaks in DNA of Chinese hamster ovary cells and DNA damage in human white blood cells. However, Kada et al. [13] reported the absence of genotoxicity using the Bacillus subtilis Rec assay test, where SnCl2 induced neither mutation nor mitotic gene-conversion. In addition, no genotoxic effects were found in Drosophila melanogaster with the wing-spot test [14]. Ashby and Tennant [15] described a carcinogenic activity of SnCl2 in the rat thyroid. SnCl2 induced cytotoxicity/genotoxicity in different DNA-repair mutants of Escherichia coli [16,17] and DNA damage was suggested to occur via the formation of oxygen radicals [18]. In addition, SnCl2 caused strand breaks in plasmid DNA in vitro and it was suggested that it could induce this type of DNA lesion in vivo as well [19]. There are no reports of adverse developmental effects in humans exposed to tin or its compounds. In addition, there are no studies that evaluated the developmental effects in animals exposed to inorganic tin. The present work was undertaken to evaluate the possible teratogenic and genotoxic effects of SnCl2 in pregnant female mice and their fetuses, and to confirm suggested mechanisms of interaction with DNA. The teratogenic study included analysis of morphological malformation and aberrations of the fetal skeleton. The semi-quantitative RT-PCR assay was used to evaluate the expression of immune-response genes in the liver of SnCl2 -treated dams and fetuses, as well as chromosome aberrations in bone marrow of the dams and their fetuses were investigated.
tilled water daily by gavage and the other three groups were given different doses of SnCl2 at the levels of 2, 10 and 20 mg/kg body weight (bw) once daily by using sterile water as the vehicle. Selection of the lower dose was based on the provisional tolerable daily intake of tin, since the actual tolerable daily intake of tin chloride in humans is 2 mg/kg bw [20]. During week 3 of the treatment, the females were paired with males in a 2:1 ratio overnight and were examined for the presence of a vaginal plug the following morning. The day a vaginal plug found was designated as day zero of gestation and the treatment was continued throughout the gestation period. 2.3. External examination of fetuses At day 18 of gestation, the pregnant mice were sacrificed by cervical dislocation. The gravid uterine contents were evaluated for numbers of implantation sites, resorptions, late fetal deaths and live fetuses. Uteri from apparently non-pregnant females or from apparent single-horn pregnancies were stained by the method of Salewski [21] to detect early resorption sites. Fetuses were weighed and examined under magnification for gross external malformation. The viability of the fetuses was determined by the presence of spontaneous breathing or responses to tactile stimulation. Findings were classified as variations or malformations, according to currently used nomenclature [22]. 2.4. Preparation of specimens of the fetal skeleton All live fetuses were evaluated for weight, external, visceral, and skeletal abnormalities. The fetuses without external malformations from each litter were chosen for skeletal examinations [23]. Soft tissues, such as, skin, eye, visceral and connective tissue were taken away from the skeleton. Later on, all fetuses were kept in a solution of 95% alcohol to fix tissues. Specimens were placed in a solution of 1% KOH for 2 days. Later on, all specimens were stained with Alizarin red S and kept at 37 ◦ C in a drying oven for 4 days. Then, specimens were treated with solutions of 1% KOH, including 20, 50 and 80% glycerin, sequentially. Glycerin (100%) was used to get the specimens transparent. After staining, all specimens were examined under a stereomicroscope for skeletal malformations and variations [24].
2. Materials and methods
2.5. Semi-quantitative RT-PCR
2.1. Chemical
The RT-PCR assay was conducted to verify the expression of immune-response genes of mice and their embryos after exposure to SnCl2 . The expression of two novel immune genes, encoding proteins such as ‘source of immuno-dominant MHCassociated peptides’ (SIMP) and ‘glycoprotein A repetitions predominant (GARP)’ was investigated, which included the following steps:
Stannous chloride (SnCl2 ·2H2 O, CAS no. 10025-69-1) was purchased from Sigma, St. Louis, MO, USA. The chemical purity was >99% by gas chromatography. 2.2. Animals and experimental design Adult male (body weight, 30–35 g) and virgin female (body weight, 25–30 g) Swiss albino mice were obtained from the Laboratory Animal house of the National Research Center, and maintained in constant-temperature controlled rooms (22 ± 2 ◦ C). Animals received food and water ad libitum and were kept on a 12-h light/12-h dark schedule. After 1 week of acclimatization, male and female mice were randomly assigned to four groups of 15 animals each (10 females and 5 males) according to body weight. Each five animals were housed in groups of the same gender in stainless steel-wire mesh cages. The control group was given dis-
2.5.1. RNA extraction Liver samples were taken from the treated mice and their fetuses. The samples were immediately frozen in liquid nitrogen and stored at −80 ◦ C prior to extraction. Total RNA was isolated from 50 to 100 mg of liver tissue by the standard TRIzol extraction method (Invitrogen, Paisley, UK) and recovered in 100 l molecular biology-grade water. In order to remove any possible genomic DNA contamination, the total RNA samples were pre-treated using the ‘DNA-freeTM DNase treatment and removal reagents kit’ (Ambion, Austin, TX, USA) following the manufacturer’s protocol.
Table 2 Primers and reaction parameters in RT-PCR Target cDNA
Primer name
Primer sequence (5 –3 )
Annealing temperature (◦ C)
PCR product size (bp)
-Actin
Act-F Act-R
CCCCATCGAGCACGGTATTG ATGGCGGGGGTGTTGAAGGTC
57
189
SIMP
SIMP-F SIMP-R
ACCCCAGTCCCAGCGTAGTG ATGTCGTCGCCTGAGTATCCAATC
58
331
GARP
GARP-F GARP-R
CCTTCACGGCAACAACATCC ATCACGCTAATCCACAACAC
54
1656
A.I. El-Makawy et al. / Mutation Research 657 (2008) 105–110 2.5.2. Reverse transcription The complete Poly(A)+ RNA samples isolated from the mice were reversetranscribed into cDNA in a total volume of 20 l using 1 l oligo(dT) primer. The composition of the reaction mixture, termed master mix (MM), consisted of 50 mM MgCl2 , 10× reverse transcription (RT) buffer (50 mM KCl; 10 mM Tris–HCl; pH 8.3; PerkinElmer), 10 mM of each dNTP (Amersham, Brunswick, Germany), and 50 M of oligo (dT) primer. The RT reaction was carried out at 25 ◦ C for 10 min, followed by 1 h at 42 ◦ C, and finished with denaturation step at 99 ◦ C for 5 min. Afterwards the reaction tubes containing RT preparations were flash-cooled in an ice chamber until used for DNA amplification through polymerase chain reaction (PCR) [25]. 2.5.3. Polymerase chain reaction (PCR) The first-strand cDNA from different mouse samples was used as template for RT-PCR with a pair of specific primers. The sequences of the specific primers and the product sizes are listed in Table 2. Beta-actin, a house-keeping gene, was used for normalizing mRNA levels of the target genes. The reaction mixture for RT-PCR consisted of 10 mM dNTP’s, 50 mM MgCl2 , 10× PCR buffer (50 mM KCl; 20 mM Tris–HCl; pH 8.3; Gibco BRL, Eggenstein, Germany) and autoclaved water. The PCR cycling parameters were one cycle of 94 ◦ C for 3 min, 35 cycles of 94 ◦ C for 30 s, 42 ◦ C (GARP gene) to 58 ◦ C (SIMP gene) for 30 s, 72 ◦ C for 90 s, and a final cycle of 72 ◦ C for 7 min. The PCR products were then loaded onto a 2.0% agarose gel, with PCR products derived from -actin of the different mouse samples [26].
107
3.2. Examination of the skeleton The fetal skeletons of both the control and the parentally SnCl2 treated groups were stained with Alizarin red S and examined by use of a dissecting binocular microscope. There was some evidence of treatment-related reduction in the ossification of the fetal skeleton. Skeletal examination of fetuses obtained from mothers of the groups treated with 2 and 10 mg SnCl2 /kg bw showed a significant decrease in the size of the skeletons compared with those in the control group. This decrease in the fetuses’ size was a result of reduced ossification. All bones of the axial (skull and vertebrae) and appendicular (bones of pelvic girdle, fore and hind limbs, bones of digits) skeletons of fetuses parentally treated with SnCl2 showed less ossification than the control. This indicates that SnCl2 did not induce external malformations but increased the incidence of skeletal anomalies, a sign of growth retardation or developmental delay. 3.3. Semi-quantitative RT-PCR
2.6. Cytogenetic analysis 2.6.1. Bone-marrow chromosome preparation Cytogenetic analysis was performed on bone-marrow cells according to the method of Preston et al. [27], with slight modifications. Experimental animals were injected intraperitoneally (i.p.) with colchicine 1.5 h prior to sacrifice. Both femurs were dissected out and cleaned of any adhering muscle tissue. Bone-marrow cells were collected from both the femurs by flushing in KCl and then incubated at 37 ◦ C for 35 min, fixed in methanol-glacial acetic acid (3:1). Centrifugation and fixation (in the cold) were repeated five times at 20-min intervals. The pellet was resuspended in a small volume of the fixative, dropped onto chilled slides, flame-dried, and stained with 10% buffered Giemsa (pH 6.8).
The analysis of the effects of SnCl2 by use of the RT-PCR assay showed that the immune-response genes GARP and SIMP were not expressed in the liver of the dams or their fetuses, in the control group or in the group treated with 2 mg/kg bw of SnCl2 (Fig. 1). However, the expression of GARP and SIMP was up-regulated in the samples from animals initially treated with 10mg/kg bw of SnCl2 (Fig. 1). The activity of the immune-response genes was also high after intake of 20 mg/kg bw of SnCl2 . 3.4. Cytogenetic analysis
2.6.2. Fetal chromosome preparation Chromosomes were prepared from fetuses according to Romagnano et al. [28]. Livers of the fetuses were removed and cleaned of any extraneous tissue. Cleaned liver tissue was placed in a conical centrifuge tube with 2 ml of medium TCM 199. Samples were pipetted several times with a Pasteur pipette to further break-up the tissue and 0.025% colchicine was added. The mixture was incubated for 90 min at 37 ◦ C. The samples were centrifuged for 5 min and then incubated in 2 ml of a prewarmed hypotonic KCl solution (0.56%) for 15 min at 37 ◦ C. Cells were fixed twice in methanol-glacial acetic acid (3:1) and slides were prepared and air-dried. Good-quality metaphases (n = 100) for each animal and fetuses were microscopically examined and different types of chromosome abnormalities were recorded. 2.7. Statistical analysis All data were statistically analysed by one-way analysis of variance (ANOVA) using SPSS for Windows 95. Multiple comparisons were performed by Duncan’s Test. All values reported as means ± S.D. For all experimental data, the significance level was set at P ≤ 0.05, when appropriate.
3. Results 3.1. External malformation of fetuses Table 1 shows the reproductive findings of pregnant mice treated with SnCl2 including the number of implanted fetuses, live fetuses, post-implantation losses, dead fetuses, fetal body weights and the number of haematomas in the control and SnCl2 -treated groups. The data show that administration to the dams of SnCl2 at 2 mg/kg bw induced a non-significant increase in the number of live fetuses and a non-significant increase in the number of post-implantation losses compared with the control. The intake of 10mg/kg bw of SnCl2 induced a significant decrease in the number of live fetuses and a significant increase in the number of postimplantation losses (P ≤ 0.01). Meanwhile, oral administration of SnCl2 at both doses (2 and 10 mg/kg bw) induced a significant decrease in the fetal body weights compared with the control group. In addition, the high dose of SnCl2 (20 mg/kg bw) induced complete post-implantation loss.
The metaphase analysis of the bone marrow and fetus cells revealed various types of structural chromosomal aberrations, which consisted of chromatid and iso-chromatid types of gaps, breaks, fragments, deletions, centric fusions and centromeric attenuations. Numerical chromosomal aberrations resulted in polyploidy and hypoploidy as shown in Tables 3 and 4. Analysis of chromosomal aberrations in bone-marrow cells showed that the treatment with 2 mg/kg bw of SnCl2 induced a non-significant increase in the frequencies of individual and total chromosomal aberrations compared with the control. The other two doses (10 and 20 mg/kg bw) of SnCl2 induced significant increase in the frequencies of both the individual and the total chromosomal aberrations (P ≤ 0.01) when compared with the control. Polyploidy showed a non-significant difference between the control and all treated groups. In the fetal cell preparations, there was non-significant difference between the frequency of chromosomal aberrations induced by the low dose of SnCl2 and that observed in the control. The dose of 10mg/kg bw of SnCl2 induced a significant increase in the frequency of chromosomal aberrations (P ≤ 0.01) compared with the control. 4. Discussion The present study was designed to determine the effects of SnCl2 , administered orally prior and during pregnancy, on mouse dams and their fetuses. Administration of SnCl2 caused a reduction in the rate of successful pregnancies in females that had a positive mating outcome. In females achieving pregnancy, however, SnCl2 had no adverse effect on the numbers of implantations. It is obvious that SnCl2 adversely affects maternal reproductive parameters and survival of offspring, since it significantly increased postimplantation loss and decreased fetal body weights. In addition, decreased fetal body weight was correlated to delayed ossification. Thus, it appears that a high dose of SnCl2 (20 mg/kg bw) causes
108
A.I. El-Makawy et al. / Mutation Research 657 (2008) 105–110
Fig. 1. RT-PCR confirmation of expression of two different immune-response genes in mice and their embryos treated with stannous chloride. Lane 1 represents DNA marker, lanes 2 and 7 represent control samples, lanes 3–5 and 8–10 represent the treated samples with low, medium and high doses of stannous chloride, respectively, and lanes 6 and 11 represent the -actin expression to normalize the treated groups. (A) Agarose gel representing the GARP gene; (B) agarose gel representing the SIMP gene.
pregnancy failure after administration during the very early stages of pregnancy. These results are in agreement with those of Wu [29] who reported that SnCl2 administered to pregnant rats showed teratogenic effects on the early growing embryos. In addition, Yousef [30] showed that treatment with SnCl2 caused reproductive toxicity in male rabbits. Meanwhile, Harazono et al. [31] and Adeeko et al. [32] reported that administration of tributyltin chloride at a high dose during very early pregnancy produced a significant and dose-related reduction in fertility. This was evident from a significant increase in post-implantation loss and a decrease in litter size as well as a decrease in fetal weight, but it did not result in external malformations, or a change in sex ratio. In addition, delayed ossification of the fetal skeleton after in utero exposure to either 10 or 20 mg/kg tributyltin chloride was observed. Assessment of health hazards arising from occupational exposure to toxic chemicals in the environment has already been reported. It is expected that exposure of animals to toxic chemicals would evoke an immune response. In the present study, the expression of the GARP and SIMP genes was up-regulated in samples isolated from animals treated with 10 mg/kg bw of SnCl2 . Furthermore, the activity of the immune-response genes also was high at the dose of 20 mg/kg bw of SnCl2 . Chang et al. [33] found a few protein components of the acute-phase response (APR) in carp in response to parasite infection as part of the innate immune defense. APR was characterized by a change of plasma proteins, which are referred to as acute-phase proteins (APPs), and by the secretion of some other innate defense molecules. Bayne et al. [34] also identified most of these components in the up-regulated gene libraries from livers of infected rainbow trout (Oncoryhnchus mykiss). We suggest that the up-regulated expression of GARP and SIMP genes in mice and their fetuses as confirmed using RT-PCR assay may also indicate that APPs are expressed and susceptible to up-regulation as a result of the SnCl2 treatment.
Concerning the chromosomal analysis, our results clearly indicate a significant dose-dependent increase in the frequencies of chromosomal aberrations in both dams and fetuses. These results are in accordance with those of Olivier and Marzin [35] who described a mutagenic action of SnCl2 using the SOS chromotest. Positive responses with SnCl2 for chromosomal aberrations, sister chromatid exchange (SCE), reduced cell proliferation, rapid and prolonged suppression of DNA synthesis and alteration in gene expression in Chinese hamster ovary (CHO) cells were also observed [8–11,36–38]. In addition, McLean et al. [12] noticed that SnCl2 produced single-strand breaks in DNA of Chinese hamster ovary cells and caused DNA damage in human white blood cells. This may be due to an interaction between genomic material and SnCl2 , which suggests its putative genotoxicity. SnCl2 produced extensive DNA damage, detected as single-strand DNA breaks in Chinese hamster cells [12], in the K562 cell line [39,40], and in the supF gene of E. coli [18,41,42]. These findings confirm that SnCl2 is an effective mutagenic substance with a powerful damaging effect through oxygen radical formation or by a Fenton-like reaction that generates + OH radicals. In addition, it was found that reactive oxygen species such as + OH were generated close to the site of the lesions due to a possible complex formation of the stannous ion with DNA [20]. ElDemerdash et al. [43] confirmed the previous interpretation when they showed that SnCl2 significantly induced free radicals in rabbit liver, testes, kidney, lung, brain and heart, whereas the activities of glutathione S-transferase (GST) and the level of sulfhydryl groups (SH-group) were decreased (P < 0.05) in all tested organs except brain and heart. The proposed carcinogenic mechanisms by which Sn exerts significant impact are the following: DNA methylation, DNA oxidation, lipid peroxidation to form reactive intermediates and DNA adducts, alterations of deoxynucleotide pool sizes, and alterations in DNA-repair processes [44]. In conclusion, our results clearly indicate a significant dosedependent increase of developmental and genetic toxicity due to exposure to stannous chloride given by oral administration to
Table 3 Frequencies of chromosome aberrations induced in bone-marrow cells of pregnant mice treated with stannous chloride by oral gavage Treatment (mg/(kg day of SnCl2 ))
Number of examined dams
Chromosomal aberrations Chromatid gap 0.80c ± 0.42 0.90c ± 0.32 1.7b ± 0.48 3.20a ± 0.63
10 10 10 10
Deletions
Chromatid break 0.30c 0.60c 1.20b 2.00a
± ± ± ±
0.48 0.52 0.63 0.47
0.00c 0.10c 2.20b 3.40a
± ± ± ±
Centromeric attenuations
0.00 0.32 0.63 0.70
0.80b 0.50b 2.30a 2.80a
± ± ± ±
0.42 0.53 0.82 0.42
Centric fusions 0.00c 0.10c 1.60b 2.30a
± ± ± ±
0.00 0.32 0.52 0.48
Polyploidy 0.20ab 0.00b 0.50a 0.50a
± ± ± ±
0.42 0.00 0.53 0.53
Total chromosomal aberrations excluding gaps
Hypoploidy 0.50c 0.80bc 1.30b 2.00a
± ± ± ±
0.53 0.42 0.82 0.82
2.60c 3.00c 10.80b 16.20a
± ± ± ±
0.50 0.67 1.23 1.03
1.90c 2.20c 9.00b 13.00a
± ± ± ±
0.32 0.42 1.25 0.94
Values expressed as means ± S.D. Means with different superscript letters (a, b and c) are significantly different (P ≤ 0.05).
Table 4 Frequencies of chromosome aberrations induced in cells of fetuses parentally treated with stannous chloride Treatment (mg/(kg day of SnCl2 ))
No. of examined fetuses
Chromosomal aberrations Chromatid gap
Control 2 10
30 30 30
Iso-chromatid Chromatid gap break
0.67b ± 0.61 0.00b ± 0.00 0.37b ± 0.49 0.67b ± 0.76 0.00b ± 0.00 0.40b ± 0.50 2.43a ± 0.82 0.60a ± 0.50 2.43a ± 0.90
Total chromosomal aberrations Fragments 0.00b ± 0.00 0.00b ± 0.00 0.93a ± 0.78
Deletions 0.00b ± 0.00 0.20b ± 0.41 2.13a ± 0.78
Centromeric attenuations 2.37b ± 0.85 2.17b ± 0.75 3.03a ± 0.72
Centric fusions 0.00b ± 0.00 0.00b ± 0.00 0.37a ± 0.61
Polyploidy
Hypoploidy
0.37b ± 0.49 0.63ab ± 0.61 0.87a ± 0.70
0.97a ± 0.67 1.07a ± 0.74 1.37a ± 1.00
4.83b ± 0.67 5.17b ± 0.70 14.03a ± 1.77
A.I. El-Makawy et al. / Mutation Research 657 (2008) 105–110
Control 2 10 20
Total chromosomal aberrations
Total chromosomal aberrations excluding gaps
4.07b ± 0.78 4.53b ± 0.78 11.13a ± 2.00
Values expressed as means ± S.D. Means with different superscript letters (a, b and c) are significantly different (P ≤ 0.05).
109
110
A.I. El-Makawy et al. / Mutation Research 657 (2008) 105–110
mice. The present study provides a basis for understanding the murine immune response and suggests candidate genes for further analysis. References [1] Agency for Toxic Substances and Disease Registry, Toxicological Profile for Tin and Compounds (Update), U.S. Department of Health and Human Services, Public Health Service, Atlanta, GA, 2005. [2] FAO/WHO, Expert Committee on Food Additive, Toxicological evaluation of certain food additives and contaminants, Cambridge University Press, Cambridge, WHO Food Additives Series no. 24, 1989, pp. 329–336. [3] J.C. Harbert, Nuclear Medicine. Diagnosis and Therapy, Thieme Medical Publishers, New York, 1996, pp. 190–201. [4] Codex Alimentarius Commission, Codex Committee on Food Additives and Contaminants, Position paper on tin, Food and Agriculture Organization of the UN/World Health Organization, Rome, 1998. [5] Codex Alimentarius Commission, Procedural Manual, Foods and Agriculture Organization of the UN/World Health Organization, Rome, 2001. [6] C.R. Silva, M.B. Oliveira, S.F. Melo, F.J. Dantas, J.C. de Mattos, R.J. Bezerra, A. Caldeira-de-Araujo, A. Duatti, M. Bernardo-Filho, Biological effects of stannous chloride, a substance that can produce stimulation or depression of the central nervous system, Brain Res. Bull. 59 (2002) 213–216. [7] H.C. Der Meulen, V.J. Feron, H.P. Til, Pancreatic atrophy and other pathological changes in rats following the feeding of stannous chloride, Pathol. Eur. 9 (3) (1974) 185–192. [8] J.R. McLean, J.G. Kaplan, The effect of tin on unscheduled and semi-conservative DNA synthesis, in: J.G. Kaplan (Ed.), The Molecular Basis of Immune Cell Function, Elsevier Biomedical, Amsterdam, 1979. [9] G.G. Hu, X.M. Luo, J. Liu, X. Liu, M. Gu, B.L. Mao, Z.Y. Chen, L.J. Wang, Sister chromatid exchanges (SCE), chromosomal aberrations and micronuclei of cultured peripheral lymphocytes in patients with lung cancer, miners and non-mining workers of the tin mine in Yunnan, Zhonghua Zhong Liu Za Zhi 9 (1987) 29–32. [10] B.B. Ganguly, G. Talukdar, A. Sharma, Cytotoxicity of tin on human peripheral lymphocytes in vitro, Mut. Res. 282 (2) (1992) 61–67. [11] C.A. Araújo, F.J.S. Dantas, M.O. Moraes, I. Felzenszwalb, M. Bernardo-Filho, Stannous chloride participates in the generation of reactive oxygen species, J. Braz. Assoc. Adv. Sci. 48 (1996) 109–113. [12] J.R.N. McLean, D.H. Blakey, G.R. Douglas, J.G. Kaplan, The effect of stannous and stannic tin chloride on DNA in Chinese hamster ovary cells, Mut. Res. 119 (1983) 195–201. [13] T. Kada, K. Hirano, Y. Shirasu, Principles and methods for their detection, in: A. Holander, F.J. Serres (Eds.), Chemical Mutagens, vol. 7, New York, Plenum Press, 1980, pp. 149–173. [14] N.K. Tripathy, F.E. Würgler, H. Frei, Genetic toxicity of six carcinogens and six non-carcinogens in the Drosophila wing spot test, Mut. Res. 242 (1990) 169–180. [15] J. Ashby, R.W. Tennant, Definitive relationships among chemical structure, carcinogenicity and mutagenicity for 301 chemicals tested by the U.S. NTP, Mut. Res. 257 (1991) 229–306. [16] J.C. De Mattos, F.J. Dantas, R.J. Bezerra, M. Bernardo-Filho, J.B. Cabral-Neto, C. Lage, A.C. Leitao, A. Caldeira-de-Araujo, Damage induced by stannous chloride in plasmid DNA, Toxicol. Lett. 116 (2000) 159–163. [17] M. Bernardo-Filho, M.C. Cunha, J.O. Valsa, A.C. Araújo, F.C.P. Silva, A.S. Fonseca, Evaluation of potential genotoxicity of stannous chloride: inactivation, filamentation and lysogenic induction of Escherichia coli, Food Chem. Toxicol. 32 (1994) 477–479. [18] R.E. Cabral, A.C. Leitão, C. Lage, A. Caldeira-de-Araujo, M. Bernardo-Filho, F.J. Dantas, J.B. Cabral-Neto, Mutational potentiality of stannous chloride: an important reducing agent in the Tc-99m radiopharmaceuticals, Mut. Res. 408 (2) (1998) 129–135. [19] F.J. Dantas, M.O. Moraes, J.C. de Mattos, R.J. Bezerra, E.F. Carvalho, M.B. Filho, A. Caldeira de Araujo, Stannous chloride mediates single strand breaks in plasmid DNA through reactive oxygen species formation, Toxicol. Lett. 110 (1999) 129–136. [20] JECFA, Toxicological evaluation of certain food additives and contaminants, WHO Food Additives, Series 24, Thirty-third Report of the Joint FAO/WHO Expert Committee on Food Additives, 1988. [21] E. Salewski, Färbemethode Zum makrosckopischen nachweis von implantations-stellen am uterus der ratte, Naunyn-Schmiedebergs Arch. Exp. Pathol. Pharmakol. 247 (1964) 367–368.
[22] I. Chahoud, J. Buschmann, R. Clark, A. Druga, H. Falke, A. Faqi, E. Hansen, B. Heinrich-Hirsch, J. Hellwig, W. Lingk, M. Parkinson, F.J. Paumgartten, R. Pfeil, T. Platzek, A.R. Scialli, J. Seed, R. Stahlmann, B. Ulbrich, X. Wu, M. Yasuda, M. Younes, R. Solecki, Classification terms in developmental toxicology: need for harmonisation, Reprod. Toxicol. 13 (1999) 77–82. [23] K. Omoe, A. Endo, Susceptibility to teratogenicity of hypervitaminosis-A in Xmonosomy mice, Reprod. Toxicol. 6 (1992) 547–550. [24] M.A. Peltzer, J.L. Schardein, A convenient method for processing fetuses for skeletal staining, Stain Technol. 41 (1966) 300–302. [25] M.E. Brun, S. Gasca, C. Girard, K. Bouton, B. De Massy, A. De Sario, Characterization and expression analysis during embryo development of the mouse ortholog of MLL3, Gene 371 (2006) 25–33. [26] J.E. Kronmiller, T. Nguyen, W. Berndt, A. Wickson, Spatial and temporal distribution of Sonic hedgehog mRNA in the embryonic mouse mandible by reverse transcription/polymerase chain reaction and in situ hybridization analysis, Arch. Oral Biol. 40 (1995) 831–838. [27] R.J. Preston, B.J. Dean, S. Galloway, H. Holden, A.F. McFee, M. Shelby, Mammalian in vivo cytogenetic assays: analysis of chromosome aberrations in bone marrow cells, Mut. Res. 189 (1987) 157–165. [28] A. Romagnano, A.W. King, C.L. Richer, M.A. Perrone, A direct technique for the preparation of chromosomes from early equine embryos, Can J. Genet. Cytol. 27 (1985) 365–369. [29] Q.Z. Wu, Teratogenic studies on stannous chloride in rats, Zhonghua Yu Fang Yi Xue Za Zhi 24 (1) (1990) 19–21. [30] I.M. Yousef, Protective role of ascorbic acid to enhance reproductive performance of male rabbits treated with stannous chloride, Toxicology 207 (2005) 81–89. [31] A. Harazono, M. Ema, Y. Ogawa, Pre-implantation embryonic loss induced by tributyltin chloride in rats, Toxicol. Lett. 89 (1996) 185–190. [32] A. Adeeko, D. Li, S.D. Forsyth, V. Casey, M.G. Cooke, J. Barthelemy, G.D. Cyr, M.J. Trasler, B. Robaire, F.B. Hales, Effects of in utero tributyltin chloride exposure in the rat on pregnancy outcome, Toxicol. Sci. 74 (2) (2003) 407– 415. [33] M.X. Chang, P. Nie, G.Y. Liu, Y. Song, Q. Gao, Identification of immune genes in grass carp Ctenopharyngodon idella in response to infection of the parasitic copepod Sinergasilus major, Parasitol. Res. 96 (2005) 224–229. [34] C.J. Bayne, L. Gerwick, K. Fujiki, M. Nakao, T. Yano, Immune-relevant (including acute phase) genes identified in the livers of rainbow trout, Oncorhynchus mykiss, by means of suppression subtractive hybridization, Dev. Comp. Immunol. 25 (2001) 205–217. [35] P. Olivier, D. Marzin, Study of genotoxic potential of 48 inorganic derivates with the SOS chromotest, Mut. Res. 189 (1987) 263–269. [36] D.K. Gulati, K. Witt, B. Anderson, E. Zeiger, M.D. Shelby, Chromosome aberration and sister chromatid exchange tests in Chinese hamster ovary cells in vitro. III. Results with 27 chemicals, Environ. Mol. Mutagen. 13 (2) (1989) 133–193. [37] Agency for Toxic Substances and Disease Registry, Toxicological profile for tin, U.S. Department of Health and Human Services, Washington D.C., USA, 1992. [38] Agency for Toxic Substances and Disease Registry, Toxicological profile for tin: an update, U.S. Department of Health and Human Services, Washington D.C., USA, 2002. [39] F.J.S. Dantas, J.C.P. de Mattos, M.O. Moraes, M.E. Viana, C.A.S. Lage, J.B. CabralNeto, A.C. Leitão, M. Bernardo-Filho, R.J.A.C. Bezerraa, J.J. Carvalho, A. Caldeirade-Araújo, Genotoxic effects of stannous chloride (SnCl2 ) in K562 cell line, Food Chem. Toxicol. 40 (2002) 1493–1498. [40] S.R.F. Moreno, R.S. Freitas, E.K. Rocha, G.L. Lima-Filho, M. Bernardo-Filho, Protection of plasmid DNA by a Ginkgo biloba extract from the effects of stannous chloride and the action on the labeling of blood elements with technetium99m, Braz. J. Med. Biol. Res. 37 (2) (2004) 267–271. [41] R.E. Cabral, A.C. Leitão, C. Lage, A. Caldeira-de-Araújo, M. Bernardo-Filho, F.J. Dantas, J.B. Cabral-Neto, Mutational potentiality of stannous chloride: an important reducing agent in the Tc-99m radiopharmaceuticals. Mut. Res. 408 (1998) 129–135. [42] J.C. de Mattos, C. Lage, F.J. Dantas, M.O. Moraes, A.P. Nunes, R.J. Bezerra, M.V. Faria, A.C. Leitão, A. Caldeira-de-Araujo, Interaction of stannous chloride leads to alteration in DNA, triphosphate nucleotides and isolated bases, Mol. Cell. Biochem. 280 (2005) 173–179. [43] F.M. El-Demerdash, M.I. Yousef, M.A. Zoheir, Stannous chloride induces alterations in enzyme activities, lipid peroxidation and histopathology in male rabbit: antioxidant role of vitamin C, Food Chem. Toxicol. 43 (2005) 1743– 1752. [44] E. Rojas, L.A. Herrera, L.A. Poirier, P. Ostrosky-Wegman, Are metals dietary carcinogens? Mut. Res. 443 (1999) 157–181.
Contents lists available at ScienceDirect
Mutation Research/Genetic Toxicology and Environmental Mutagenesis journal homepage: www.elsevier.com/locate/gentox Community address: www.elsevier.com/locate/mutres
Developmental and genetic toxicity of stannous chloride in mouse dams and fetuses Aida I. El-Makawy ∗ , Shenouda M. Girgis, Wagdy K.B. Khalil Cell Biology Department, National Research Center, 12622 Dokki, Cairo, Egypt
a r t i c l e
i n f o
Article history: Received 6 May 2008 Received in revised form 9 July 2008 Accepted 4 August 2008 Available online 22 August 2008 Keywords: Stannous chloride Teratogenicity Genotoxicity RT-PCR Chromosome aberrations Mice
a b s t r a c t Humans are exposed to stannous chloride (SnCl2 ) present in packaged food, soft drinks, biocides, dentifrices, etc. Health effects in children exposed to tin and tin compounds have not been investigated yet. Therefore, we evaluated the possible teratogenic and genotoxic effects of SnCl2 in pregnant female mice and their fetuses. Teratogenic effects including morphological malformation of the fetus and its skeleton were observed. Exposures to environmental stressors including toxic chemicals that have the potential of modulating the immune system can often be linked to ecologically relevant endpoints, such as reduced resistance to disease. Therefore, the semi-quantitative reverse-transcription PCR (RT-PCR) assay was used to evaluate the expression of immune-response genes in the liver of SnCl2 -treated dams and their fetuses. Bone-marrow cells of dams and fetuses were investigated for the presence of aberrant chromosomes. Three oral doses of SnCl2 (2, 10 and 20 mg/kg bw) were tested. The results of the teratological study show that SnCl2 induced a significant decrease in the number of living fetuses and a significant increase in the number of post-implantation losses. The high dose of SnCl2 induced complete post-implantation loss. Furthermore, SnCl2 caused reduction in the ossification of the fetal skeleton. The RT-PCR assay showed that the immune-response genes GARP and SIMP were not expressed in the liver of dams and fetuses in the controls or in the group treated with SnCl2 at 2 mg/kg bw. However, the expression of these genes was up-regulated in the groups treated with the other doses of SnCl2 . Regarding the chromosome analysis, SnCl2 induced a dose-dependent increase in the frequency of individual and total chromosomal aberrations (P ≤ 0.01) in bone-marrow cells of dams. In fetal cells, the 2-mg/kg bw dose of SnCl2 caused a non-significant increase in the total chromosomal aberrations, but the 10-mg/kg bw dose significantly increased the total number of chromosomal aberrations (P ≤ 0.01) compared with the control group. © 2008 Elsevier B.V. All rights reserved.
1. Introduction Tin is a natural element in the earth’s crust. Tin metal is used to line cans for food, beverages, and aerosols. It can combine with chemicals like chlorine, sulfur, or oxygen to form inorganic tin compounds (i.e., stannous chloride, stannous sulfide, stannic oxide). These compounds are used in toothpaste, perfumes, soaps, food additives and dyes. Tin can also combine with carbon to form organotin compounds (i.e., dibutyltin, tributyltin, triphenyltin), which are used to make plastics, food packages, plastic pipes, pesticides, paints, and pest repellents [1]. Inorganic tin compounds are used as pigments in the ceramic and textile industry [2]. In addition, stannous chloride, SnCl2 , is widely used in daily human life to conserve soft drinks, in food manufacturing, processing and packaging, and in biocidal preparations. In nuclear medicine, SnCl2 is used
∗ Corresponding author. Tel.: +20 2 3371433; fax: +20 2 337 0931. E-mail address: [email protected] (A.I. El-Makawy). 1383-5718/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.mrgentox.2008.08.007
as a reducing agent of Technetium-99 m (as sodium pertechnetate), a radionuclide used to label different cells and molecules [3]. As result of the use of tinplate for packaging of food and beverages, there is a probability that traces of tin dissolve in the food content [4]. According to Food and Agriculture Organization and the World Health Organization (UN-FAO/UN-WHO), the maximum limit for tin in canned foods is 250 mg kg−1 [5], but there is evidence suggesting that consumption of food or beverages containing tin above 200 mg kg−1 has caused gastrointestinal effects [6]. Moreover, when the contamination reaches this level the organoleptic properties of the food can be seriously affected. The biological effects of SnCl2 include stimulation followed by depression of the central nervous system in laboratory animals [6]. Early reports showed toxicity of tin chloride in rats, i.e. pathological changes in liver and kidney, brain edema, pancreatic atrophy, increased incidence of changes in fatty acids and vacuoles in the proximal convoluted tubules [7]. There are only few reports regarding the possible genotoxicity of tin compounds. Inorganic tin increased the frequency of chromosomal aberrations, sister chromatid exchange,
106
A.I. El-Makawy et al. / Mutation Research 657 (2008) 105–110
Table 1 Reproductive findings of pregnant mice treated with stannous chloride Treatment (mg/kg day−1 of SnCl2 )
Number of pregnant mice
Number of implantation
Control 2 10 20
10 10 10 10
7.90 9.20 8.70 8.00
± ± ± ±
1.29a 1.55a 1.49a 1.33a
Post-implantation loss 0.30 0.90 3.10 8.00
± ± ± ±
0.48c 1.60c 3.25b 1.33a
Number of live fetuses per litter
Number of fetal death
Fetal body weight (g)
Number of haematoma
7.60 ± 1.43a 8.20 ± 2.10a 5.60 ± 3.47b 0c
0a 0.11 ± 0.33a 0a 0a
1.17 ± 0.05a 0.65 ± 0.06b 0.50 ± 0.13b 0c
1.00 ± 0.30b 2.10 ± 0.50a 0.80 ± 0.47b 0b
Values presented as means ± S.D. Means with different superscript letters (a, b and c) are significantly different (P ≤ 0.05).
and it reduced cell proliferation; it induced rapid and prolonged suppression of DNA synthesis and caused alteration in gene expression, as reported by McLean and Kaplan [8]; Hu [9]; Ganguly et al. [10]; Araújo et al. [11]. In addition, McLean et al. [12] noticed that SnCl2 produced single-strand breaks in DNA of Chinese hamster ovary cells and DNA damage in human white blood cells. However, Kada et al. [13] reported the absence of genotoxicity using the Bacillus subtilis Rec assay test, where SnCl2 induced neither mutation nor mitotic gene-conversion. In addition, no genotoxic effects were found in Drosophila melanogaster with the wing-spot test [14]. Ashby and Tennant [15] described a carcinogenic activity of SnCl2 in the rat thyroid. SnCl2 induced cytotoxicity/genotoxicity in different DNA-repair mutants of Escherichia coli [16,17] and DNA damage was suggested to occur via the formation of oxygen radicals [18]. In addition, SnCl2 caused strand breaks in plasmid DNA in vitro and it was suggested that it could induce this type of DNA lesion in vivo as well [19]. There are no reports of adverse developmental effects in humans exposed to tin or its compounds. In addition, there are no studies that evaluated the developmental effects in animals exposed to inorganic tin. The present work was undertaken to evaluate the possible teratogenic and genotoxic effects of SnCl2 in pregnant female mice and their fetuses, and to confirm suggested mechanisms of interaction with DNA. The teratogenic study included analysis of morphological malformation and aberrations of the fetal skeleton. The semi-quantitative RT-PCR assay was used to evaluate the expression of immune-response genes in the liver of SnCl2 -treated dams and fetuses, as well as chromosome aberrations in bone marrow of the dams and their fetuses were investigated.
tilled water daily by gavage and the other three groups were given different doses of SnCl2 at the levels of 2, 10 and 20 mg/kg body weight (bw) once daily by using sterile water as the vehicle. Selection of the lower dose was based on the provisional tolerable daily intake of tin, since the actual tolerable daily intake of tin chloride in humans is 2 mg/kg bw [20]. During week 3 of the treatment, the females were paired with males in a 2:1 ratio overnight and were examined for the presence of a vaginal plug the following morning. The day a vaginal plug found was designated as day zero of gestation and the treatment was continued throughout the gestation period. 2.3. External examination of fetuses At day 18 of gestation, the pregnant mice were sacrificed by cervical dislocation. The gravid uterine contents were evaluated for numbers of implantation sites, resorptions, late fetal deaths and live fetuses. Uteri from apparently non-pregnant females or from apparent single-horn pregnancies were stained by the method of Salewski [21] to detect early resorption sites. Fetuses were weighed and examined under magnification for gross external malformation. The viability of the fetuses was determined by the presence of spontaneous breathing or responses to tactile stimulation. Findings were classified as variations or malformations, according to currently used nomenclature [22]. 2.4. Preparation of specimens of the fetal skeleton All live fetuses were evaluated for weight, external, visceral, and skeletal abnormalities. The fetuses without external malformations from each litter were chosen for skeletal examinations [23]. Soft tissues, such as, skin, eye, visceral and connective tissue were taken away from the skeleton. Later on, all fetuses were kept in a solution of 95% alcohol to fix tissues. Specimens were placed in a solution of 1% KOH for 2 days. Later on, all specimens were stained with Alizarin red S and kept at 37 ◦ C in a drying oven for 4 days. Then, specimens were treated with solutions of 1% KOH, including 20, 50 and 80% glycerin, sequentially. Glycerin (100%) was used to get the specimens transparent. After staining, all specimens were examined under a stereomicroscope for skeletal malformations and variations [24].
2. Materials and methods
2.5. Semi-quantitative RT-PCR
2.1. Chemical
The RT-PCR assay was conducted to verify the expression of immune-response genes of mice and their embryos after exposure to SnCl2 . The expression of two novel immune genes, encoding proteins such as ‘source of immuno-dominant MHCassociated peptides’ (SIMP) and ‘glycoprotein A repetitions predominant (GARP)’ was investigated, which included the following steps:
Stannous chloride (SnCl2 ·2H2 O, CAS no. 10025-69-1) was purchased from Sigma, St. Louis, MO, USA. The chemical purity was >99% by gas chromatography. 2.2. Animals and experimental design Adult male (body weight, 30–35 g) and virgin female (body weight, 25–30 g) Swiss albino mice were obtained from the Laboratory Animal house of the National Research Center, and maintained in constant-temperature controlled rooms (22 ± 2 ◦ C). Animals received food and water ad libitum and were kept on a 12-h light/12-h dark schedule. After 1 week of acclimatization, male and female mice were randomly assigned to four groups of 15 animals each (10 females and 5 males) according to body weight. Each five animals were housed in groups of the same gender in stainless steel-wire mesh cages. The control group was given dis-
2.5.1. RNA extraction Liver samples were taken from the treated mice and their fetuses. The samples were immediately frozen in liquid nitrogen and stored at −80 ◦ C prior to extraction. Total RNA was isolated from 50 to 100 mg of liver tissue by the standard TRIzol extraction method (Invitrogen, Paisley, UK) and recovered in 100 l molecular biology-grade water. In order to remove any possible genomic DNA contamination, the total RNA samples were pre-treated using the ‘DNA-freeTM DNase treatment and removal reagents kit’ (Ambion, Austin, TX, USA) following the manufacturer’s protocol.
Table 2 Primers and reaction parameters in RT-PCR Target cDNA
Primer name
Primer sequence (5 –3 )
Annealing temperature (◦ C)
PCR product size (bp)
-Actin
Act-F Act-R
CCCCATCGAGCACGGTATTG ATGGCGGGGGTGTTGAAGGTC
57
189
SIMP
SIMP-F SIMP-R
ACCCCAGTCCCAGCGTAGTG ATGTCGTCGCCTGAGTATCCAATC
58
331
GARP
GARP-F GARP-R
CCTTCACGGCAACAACATCC ATCACGCTAATCCACAACAC
54
1656
A.I. El-Makawy et al. / Mutation Research 657 (2008) 105–110 2.5.2. Reverse transcription The complete Poly(A)+ RNA samples isolated from the mice were reversetranscribed into cDNA in a total volume of 20 l using 1 l oligo(dT) primer. The composition of the reaction mixture, termed master mix (MM), consisted of 50 mM MgCl2 , 10× reverse transcription (RT) buffer (50 mM KCl; 10 mM Tris–HCl; pH 8.3; PerkinElmer), 10 mM of each dNTP (Amersham, Brunswick, Germany), and 50 M of oligo (dT) primer. The RT reaction was carried out at 25 ◦ C for 10 min, followed by 1 h at 42 ◦ C, and finished with denaturation step at 99 ◦ C for 5 min. Afterwards the reaction tubes containing RT preparations were flash-cooled in an ice chamber until used for DNA amplification through polymerase chain reaction (PCR) [25]. 2.5.3. Polymerase chain reaction (PCR) The first-strand cDNA from different mouse samples was used as template for RT-PCR with a pair of specific primers. The sequences of the specific primers and the product sizes are listed in Table 2. Beta-actin, a house-keeping gene, was used for normalizing mRNA levels of the target genes. The reaction mixture for RT-PCR consisted of 10 mM dNTP’s, 50 mM MgCl2 , 10× PCR buffer (50 mM KCl; 20 mM Tris–HCl; pH 8.3; Gibco BRL, Eggenstein, Germany) and autoclaved water. The PCR cycling parameters were one cycle of 94 ◦ C for 3 min, 35 cycles of 94 ◦ C for 30 s, 42 ◦ C (GARP gene) to 58 ◦ C (SIMP gene) for 30 s, 72 ◦ C for 90 s, and a final cycle of 72 ◦ C for 7 min. The PCR products were then loaded onto a 2.0% agarose gel, with PCR products derived from -actin of the different mouse samples [26].
107
3.2. Examination of the skeleton The fetal skeletons of both the control and the parentally SnCl2 treated groups were stained with Alizarin red S and examined by use of a dissecting binocular microscope. There was some evidence of treatment-related reduction in the ossification of the fetal skeleton. Skeletal examination of fetuses obtained from mothers of the groups treated with 2 and 10 mg SnCl2 /kg bw showed a significant decrease in the size of the skeletons compared with those in the control group. This decrease in the fetuses’ size was a result of reduced ossification. All bones of the axial (skull and vertebrae) and appendicular (bones of pelvic girdle, fore and hind limbs, bones of digits) skeletons of fetuses parentally treated with SnCl2 showed less ossification than the control. This indicates that SnCl2 did not induce external malformations but increased the incidence of skeletal anomalies, a sign of growth retardation or developmental delay. 3.3. Semi-quantitative RT-PCR
2.6. Cytogenetic analysis 2.6.1. Bone-marrow chromosome preparation Cytogenetic analysis was performed on bone-marrow cells according to the method of Preston et al. [27], with slight modifications. Experimental animals were injected intraperitoneally (i.p.) with colchicine 1.5 h prior to sacrifice. Both femurs were dissected out and cleaned of any adhering muscle tissue. Bone-marrow cells were collected from both the femurs by flushing in KCl and then incubated at 37 ◦ C for 35 min, fixed in methanol-glacial acetic acid (3:1). Centrifugation and fixation (in the cold) were repeated five times at 20-min intervals. The pellet was resuspended in a small volume of the fixative, dropped onto chilled slides, flame-dried, and stained with 10% buffered Giemsa (pH 6.8).
The analysis of the effects of SnCl2 by use of the RT-PCR assay showed that the immune-response genes GARP and SIMP were not expressed in the liver of the dams or their fetuses, in the control group or in the group treated with 2 mg/kg bw of SnCl2 (Fig. 1). However, the expression of GARP and SIMP was up-regulated in the samples from animals initially treated with 10mg/kg bw of SnCl2 (Fig. 1). The activity of the immune-response genes was also high after intake of 20 mg/kg bw of SnCl2 . 3.4. Cytogenetic analysis
2.6.2. Fetal chromosome preparation Chromosomes were prepared from fetuses according to Romagnano et al. [28]. Livers of the fetuses were removed and cleaned of any extraneous tissue. Cleaned liver tissue was placed in a conical centrifuge tube with 2 ml of medium TCM 199. Samples were pipetted several times with a Pasteur pipette to further break-up the tissue and 0.025% colchicine was added. The mixture was incubated for 90 min at 37 ◦ C. The samples were centrifuged for 5 min and then incubated in 2 ml of a prewarmed hypotonic KCl solution (0.56%) for 15 min at 37 ◦ C. Cells were fixed twice in methanol-glacial acetic acid (3:1) and slides were prepared and air-dried. Good-quality metaphases (n = 100) for each animal and fetuses were microscopically examined and different types of chromosome abnormalities were recorded. 2.7. Statistical analysis All data were statistically analysed by one-way analysis of variance (ANOVA) using SPSS for Windows 95. Multiple comparisons were performed by Duncan’s Test. All values reported as means ± S.D. For all experimental data, the significance level was set at P ≤ 0.05, when appropriate.
3. Results 3.1. External malformation of fetuses Table 1 shows the reproductive findings of pregnant mice treated with SnCl2 including the number of implanted fetuses, live fetuses, post-implantation losses, dead fetuses, fetal body weights and the number of haematomas in the control and SnCl2 -treated groups. The data show that administration to the dams of SnCl2 at 2 mg/kg bw induced a non-significant increase in the number of live fetuses and a non-significant increase in the number of post-implantation losses compared with the control. The intake of 10mg/kg bw of SnCl2 induced a significant decrease in the number of live fetuses and a significant increase in the number of postimplantation losses (P ≤ 0.01). Meanwhile, oral administration of SnCl2 at both doses (2 and 10 mg/kg bw) induced a significant decrease in the fetal body weights compared with the control group. In addition, the high dose of SnCl2 (20 mg/kg bw) induced complete post-implantation loss.
The metaphase analysis of the bone marrow and fetus cells revealed various types of structural chromosomal aberrations, which consisted of chromatid and iso-chromatid types of gaps, breaks, fragments, deletions, centric fusions and centromeric attenuations. Numerical chromosomal aberrations resulted in polyploidy and hypoploidy as shown in Tables 3 and 4. Analysis of chromosomal aberrations in bone-marrow cells showed that the treatment with 2 mg/kg bw of SnCl2 induced a non-significant increase in the frequencies of individual and total chromosomal aberrations compared with the control. The other two doses (10 and 20 mg/kg bw) of SnCl2 induced significant increase in the frequencies of both the individual and the total chromosomal aberrations (P ≤ 0.01) when compared with the control. Polyploidy showed a non-significant difference between the control and all treated groups. In the fetal cell preparations, there was non-significant difference between the frequency of chromosomal aberrations induced by the low dose of SnCl2 and that observed in the control. The dose of 10mg/kg bw of SnCl2 induced a significant increase in the frequency of chromosomal aberrations (P ≤ 0.01) compared with the control. 4. Discussion The present study was designed to determine the effects of SnCl2 , administered orally prior and during pregnancy, on mouse dams and their fetuses. Administration of SnCl2 caused a reduction in the rate of successful pregnancies in females that had a positive mating outcome. In females achieving pregnancy, however, SnCl2 had no adverse effect on the numbers of implantations. It is obvious that SnCl2 adversely affects maternal reproductive parameters and survival of offspring, since it significantly increased postimplantation loss and decreased fetal body weights. In addition, decreased fetal body weight was correlated to delayed ossification. Thus, it appears that a high dose of SnCl2 (20 mg/kg bw) causes
108
A.I. El-Makawy et al. / Mutation Research 657 (2008) 105–110
Fig. 1. RT-PCR confirmation of expression of two different immune-response genes in mice and their embryos treated with stannous chloride. Lane 1 represents DNA marker, lanes 2 and 7 represent control samples, lanes 3–5 and 8–10 represent the treated samples with low, medium and high doses of stannous chloride, respectively, and lanes 6 and 11 represent the -actin expression to normalize the treated groups. (A) Agarose gel representing the GARP gene; (B) agarose gel representing the SIMP gene.
pregnancy failure after administration during the very early stages of pregnancy. These results are in agreement with those of Wu [29] who reported that SnCl2 administered to pregnant rats showed teratogenic effects on the early growing embryos. In addition, Yousef [30] showed that treatment with SnCl2 caused reproductive toxicity in male rabbits. Meanwhile, Harazono et al. [31] and Adeeko et al. [32] reported that administration of tributyltin chloride at a high dose during very early pregnancy produced a significant and dose-related reduction in fertility. This was evident from a significant increase in post-implantation loss and a decrease in litter size as well as a decrease in fetal weight, but it did not result in external malformations, or a change in sex ratio. In addition, delayed ossification of the fetal skeleton after in utero exposure to either 10 or 20 mg/kg tributyltin chloride was observed. Assessment of health hazards arising from occupational exposure to toxic chemicals in the environment has already been reported. It is expected that exposure of animals to toxic chemicals would evoke an immune response. In the present study, the expression of the GARP and SIMP genes was up-regulated in samples isolated from animals treated with 10 mg/kg bw of SnCl2 . Furthermore, the activity of the immune-response genes also was high at the dose of 20 mg/kg bw of SnCl2 . Chang et al. [33] found a few protein components of the acute-phase response (APR) in carp in response to parasite infection as part of the innate immune defense. APR was characterized by a change of plasma proteins, which are referred to as acute-phase proteins (APPs), and by the secretion of some other innate defense molecules. Bayne et al. [34] also identified most of these components in the up-regulated gene libraries from livers of infected rainbow trout (Oncoryhnchus mykiss). We suggest that the up-regulated expression of GARP and SIMP genes in mice and their fetuses as confirmed using RT-PCR assay may also indicate that APPs are expressed and susceptible to up-regulation as a result of the SnCl2 treatment.
Concerning the chromosomal analysis, our results clearly indicate a significant dose-dependent increase in the frequencies of chromosomal aberrations in both dams and fetuses. These results are in accordance with those of Olivier and Marzin [35] who described a mutagenic action of SnCl2 using the SOS chromotest. Positive responses with SnCl2 for chromosomal aberrations, sister chromatid exchange (SCE), reduced cell proliferation, rapid and prolonged suppression of DNA synthesis and alteration in gene expression in Chinese hamster ovary (CHO) cells were also observed [8–11,36–38]. In addition, McLean et al. [12] noticed that SnCl2 produced single-strand breaks in DNA of Chinese hamster ovary cells and caused DNA damage in human white blood cells. This may be due to an interaction between genomic material and SnCl2 , which suggests its putative genotoxicity. SnCl2 produced extensive DNA damage, detected as single-strand DNA breaks in Chinese hamster cells [12], in the K562 cell line [39,40], and in the supF gene of E. coli [18,41,42]. These findings confirm that SnCl2 is an effective mutagenic substance with a powerful damaging effect through oxygen radical formation or by a Fenton-like reaction that generates + OH radicals. In addition, it was found that reactive oxygen species such as + OH were generated close to the site of the lesions due to a possible complex formation of the stannous ion with DNA [20]. ElDemerdash et al. [43] confirmed the previous interpretation when they showed that SnCl2 significantly induced free radicals in rabbit liver, testes, kidney, lung, brain and heart, whereas the activities of glutathione S-transferase (GST) and the level of sulfhydryl groups (SH-group) were decreased (P < 0.05) in all tested organs except brain and heart. The proposed carcinogenic mechanisms by which Sn exerts significant impact are the following: DNA methylation, DNA oxidation, lipid peroxidation to form reactive intermediates and DNA adducts, alterations of deoxynucleotide pool sizes, and alterations in DNA-repair processes [44]. In conclusion, our results clearly indicate a significant dosedependent increase of developmental and genetic toxicity due to exposure to stannous chloride given by oral administration to
Table 3 Frequencies of chromosome aberrations induced in bone-marrow cells of pregnant mice treated with stannous chloride by oral gavage Treatment (mg/(kg day of SnCl2 ))
Number of examined dams
Chromosomal aberrations Chromatid gap 0.80c ± 0.42 0.90c ± 0.32 1.7b ± 0.48 3.20a ± 0.63
10 10 10 10
Deletions
Chromatid break 0.30c 0.60c 1.20b 2.00a
± ± ± ±
0.48 0.52 0.63 0.47
0.00c 0.10c 2.20b 3.40a
± ± ± ±
Centromeric attenuations
0.00 0.32 0.63 0.70
0.80b 0.50b 2.30a 2.80a
± ± ± ±
0.42 0.53 0.82 0.42
Centric fusions 0.00c 0.10c 1.60b 2.30a
± ± ± ±
0.00 0.32 0.52 0.48
Polyploidy 0.20ab 0.00b 0.50a 0.50a
± ± ± ±
0.42 0.00 0.53 0.53
Total chromosomal aberrations excluding gaps
Hypoploidy 0.50c 0.80bc 1.30b 2.00a
± ± ± ±
0.53 0.42 0.82 0.82
2.60c 3.00c 10.80b 16.20a
± ± ± ±
0.50 0.67 1.23 1.03
1.90c 2.20c 9.00b 13.00a
± ± ± ±
0.32 0.42 1.25 0.94
Values expressed as means ± S.D. Means with different superscript letters (a, b and c) are significantly different (P ≤ 0.05).
Table 4 Frequencies of chromosome aberrations induced in cells of fetuses parentally treated with stannous chloride Treatment (mg/(kg day of SnCl2 ))
No. of examined fetuses
Chromosomal aberrations Chromatid gap
Control 2 10
30 30 30
Iso-chromatid Chromatid gap break
0.67b ± 0.61 0.00b ± 0.00 0.37b ± 0.49 0.67b ± 0.76 0.00b ± 0.00 0.40b ± 0.50 2.43a ± 0.82 0.60a ± 0.50 2.43a ± 0.90
Total chromosomal aberrations Fragments 0.00b ± 0.00 0.00b ± 0.00 0.93a ± 0.78
Deletions 0.00b ± 0.00 0.20b ± 0.41 2.13a ± 0.78
Centromeric attenuations 2.37b ± 0.85 2.17b ± 0.75 3.03a ± 0.72
Centric fusions 0.00b ± 0.00 0.00b ± 0.00 0.37a ± 0.61
Polyploidy
Hypoploidy
0.37b ± 0.49 0.63ab ± 0.61 0.87a ± 0.70
0.97a ± 0.67 1.07a ± 0.74 1.37a ± 1.00
4.83b ± 0.67 5.17b ± 0.70 14.03a ± 1.77
A.I. El-Makawy et al. / Mutation Research 657 (2008) 105–110
Control 2 10 20
Total chromosomal aberrations
Total chromosomal aberrations excluding gaps
4.07b ± 0.78 4.53b ± 0.78 11.13a ± 2.00
Values expressed as means ± S.D. Means with different superscript letters (a, b and c) are significantly different (P ≤ 0.05).
109
110
A.I. El-Makawy et al. / Mutation Research 657 (2008) 105–110
mice. The present study provides a basis for understanding the murine immune response and suggests candidate genes for further analysis. References [1] Agency for Toxic Substances and Disease Registry, Toxicological Profile for Tin and Compounds (Update), U.S. Department of Health and Human Services, Public Health Service, Atlanta, GA, 2005. [2] FAO/WHO, Expert Committee on Food Additive, Toxicological evaluation of certain food additives and contaminants, Cambridge University Press, Cambridge, WHO Food Additives Series no. 24, 1989, pp. 329–336. [3] J.C. Harbert, Nuclear Medicine. Diagnosis and Therapy, Thieme Medical Publishers, New York, 1996, pp. 190–201. [4] Codex Alimentarius Commission, Codex Committee on Food Additives and Contaminants, Position paper on tin, Food and Agriculture Organization of the UN/World Health Organization, Rome, 1998. [5] Codex Alimentarius Commission, Procedural Manual, Foods and Agriculture Organization of the UN/World Health Organization, Rome, 2001. [6] C.R. Silva, M.B. Oliveira, S.F. Melo, F.J. Dantas, J.C. de Mattos, R.J. Bezerra, A. Caldeira-de-Araujo, A. Duatti, M. Bernardo-Filho, Biological effects of stannous chloride, a substance that can produce stimulation or depression of the central nervous system, Brain Res. Bull. 59 (2002) 213–216. [7] H.C. Der Meulen, V.J. Feron, H.P. Til, Pancreatic atrophy and other pathological changes in rats following the feeding of stannous chloride, Pathol. Eur. 9 (3) (1974) 185–192. [8] J.R. McLean, J.G. Kaplan, The effect of tin on unscheduled and semi-conservative DNA synthesis, in: J.G. Kaplan (Ed.), The Molecular Basis of Immune Cell Function, Elsevier Biomedical, Amsterdam, 1979. [9] G.G. Hu, X.M. Luo, J. Liu, X. Liu, M. Gu, B.L. Mao, Z.Y. Chen, L.J. Wang, Sister chromatid exchanges (SCE), chromosomal aberrations and micronuclei of cultured peripheral lymphocytes in patients with lung cancer, miners and non-mining workers of the tin mine in Yunnan, Zhonghua Zhong Liu Za Zhi 9 (1987) 29–32. [10] B.B. Ganguly, G. Talukdar, A. Sharma, Cytotoxicity of tin on human peripheral lymphocytes in vitro, Mut. Res. 282 (2) (1992) 61–67. [11] C.A. Araújo, F.J.S. Dantas, M.O. Moraes, I. Felzenszwalb, M. Bernardo-Filho, Stannous chloride participates in the generation of reactive oxygen species, J. Braz. Assoc. Adv. Sci. 48 (1996) 109–113. [12] J.R.N. McLean, D.H. Blakey, G.R. Douglas, J.G. Kaplan, The effect of stannous and stannic tin chloride on DNA in Chinese hamster ovary cells, Mut. Res. 119 (1983) 195–201. [13] T. Kada, K. Hirano, Y. Shirasu, Principles and methods for their detection, in: A. Holander, F.J. Serres (Eds.), Chemical Mutagens, vol. 7, New York, Plenum Press, 1980, pp. 149–173. [14] N.K. Tripathy, F.E. Würgler, H. Frei, Genetic toxicity of six carcinogens and six non-carcinogens in the Drosophila wing spot test, Mut. Res. 242 (1990) 169–180. [15] J. Ashby, R.W. Tennant, Definitive relationships among chemical structure, carcinogenicity and mutagenicity for 301 chemicals tested by the U.S. NTP, Mut. Res. 257 (1991) 229–306. [16] J.C. De Mattos, F.J. Dantas, R.J. Bezerra, M. Bernardo-Filho, J.B. Cabral-Neto, C. Lage, A.C. Leitao, A. Caldeira-de-Araujo, Damage induced by stannous chloride in plasmid DNA, Toxicol. Lett. 116 (2000) 159–163. [17] M. Bernardo-Filho, M.C. Cunha, J.O. Valsa, A.C. Araújo, F.C.P. Silva, A.S. Fonseca, Evaluation of potential genotoxicity of stannous chloride: inactivation, filamentation and lysogenic induction of Escherichia coli, Food Chem. Toxicol. 32 (1994) 477–479. [18] R.E. Cabral, A.C. Leitão, C. Lage, A. Caldeira-de-Araujo, M. Bernardo-Filho, F.J. Dantas, J.B. Cabral-Neto, Mutational potentiality of stannous chloride: an important reducing agent in the Tc-99m radiopharmaceuticals, Mut. Res. 408 (2) (1998) 129–135. [19] F.J. Dantas, M.O. Moraes, J.C. de Mattos, R.J. Bezerra, E.F. Carvalho, M.B. Filho, A. Caldeira de Araujo, Stannous chloride mediates single strand breaks in plasmid DNA through reactive oxygen species formation, Toxicol. Lett. 110 (1999) 129–136. [20] JECFA, Toxicological evaluation of certain food additives and contaminants, WHO Food Additives, Series 24, Thirty-third Report of the Joint FAO/WHO Expert Committee on Food Additives, 1988. [21] E. Salewski, Färbemethode Zum makrosckopischen nachweis von implantations-stellen am uterus der ratte, Naunyn-Schmiedebergs Arch. Exp. Pathol. Pharmakol. 247 (1964) 367–368.
[22] I. Chahoud, J. Buschmann, R. Clark, A. Druga, H. Falke, A. Faqi, E. Hansen, B. Heinrich-Hirsch, J. Hellwig, W. Lingk, M. Parkinson, F.J. Paumgartten, R. Pfeil, T. Platzek, A.R. Scialli, J. Seed, R. Stahlmann, B. Ulbrich, X. Wu, M. Yasuda, M. Younes, R. Solecki, Classification terms in developmental toxicology: need for harmonisation, Reprod. Toxicol. 13 (1999) 77–82. [23] K. Omoe, A. Endo, Susceptibility to teratogenicity of hypervitaminosis-A in Xmonosomy mice, Reprod. Toxicol. 6 (1992) 547–550. [24] M.A. Peltzer, J.L. Schardein, A convenient method for processing fetuses for skeletal staining, Stain Technol. 41 (1966) 300–302. [25] M.E. Brun, S. Gasca, C. Girard, K. Bouton, B. De Massy, A. De Sario, Characterization and expression analysis during embryo development of the mouse ortholog of MLL3, Gene 371 (2006) 25–33. [26] J.E. Kronmiller, T. Nguyen, W. Berndt, A. Wickson, Spatial and temporal distribution of Sonic hedgehog mRNA in the embryonic mouse mandible by reverse transcription/polymerase chain reaction and in situ hybridization analysis, Arch. Oral Biol. 40 (1995) 831–838. [27] R.J. Preston, B.J. Dean, S. Galloway, H. Holden, A.F. McFee, M. Shelby, Mammalian in vivo cytogenetic assays: analysis of chromosome aberrations in bone marrow cells, Mut. Res. 189 (1987) 157–165. [28] A. Romagnano, A.W. King, C.L. Richer, M.A. Perrone, A direct technique for the preparation of chromosomes from early equine embryos, Can J. Genet. Cytol. 27 (1985) 365–369. [29] Q.Z. Wu, Teratogenic studies on stannous chloride in rats, Zhonghua Yu Fang Yi Xue Za Zhi 24 (1) (1990) 19–21. [30] I.M. Yousef, Protective role of ascorbic acid to enhance reproductive performance of male rabbits treated with stannous chloride, Toxicology 207 (2005) 81–89. [31] A. Harazono, M. Ema, Y. Ogawa, Pre-implantation embryonic loss induced by tributyltin chloride in rats, Toxicol. Lett. 89 (1996) 185–190. [32] A. Adeeko, D. Li, S.D. Forsyth, V. Casey, M.G. Cooke, J. Barthelemy, G.D. Cyr, M.J. Trasler, B. Robaire, F.B. Hales, Effects of in utero tributyltin chloride exposure in the rat on pregnancy outcome, Toxicol. Sci. 74 (2) (2003) 407– 415. [33] M.X. Chang, P. Nie, G.Y. Liu, Y. Song, Q. Gao, Identification of immune genes in grass carp Ctenopharyngodon idella in response to infection of the parasitic copepod Sinergasilus major, Parasitol. Res. 96 (2005) 224–229. [34] C.J. Bayne, L. Gerwick, K. Fujiki, M. Nakao, T. Yano, Immune-relevant (including acute phase) genes identified in the livers of rainbow trout, Oncorhynchus mykiss, by means of suppression subtractive hybridization, Dev. Comp. Immunol. 25 (2001) 205–217. [35] P. Olivier, D. Marzin, Study of genotoxic potential of 48 inorganic derivates with the SOS chromotest, Mut. Res. 189 (1987) 263–269. [36] D.K. Gulati, K. Witt, B. Anderson, E. Zeiger, M.D. Shelby, Chromosome aberration and sister chromatid exchange tests in Chinese hamster ovary cells in vitro. III. Results with 27 chemicals, Environ. Mol. Mutagen. 13 (2) (1989) 133–193. [37] Agency for Toxic Substances and Disease Registry, Toxicological profile for tin, U.S. Department of Health and Human Services, Washington D.C., USA, 1992. [38] Agency for Toxic Substances and Disease Registry, Toxicological profile for tin: an update, U.S. Department of Health and Human Services, Washington D.C., USA, 2002. [39] F.J.S. Dantas, J.C.P. de Mattos, M.O. Moraes, M.E. Viana, C.A.S. Lage, J.B. CabralNeto, A.C. Leitão, M. Bernardo-Filho, R.J.A.C. Bezerraa, J.J. Carvalho, A. Caldeirade-Araújo, Genotoxic effects of stannous chloride (SnCl2 ) in K562 cell line, Food Chem. Toxicol. 40 (2002) 1493–1498. [40] S.R.F. Moreno, R.S. Freitas, E.K. Rocha, G.L. Lima-Filho, M. Bernardo-Filho, Protection of plasmid DNA by a Ginkgo biloba extract from the effects of stannous chloride and the action on the labeling of blood elements with technetium99m, Braz. J. Med. Biol. Res. 37 (2) (2004) 267–271. [41] R.E. Cabral, A.C. Leitão, C. Lage, A. Caldeira-de-Araújo, M. Bernardo-Filho, F.J. Dantas, J.B. Cabral-Neto, Mutational potentiality of stannous chloride: an important reducing agent in the Tc-99m radiopharmaceuticals. Mut. Res. 408 (1998) 129–135. [42] J.C. de Mattos, C. Lage, F.J. Dantas, M.O. Moraes, A.P. Nunes, R.J. Bezerra, M.V. Faria, A.C. Leitão, A. Caldeira-de-Araujo, Interaction of stannous chloride leads to alteration in DNA, triphosphate nucleotides and isolated bases, Mol. Cell. Biochem. 280 (2005) 173–179. [43] F.M. El-Demerdash, M.I. Yousef, M.A. Zoheir, Stannous chloride induces alterations in enzyme activities, lipid peroxidation and histopathology in male rabbit: antioxidant role of vitamin C, Food Chem. Toxicol. 43 (2005) 1743– 1752. [44] E. Rojas, L.A. Herrera, L.A. Poirier, P. Ostrosky-Wegman, Are metals dietary carcinogens? Mut. Res. 443 (1999) 157–181.