Developmental expression of 2′,3′-cyclic-nucleotide 3′-phosphodiesterase mRNA inbrains of normal and quaking mice

Molecular Brain Research, 5 (1989) 247-250 Elsevier

247

BRM 80038

Developmental expression of 2",3"-cyclic-nucleotide 3"-phosphodiesterase mRNA in brains of normal and quaking mice Tadashi Kurihara a, Yasuo Takahashi ~, Nobuya Fujita 2, Shuzo Sato 2 and Tadashi Miyatake a Departments of lNeuropharmacology and 2Neurology, Brain Research Institute, Niigata University, Niigata (Japan) (Accepted 27 December 1988) Key words: 2",3"-Cyclic-nucleotide3"-phosphodiesterase; mRNA; Development; Myelin; Mouse; Quaking mouse

A cDNA fragment of mouse 2",3"-cyclic-nucleotide 3"-phosphodiesterase was isolated and used as the probe for Northern blot analysis. The mRNA bands in normal mice became detectable at 10 days after birth, reached the maximum at the period of active myelination and then decreased gradually. At all stages of development studied, the mRNA bands in quaking mice were markedly reduced as compared with those in normal mice. The protein composition of central nervous system myelin is relatively simple consisting largely of proteolipid protein, myelin basic protein and 2",3"-cyclic-nucleotide 3"-phosphodiesterase (CNP) (EC 3.1.4.37), in the order of abundance. CNP has been widely used as a marker for myelin-oligodendrocytes in the central nervous system; the function of the enzyme, however, remains unknown (see a recent review by Vogel and Thompson11). The cDNAs of bovine, rat and human CNPs were recently isolated and sequenced 1'6'7'1°. A c D N A fragment of mouse CNP was here isolated and the levels of CNP m R N A were measured in brains of normal and quaking mice at various stages of development. Poly(A) ÷ R N A was prepared and analyzed as described previously 2. The mouse CNP c D N A was isolated by screening a mouse brain cDNA library (2gtll; Clontech Laboratories, Palo Alto, CA, U.S.A.) with the 300-bp EcoRI fragment of human CNP c D N A 7. The cDNA obtained was recloned into pUC8 and sequenced by the method of Maxam and Gilbert 8. A mouse strain, ddY, was bred in our laboratory and used as normal mice. The quaking mutant was obtained from Jackson Labs. (Bar

Harbor, ME, U.S.A.) and maintained in our laboratory; affected homozygotes were used for m R N A analysis. One positive clone containing a c D N A insert of 437 bp was isolated by hybridization with human CNP cDNA (Fig. la). The 437-bp c D N A corresponded to nucleotides 184-623 of human CNP cDNA 7. The nucleotide sequence had 89% identity with the corresponding region of human CNP cDNA7; the deduced amino acid sequence had 92% identity. The nucleotide sequence had 90% identity with the corresponding region of rat CNP cDNA 1. The deduced amino acid sequence, however, had unexpected low identity (71%) with the reported sequence of rat CNP 1. Comparison of rat CNP cDNA 1 with bovine 6'1°, human 7 and mouse (Fig. la) CNP cDNAs suggests that the reading frame of the reported rat sequence I between nucleotides 148 and 237 has been shifted probably due to sequencing errors (Fig. lb). The mouse sequence (Fig. la) has been confirmed by two other independent clones (T. Kurihara, unpublished work). Similar shifts are also found in nucleotides 271-279 (Fig. Ib), nucleotides 604-660 and nucleotides 1135-1179 of the reported rat sequence 1.

Correspondence: T. Kurihara, Department of Neuropharmacology, Brain Research Institute, Niigata University, Niigata 951, Japan. 0169-328X/89/$03.50 t~) 1989 Elsevier Science Publishers B.V. (Biomedical Division)

248

(a) TCC GCT GAT GCT TAC AAG ATC ATC CCT GGC TCT CGG GCA GAC TTC TCC GAG GCG TAC 240 80 Ser Ala Asp Ala Tyr Lys lle lle Pro Gly Set Arg Ala Asp Phe Ser Glu Ala Tyr AAG CGT CTA GAC GAG GAC CTG GCT GGC TAC TGC CGC CGG GAC ATC AGG GTT CTT GTG CTT 300 Lys Arg Leu Asp Glu Asp Leu Ala Gly Tyr Cys Arg Arg Asp lle Arg Val Leu Val Leu 100 GAT GAT ACC AAC CAC GAG CGG GAG CGG CTG GAT CAG CTT TTT GAA ATG GCA GAC CAG TAT 360 Asp Asp Thr Asn His Glu Arg Glu Arg Leu Asp Gin Leu Phe Glu Met Ala Asp Gin Tyr 120 CAG TAC CAG GTG GTG CTG GTG GAG CCC AAG ACA GCG TGG CGA CTA GAC TGT GCC CAG CTC 420 Gin Tyr Gin Val Val Leu Val Glu Pro Lys Thr Ala Trp Arg Leu Asp Cys Ala Gin Leu 140 AAG GAG AAG AAC CAA TGG CAG CTG TCG GCC GAT GAC CTG AAG AAG CTG AAG CCC GGGCTG 480 Lys Glu Lys Asn Gin Trp Gin Leu Ser Ala Asp Asp Leu Lys Lys Leu Lys Pro Gly Leu 160 GAG AAG GAC TTT CTG CCA CTC TAC TTT GGC TGG TTC CTG ACC AAA AAG AGT TCT GAG ACC 540 Glu Lys Asp Phe Leu Pro Leu Tyr Phe Gly Trp Phe Leu Thr Lys Lys Ser Set Glu Thr 180 CTC CGA AAA GCT GGC CAG GTC TTT CTG GAG GAG CTG GGGAAT CAC AAG GCC TTC AAG AAA 600 Leu Arg Lys Ala Gly Gin Val Phe Leu G1u Glu Leu Gly Asn His Lys Ala Phe Lys Lys 200 620 207

GAG CTT CGA CAC TTT ATT TC Glu Leu Arg His Phe lle Ser

(b) Rat (reported)

LeuAsnProTrpArgSerThrThrThrA1aProArgTrp CTCAATCCGTGGAGAAGTACCACAACGGCACCAAGATGG 183

Rat (changed)

Rat (reported) Rat (changed) Mouse

Rat (reported)

CTCATCGTGGAGAAGTACCACAACGGCACCAAGATG LeuTleValGluLysTyrHisAsnGlyThrLysMet

180

CysLeukeuMetLeuThrArgSerPheLeuA1aLeuGlyGlnThrSerProArgGluTyr TGTCTGCTGATGCTTACAAGATCATTCCTGGCTCTCGGGCAGACTTCTCCGAGGGAGTAC 243 GTGTCTGCTGATGCTTACAAGATCATTCCTGGCTCTCGGGCAGACTTCTCCGAGGAGTAC ValSerAlaAspAlaTyrLysIleIleProG]ySerArgAlaAspPheSerGlu-~luTyr

240

TCCGCTGATGCTTACAAGATCATCCCTGGCTCTCGGGCAGACTTCTCCGAGGCGTAC SerAlaAspAlaTyrLysIleIleProGlySerArgAlaAspPheSerGluAlaTyr

240

LysArgLeuAspGluAspLeuAlaGlyIleLeuProArgAsp AAGCGTCTGGACGAGGACCTGGCTGGCATACTGCCGCGGGAC 285

Rat (changed)

AAGCGTCTGGACGAGGACCTGGCTGGCTACTGCCGCCGGGAC 282 LysArgLeuAspGluAspLeuAlaGlyTyrCysArg-XrgAsp

Mouse

AAGCGTCTAGACGAGGACCTGGCTGGCTACTGCCGCCGGGAC 282 LysArgLeuAspG1uAspLeuAlaGlyTyrCysArgArgAsp

Fig. 1. a: nucleotide sequence of the mouse CNP cDNA probe (437 bp) used in the present study. All the nucleotides were determined in both directions, b: probable sequencing errors in reported rat CNP cDNA. The reported rat sequence 1 between nucleotide 145 and nucleotide 285 was minimally changed to meet matching with bovine6'm, human 7 and mouse cDNA sequences. Rat (reported), reported rat sequence; Rat (changed), changed rat sequence; Mouse, mouse sequence. The nucleotides changed are underlined.

Fig. 2a shows the N o r t h e r n blot for C N P m R N A

the p e r i o d of active m y e l i n a t i o n (25 days) and t h e n

in n o r m a l mice. T w o m R N A bands b e c a m e detect-

d e c r e a s e d gradually. T h e m R N A level in adult brain was very low. T h e two m R N A s w e r e e q u a l in

able at 10 days after birth, r e a c h e d the m a x i m u m at

249

(a) 1

5

(b) N N Q 25 A

10 15 25 40 A

.

Q Q,

g O e~

" 4~p,--'----

,,41------g

Fig. 2. Northern blot analysis of CNP mRNA in brains of normal (a) and quaking (b) mice. a: poly(A) ÷ RNA (6/zg each) from brains of 1-, 5-, 10-, 15-, 25-, 40-day-old and adult (A) normal mice was electrophoresed, b: poly(A) ÷ RNA (6/~g each) from brains of 15-, 25-day-old and adult (A) quaking mice (Q) was electrophoresed. Poly(A) ÷ RNA (6/~g each) from brains of 25-day-old and adult (A) normal mice (N) was also electrophoresed in (b). Poly(A) ÷ RNA electrophoresed was transferred to a nitrocellulose filter and hybridized with the mouse CNP cDNA probe (Fig. la) as described previously2. The upper and lower arrows indicate the positions of 28S and 18S rRNAs, respectively.

concentration with each other at 25 and 40 days; the smaller one, however, seemed dominant when the m R N A level was low (10, 15 days and adult). Fig. 2b shows the Northern blot for CNP m R N A in quaking mice. At all stages of development studied (15, 25 days and adult), the two m R N A bands in quaking mice were markedly reduced as compared with those in normal mice of the same age. When the two m R N A bands were compared with each other, the larger m R N A seemed dominant at 15 and 25 days and the smaller m R N A seemed dominant in adult mice. CNP increases with age, maximally at the period of active myelination 4'5. The present study demonstrated that CNP m R N A is produced maximally at the period of active myelination. This is further evidence that CNP is involved in the process of myelination. The present study also demonstrated that CNP m R N A is reduced in concentration in quaking mouse. This reduction agrees with the reduction of CNP in quaking mouse 5. In contrast

with our results, Vogel and T h o m p s o n 1° found no quantitative difference between normal and quaking mice using bovine c D N A as the probe; the reason is unclear. Reduced C N P m R N A and corresponding reduced CNP in quaking mouse can be regarded as a reflection of the hypomyelination found in quaking mouse 9. Expression of proteolipid protein and myelin basic protein m R N A s is similarly reduced in quaking mouse 3. However, one species of myelinassociated glycoprotein m R N A lacking a 45-base expon portion is much more severely reduced and the other species containing the 45-base exon portion is overexpressed in quaking mouse 2. Myelinassociated glycoprotein seems to involve more directly in the pathogenesis of quaking mouse than proteolipid protein, myelin basic protein and CNP. Two discrete m R N A bands are present in rat I and mouse (Fig. 2) CNPs, but only a single m R N A band is present in bovine 6 and human 7 CNPs. The origin of the two m R N A bands of rat and mouse has not yet been established. Bernier et al.1 suggest that the

250 two m R N A s of rat are produced by alternative splicing near the 5"-end. This study was supported in part by Grants-in-aid 1 Bernier, L., Alvarez, F., Norgard, E.M., Raible, D.W., Mentaberry, A., Shembri, J.G., Sabatini, D.D. and Colman, D.R., Molecular cloning of a 2",3"-cyclic nucleotide 3"-phosphodiesterase: mRNAs with different 5" ends encode the same set of proteins in nervous and lymphoid tissues, J. Neurosci., 7 (1987) 2703-2710. 2 Fujita, N., Sato, S., Kurihara, T., Inuzuka, T., Takahashi, Y. and Miyatake, T., Developmentally regulated alternative splicing of brain myelin-associated glycoprotein mRNA is lacking in the quaking mouse, FEBS Lett., 232 (1988) 323-327. 3 Konat, G., Trojanowska, M., Gantt, G. and Hogan, E.L., Expression of myelin protein genes in quaking mouse brain, J. Neurosci. Res,, 20 (1988) 19-22. 4 Kurihara, T. and Tsukada, Y., 2",3"-Cyclic nucleotide 3"-phosphohydrolase in the developing chick brain and spinal cord, J. Neurochem., 15 (1968) 827-832. 5 Kurihara, T., Nussbaum, J.L. and Mandel, P., 2",3"-Cyclic nucleotide 3"-phosphohydrolase in brains of mutant mice with deficient myelination, J. Neurochem., 17 (1970) 993-997.

for Scientific Research from the Ministry of Education, Science and Culture of Japan (62570362; 63570361). This study was carried out u n d e r the NIBB Cooperative Research Program (88-119). 6 Kurihara, T., Fowler, A.V. and Takahashi, Y., cDNA cloning and amino acid sequence of bovine brain 2", 3"-cyclic-nucleotide 3"-phosphodiesterase, J. Biol, Chem., 262 (1987) 3256-3261; 16754. 7 Kurihara, T., Takahashi, Y., Nishiyama, A. and Kumanishi, T., cDNA cloning and amino acid sequence of human brain 2",3"-cyclic-nucleotide 3"-phosphodiesterase, Biochem. Biophys. Res. Commun., 152 (1988) 837-842. 8 Maxam, A.M. and Gilbert, W., Sequencing end-labeled DNA with base-specific chemical cleavages, Methods Enzymol., 65 (1980) 499-560. 9 Sidman, R.L., Dickie, M.M. and Appel, S.H., Mutant mice (quaking and jimpy) with deficient myelination in the central nervous system, Science, 144 (1964) 309-311. 10 Vogel, U.S. and Thompson, R.J., Molecular cloning of the myelin-specific enzyme 2",3"-cyclic-nucleotide3"-phosphohydrolase, FEBS Lett., 218 (1987) 261-265. 11 Vogel, U.S. and Thompson, R.J., Molecular structure, localization, and possible functions of the myelin-associated enzyme 2",3"-cyclic nucleotide 3"-phosphodiesterase, J. Neurochem., 50 (1988) 1667-1677.