Developmental toxicity and estrogenic potency of zearalenone in zebrafish (Danio rerio)

Aquatic Toxicology 136–137 (2013) 13–21

Contents lists available at SciVerse ScienceDirect

Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox

Developmental toxicity and estrogenic potency of zearalenone in zebrafish (Danio rerio) Katalin Bakos a , Róbert Kovács a , Ádám Staszny a , Dóra Kánainé Sipos a , Béla Urbányi a , Ferenc Müller b , Zsolt Csenki a,∗ , Balázs Kovács a,∗ a Department of Aquaculture, Institute of Environmental and Landscape Management, Faculty of Agricultural and Environmental Sciences, Szent István University, 1. Pater Károly St., H-2100 Gödöllo, ˝ Hungary b Institute of Biomedical Research, School of Clinical and Experimental Medicine, College of Medical and Dental Sciences, University of Birmingham, B15 2TT, Edgbaston, Birmingham, United Kingdom

a r t i c l e

i n f o

Article history: Received 25 October 2012 Received in revised form 26 February 2013 Accepted 5 March 2013 Keywords: Zearalenone (ZEA) Zebrafish toxicity test Tail fin primordium Tail morphology Heart-and-soul (has) phenotype Vitellogenin (Vtg and vtg-1)

a b s t r a c t Zearalenone (ZEA, F2) is one of the most common mycotoxins and the only known mycoestrogen. It enters the food and feed chain from contaminated cereals and infiltrates into sewage or natural waters posing potential threat to exposed livestock, wildlife and humans. Therefore evaluation of its biological effects is of international importance. We performed toxicological tests on zebrafish (Danio rerio) larvae and adults. Developmental toxicity was assessed by an extended (5 days) fish embryo toxicity test (FET). Effects of early ZEA exposure were concentration-dependent with LC50 and LC10 values of 893 and 335 ␮g/L. In larvae exposed to 500 ␮g/L and above, ZEA induced similar phenotype to has (heart-and soul) showing defects in heart and eye development and upward curvature of the body axis. From 250 ␮g/L at 72 hpf the gap in the melanophore streak at the base of the tail fin was missing and the fin fold was abnormal, suggesting disturbance in the development of the adult tail fin primordium. Estrogenic potency was measured on the basis of Vitellogenin (Vtg) protein (adults) levels and relative abundance of vitellogenin1 mRNA (vtg-1) (larvae and adults). qRT-PCR in larvae proved to be sufficient substitute to adult tests and sensitive enough to detect ZEA in 0.1 ␮g/L concentrations, that is close to levels observed in wastewaters. Developmental defects reveal that besides direct estrogenic effects, zearalenone might interact with other ontogenic pathways. © 2013 Elsevier B.V. All rights reserved.

1. Introduction Zearalenone (ZEA, F2) is a nonsteroidal, estrogenic mycotoxin produced as a secondary metabolite of Fusarium spp. growing on cereal crops (corn, wheat, barley, rye, oat) in the field or during storage (Williams et al., 1989; Bennett and Klich, 2003; Bucheli et al., 2008). As one of the most common mycotoxins, its occurrence has widely been studied in foods, fodders and environmental samples. Concentrations varied over a wide range, depending on climatic conditions and agricultural activity. Stored agricultural products have been found to be highly contaminated with ZEA with average concentrations ranging between 5–50 mg/kg and maximum concentrations from 120 to 180 mg/kg (Kuiper-Goodman et al., 1987; Zinedine et al., 2007). The greatest contamination has been detected in corn and corn products (3.1 mg/kg in Europe, 17.5 mg/kg in Africa, 9.83 mg/kg

∗ Corresponding authors. Fax: +36 28 410 804. E-mail addresses: [email protected] (Z. Csenki), [email protected] (B. Kovács). 0166-445X/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.aquatox.2013.03.004

in South-America, 13.2 mg/kg in North-America, 16 mg/kg in Oceania), except for Asia, where the highest levels were found in wheat and rice (up to 600 mg/kg) (Zinedine et al., 2007). Mean yearly ZEA contents were 3–180 and 3–36 ␮g/kg in feed samples of wheat and barley collected in 1987 and 1989–93 in Germany (Müller et al., 1997a, b). The toxin was also detected in soils, drainage water, wastewater influents and effluents, rivers and lakes of the United States, Italy and Poland and ranged up to 220 ng/L (Lagana et al., 2001, 2004; Hartmann et al., 2007; Lundgren and Novak, 2009; Gromadzka et al., 2009; Kolpin et al., 2010; Dudziak, 2011; Maragos, 2012). ZEA is a macrocyclic ␤-resorcylic acid lactone which was described by Urry et al. (1966). The molecule is heat stable, persistent and moderately water-soluble. ZEA and its metabolites are able to bind to estrogen receptors (ER) resulting in estrogenicity that exceeds the activity of most of other naturally occurring nonsteroidal estrogens (phytoestrogens) (Kuiper-Goodman et al., 1987; Bennett and Klich, 2003; Zinedine et al., 2007). Adverse effects produced by ZEA were observed in both laboratory and domestic animals. Most of these effects are consequences of endocrine disruption including the induction of the proliferation

14

K. Bakos et al. / Aquatic Toxicology 136–137 (2013) 13–21

of estrogen-sensitive cells and tissues, feminization of male gonads or reproductive disorders (decreased libido, disturbed reproductive cycle, anovulation, disturbed spermatogenesis, infertility, neoplasmic lesions, altered behavior, decreased fertility of offspring), osteoporosis, myelofibrosis, adenomas and skeletal deformations (Kuiper-Goodman et al., 1987; Williams et al., 1989; Metzler et al., 2010). Genotoxic effects have also been proven by in vitro methods: SOS repair, chromosomal aberration and sister chromatid exchange (Eriksen et al., 2000). Biological effects of ZEA have been studied on several fish species including Atlantic salmon (Salmo salar) (Arukwe et al., 1999), rainbow trout (Oncorhynchus mykiss) (Olsen ´ et al., 2005; Tollefsen et al., 2003; Van den Belt et al., 2003; Wozny et al., 2010), fathead minnow (Pimephales promelas) (Johns et al., 2011) and carp (Cyprinus carpio) (Vanyi et al., 1974; Sandor and Vanyi, 1990). The consequences of short- and long-term ZEA exposure were intersex males, testicular degeneration, decreased sperm production and motility, decreased fertilization success, immune system and growth impairments and dose dependent induction of estrogen-responsive genes like vitellogenin (vtg) and zona radiata protein. Significant Vitellogenin (Vtg) induction was observed after 7 days of exposure following intraperitoneal injection of ZEA (1 and 10 mg/kg) in Atlantic salmon juveniles (Arukwe et al., 1999) and in the liver of rainbow trout following short term exposure ´ (Wozny et al., 2010). The rate of induction was 50% compared to the natural estrogen (E2) (Arukwe et al., 1999), as confirmed later by Le Guevel and Packdel (2001), Olsen et al. (2005), Tollefsen et al. (2003) and Schwartz et al. (2010) in rainbow trout and Atlantic salmon hepatocyte cultures, human endometrial Ishikawa cells, MCF-7 cells (E-SCREEN) and rYES (recombinant yeast estrogen screen expressing rainbow trout estrogen receptor and human estrogen receptor alpha) screens. These authors found that the vitellogenic response to ZEA was 5.4–1439 times lower than that of E2,. However, interspecies differences were detected probably due to inter-assay variation of the estrogen receptor (ER) mediated response. Based on rYES experiments it was concluded that ZEA binds to rainbow trout ERs with 14.8–28.1 times higher affinity than to human ERs (Matthews et al., 2000; Le Guevel and Packdel, 2001). Schwartz et al. (2010, 2011) performed detailed examination on the short- and long-term effects of ZEA in zebrafish. Short-term exposure of adults resulted in reduced spawning frequency. Longterm exposure experiments included a subsequent depuration period, and transgenerational effects of P0 short-term exposure on F1 generation. They found that wet weight, body length, and condition factor (weight × 100/length3 ) of female fish increased which also affected growth and reproductive performance of the F1 generation and shifted the sex of offspring toward females. Both shortand long-term exposures increased Vtg levels but did not affect fertility, hatching, embryo survival and gonad morphology. ´ et al. To reveal the molecular background of ZEA toxicity, Wozny (2012) examined differentially expressed transcripts in the liver and ovary of juvenile rainbow trout exposed to the toxin and identified differentially regulated genes involved in DNA repair and cell cycle control, glycolysis, blood coagulation or iron-storage processes and a cytoskeleton structural element. Based on the consequences and ecotoxicological effects of ZEA evaluated by several studies in vitro and in vivo on cell lines, fish larvae and adults, the contribution of ZEA to environmental estrogens in waters appears to be relatively small (Schwartz et al., 2011; Maragos, 2012). However, ZEA contamination in (fish) food might be of international importance. In major common carp producing countries of Central Europe ZEA may pose potential threat to fish stocks via feeding, as in these countries fish are reared on cereal-based feed, in which the occurrence of ZEA can be relatively high. Jakic-Dimic et al. (2005) found 10–1000 times higher ZEA contamination in corn (5.3 mg/kg), wheat (2.06 mg/kg) and barley

(2.00 mg/kg) in Serbian fish farms than the average concentrations measured in agricultural products. Moreover, toxicity and estrogenic activity of the toxin has not been determined in fish embryos, a sensitive stage of development. Zebrafish is a recommended test species in studying embryotoxic effects (Scholz et al., 2008) and also proved to be suitable for measuring levels of vitellogenin (protein or mRNA) (Van den Belt et al., 2003; Rose et al., 2002; Muncke and Eggen, 2006; Muncke et al., 2007; Schwartz et al., 2010, 2011), the widely used most common biomarker in detecting estrogenic activity (Sumpter and Jobling, 1995). Vitellogenins are synthesized by the liver of oviparous organisms as a nutrient and major precursor of the egg yolk protein, Vitellin, that serves as an energy reserve for the developing embryo. As the expression of the vitellogenin genes is estrogen-dependent, only mature females produce the protein in larger quantities normally. However the presence of estrogenic compounds triggers Vtg synthesis in males and larvae, too (Wallace and Jared, 1968; Lazier and McKay, 1993; Tyler et al., 1996, 1999a,b). Levels of the Vtg protein can be measured in several ways. Previously indirect methods (Alkali Labile Lipid/ALL/, Alkali Labile Phosphate/ALP/assays) (Wallace and Jared, 1968; Kramer et al., 1998) were used all being cost effective and convenient but unspecific. Thus more specific assays were needed, and Vtg-specific enzyme-linked immunosorbent assays (ELISA) were developed (Fenske et al., 2001; Holbech et al., 2001; Tyler et al., 2002; Van den Belt et al., 2003; Liao et al., 2006). These assays require species-specific antibodies and the isolation of the pure protein, making the methods costly. mRNA expression of Vtg gene may also be measured by quantitative real-time PCR also in zebrafish larvae (Muncke and Eggen, 2006; Muncke et al., 2007). In this report our aim was to test the developmental toxicity and estrogenic potency of different ZEA concentrations on zebrafish larvae and to compare the applicability of a duplex real-time PCR method to the conventional ELISA technique in measuring the rate of induction of either Vtg or vtg. 2. Materials and methods 2.1. Fish and maintenance All experiments were performed on a laboratory-bred strain (AB) of zebrafish (Danio rerio). Prior to treatments fish were maintained in a Tecniplast ZebTEC (Tecniplast S.p.a.) recirculation system under standard laboratory conditions (at 27.5 ◦ C with 14 h light–10 h dark cycle). Adults were fed twice a day with complete fish food (zebrafish basic food, Special Diets Services/SDS/) supplemented with freshly hatched live Artemia nauplii twice a week. Fish were placed in breeding tanks (Tecniplast S.p.a.) in the afternoon the day before the experiment and eggs were spawn synchronously the next morning. After harvesting eggs resulting from natural spawning the fertilized and healthy eggs were selected by microscopic observation. 2.2. Chemicals Stock solutions of 17-␤-estradiol (100 ␮g/L) (E2, Sigma–Aldrich) and zearalenone (Sigma–Aldrich) (50 mg/L) were prepared in 96% ethanol (Reanal) and stored at −80 ◦ C until use. 2.3. Embryo test Embryos were placed in 24-well plates (one embryo/well) at 1 h post fertilization (hpf) containing ZEA test solutions of 1 ng/L, 0.1, 1, 5, 10, 25, 50, 100, 250, 500, 750, 1000, 1250, 1500, 1750, 2000, 3000,

K. Bakos et al. / Aquatic Toxicology 136–137 (2013) 13–21

4000, 5000 ␮g/L and incubated at 27.5 ◦ C. As negative control system water and solvent treated embryos (0.001% ethanol) were used. All exposures were carried out in duplicates (2 plates). All larvae were screened daily under a microscope and were examined until 5 days post fertilization (dpf) for survival and lethal endpoints – coagulation, missing heartbeat, tail detachment and developmental abnormalities (yolk sac and pericardial edema, bent spine, abnormal pigmentation, fin and tail malformations, hatching, incomplete development of the head and eyes). The procedure was performed blinded. Digital images of embryos and larvae in lateral orientation were taken every day under a stereomicroscope at 30x magnification (Leica M205 FA, Leica DFC 425C camera, LAS V3.8 software). Data for each treatment group (2 plates) were then merged and analyzed statistically. Concentration response curves were plotted for lethality from which LC10 and LC50 values were calculated for every 24 h up to 120 hpf.

15

then washed in 75% ethanol (Reanal). The pellet was dissolved in RNAse-free water. Concentration and quality was measured by Nanophotometer (Implen) and integrity was checked on agarose gel. RNA samples were DNase treated (Fermentas) to remove genomic DNA contamination. DNase was inactivated with EDTA equimolar to the Mg2+ content of the buffer and 0.5 ␮g of RNA from each sample was reverse transcribed by the High Capacity Reverse Transcription kit of Applied Biosystems. A duplex real-time PCR was designed to measure the mRNA expression of the control gene and vitellogenin in the same tube. As a control gene ␤-actin was chosen (Muncke and Eggen, 2006; Muncke et al., 2007; Liedtke et al., 2008; Jin et al., 2009). Primers (Vtg1 cDNS 1DKF, R, ZF baktin F, R) and TaqMan probes (VtgZF VITE P2-FAM, ZF baktin P-HEX) were designed using Primer3 software (http://simgene.com/Primer3) (Table 1). PCR reactions were assembled in 20 ␮L final volume containing vitellogenin-1 primers (0.132 pM each), vitellogenin-1 probe (0.198 pM), ␤-actin primers (0.33 pM each), ␤-actin probe (0.462 pM), dNTP (0.8 mM), ROX (20x), MgCl2 (2 mM), buffer (10×, Fermentas), and Taq polymerase (0.2 U, Fermentas). Reactions were run in the StepOne Plus real-time PCR system of Applied Biosystems: 95 ◦ C 10 min, 40 cycles of 95 ◦ C 10 s, 54 ◦ C 30 s, 75 ◦ C 1 min. Data were collected at the annellation stage. Ct values were determined and data were analyzed according to the efficiency corrected calculation model of Pfaffl (2001), Pfaffl et al. (2002) with the Relative Expression Software Tool (REST).

2.4. Adult fish exposure Seven sexually mature males were placed in each 3-L tank containing 1000, 10, 0.1 ␮g/L ZEA. 0.1 ␮g/L 17-␤-estradiol was used as positive control, and system water as negative control. Treatments were performed under semi-static conditions, in duplicates. During the 21-day test solution was changed in every 4 days, to ensure the nominal concentrations of the chemical. All tanks were constantly aerated (10 mL/min) and kept at 27.5 ◦ C in 14 h light /10 h dark cycle. Fish were fed once a day with fish food (zebrafish basic food, Special Diets Services/SDS/). Five hundred mL solution was collected from the tanks prior to and after changing solution (in a 4-day period). Samples were stored at −20 ◦ C until analysis and sent to a laboratory accredited for measuring ZEA (Food Analytica Ltd., Bekescsaba, Hungary). Concentrations were measured by HPLC following immunaffinity enrichment.

2.7. ELISA For the ELISA test the BioSense Zebrafish Vitellogenin ELISA Kit was used according the manufacturer’s instructions. Purified Vitellogenin from zebrafish was used as standard. The absorbance was read with Gene5 microplate reader (BioTek) at 492 nm. The concentration of the Vitellogenin protein of each individual was calculated with non-specific binding correction and regression analysis, performed by log-log transformation of the data according the manufacturer’s recommendations.

2.5. Sampling Following exposure 3 pools of 10 living larvae in each pool were collected for RNA isolation. In case of the 1000 ␮g/L group, only 2 pools could be obtained because of high mortality (the concentration was higher than LC50 ). Larvae were sampled randomly from each plate, pools were collected from parallel plates. Larvae were homogenized by using micropestles (VWR International Ltd.). From adult males, a whole body homogenate was prepared individually in PBS according to the instructions of the ELISA kit (BioSense). Homogenates were then divided into two (one for RNA preparation and the other for ELISA) to ensure that samples tested by the two methods are real parallels. Samples were stored at −80 ◦ C until use.

2.8. Statistics One-way analysis of variance (ANOVA) was used to test the effect of ZEA concentrations on the relative abundance of development defects compared to the control. As variances across groups were not equal, comparison of exposure groups was carried out by Dunnett’s T3 post hoc test. On the basis of these no observed effect concentration (NOEC) and lowest observed effect concentration (LOEC) values were determined. Survival curves, LC50 and LC10 were calculated by Probit analysis (Minitab 16.1.1). Concentration–response curves and EC50 values were calculated and all graphs were plotted by Graphpad Prism 4.0. Results (induction rates) of ELISA vs. quantitative real-time PCR and larvae vs. adults were compared with Pearson’s correlation, following normalization of results (presented as percentages). Homogeneity of variance was tested by Levene test, prior to performing the correlation.

2.6. RNA isolation, reverse transcription and quantitative real-time PCR Total RNA was isolated by TRIzol (Invitrogene) and chloroform. RNA was precipitated in chilled isopropanol (VWR) and

Table 1 Sequence and fluorescent labels of the primers and probes used in the quantitative real-time PCR analysis to examine vitellogenin -1 induction in larvae and adult males. Primer/probe name

Gene

Sequence

Fluorescent dye/label

Vtg1 cDNS 1DKR Vtg1 cDNS 2DKF ZF VITE P2 ZF baktin F ZF baktin R ZF baktin P

vitellogenin vitellogenin vitellogenin ␤-actin ␤-actin ␤-actin

5 5 5 5 5 5

– – FAM – – HEX

TGCCAAAAAGCTGGGTAAAC 3 GACATTGTGATCTCTGGAATC 3 ACAGCGAGAAAGAGATTGAACTGAC 3 AGGAGATCACCTCTCTTG 3 CCAGACGGAGTATTACG 3 TGAAGATCAAGATCATTGCTCC 3

16

K. Bakos et al. / Aquatic Toxicology 136–137 (2013) 13–21

Table 2 No observed effect concentrations (NOEC) and lowest observed effect (LOEC) values of abnormalities detected during the embryotoxicity test. Zebrafish embryos were exposed to zearalenone (concentrations ranged between 1 ng/L and 5000 ␮g/L), and screened daily for abnormalities. Data show the lowest concentrations that had (LOEC) or did not have (NOEC) statistically significant adverse effect on the embryos compared with controls (p < 0.0001). hpf

24 48 72 96 120

Edema

Dorsal body axis curvature

Reduced pigmentation

Unhatched larvae

NOEC

LOEC

NOEC

LOEC

NOEC

LOEC

NOEC

LOEC

1000 ␮g/L 750 ␮g/L 50 ␮g/L 50 ␮g/L 50 ␮g/L

1500 ␮g/L 1000 ␮g/L 100 ␮g/L 100 ␮g/L 100 ␮g/L

– 250 ␮g/L 250 ␮g/L 500 ␮g/L 500 ␮g/L

– 500 ␮g/L 500 ␮g/L 750 ␮g/L 750 ␮g/L

– – 500 ␮g/L 25 ␮g/L 25 ␮g/L

– – 750 ␮g 50 ␮g 50 ␮g

– – 750 ␮g/L – –

– – 1000 ␮g/L – –

3. Results 3.1. Embryotoxicity tests To analyze the embryotoxic effects, 1 hpf zebrafish embryos were exposed to different concentrations of zearalenone for five days to detect developmental abnormalities and to determine the lowest concentrations that had (LOEC) or did not have (NOEC) statistically significant adverse effect on the embryos compared with controls (Table 2). In the control groups no deformities were detected. All embryos and larvae showed wild-type phenotype and developed normally having normal eyes, pigmentation, straight trunk and tail and no edema. In concentrations under 50 ␮g/L, ZEA had no effect in any group during the entire experimental period. In higher concentrations, lethal and non-lethal effects appeared in a concentration-dependent manner, varying according to the time of exposure and the concentrations used. There was no delay in hatching in any concentration below 1000 ␮g/L. However, some embryos remained unhatched in this concentration and above. In the first 24 h of exposure, concentrations lower than 1500 ␮g/L did not have toxic effects, embryos developed similarly to the controls. In 1500 ␮g/L and above embryos showed pericardial edema, while in 5000 ␮g/L all embryos stopped development at the tailbud stage after 10 h of exposure. After 48 h, embryos exposed to concentrations lower than 250 ␮g/L still showed normal development. From 500 ␮g/L and above, a dorsal curvature of the body axis accompanied by abnormal heart and eye development was detected. These phenotypes, according to our previous findings, are typical for estrogenic substances (unpublished data). Embryos showed yolk sac and pericardial edema from the concentration of 1000 ␮g/L. All embryos hatched at the latest by 72 hpf, when treated with less than 1000 ␮g/L ZEA. Those that did not hatch in higher concentrations remained unhatched throughout the time span of the experiment. Edema was detected from much lower concentrations (100 ␮g/L, Table 2). For the embryos treated with 500 ␮g/L and above reduced pigmentation, altered eye and heart development and dorsal curvature of the body axis were shown. These defects were more pronounced at higher concentrations (Fig. 1). The degree of curvature was dose dependent with an EC50 of 596 ␮g/L (Fig. 2). Normally at the base of the prospective caudal fin there is a gap in the melanophore streak along the ventral myotomes, and the fin is slightly longer dorsally than ventrally (Fig. 1). In embryos showing bent notochord, this gap was missing and the caudal fin was thin and symmetrical (Fig. 3). Pigmentation was reduced above 500 ␮g/L ZEA treatment. In later stages (96 and 120 hpf) no additional abnormalities were detected, however they appeared at much lower concentrations: edema from 50 ␮g/L, curved body axis from 500 ␮g/L and reduced pigmentation from 50 ␮g/L (Table 2). Some of the curved embryos died within the first 72 h that accounts for higher LOEC values in these stages.

Fig. 1. Dorsal curvature of the body axis in 72 hpf embryos exposed to different concentrations of zearalenone (DE – disintegrated embryo, PE – pericardial edema, YE – yolk sac edema, TM – tail malformation, BS – bent spine). Embryos also showed abnormal heart and eye development.

Concentration–response curves for lethality were plotted from which LC10 and LC50 values were calculated (Fig. 4, Table 3). LC10 values ranged between 335.1 and 1424 ␮g/L (1424, 869.4, 610.1, 456.2 and 335.1 ␮g/L for 24, 48, 72, 96 and 120 hpf Table 3 LC50 and LC10 values determined for zebrafish embryos on the basis of concentration-response curves for 24, 48, 72, 96 and 120 hpf. Exposure concentrations ranged between 1 ng/L and 5000 ␮g/L. hpf

LC50

LC10

24 48 72 96 120

2854 ␮g/L 2067.8 ␮g/L 1298.6 ␮g/L 1099.4 ␮g/L 893 ␮g/L

1424 ␮g/L 869.4 ␮g/L 610.1 ␮g/L 456.2 ␮g/L 335.1 ␮g/L

K. Bakos et al. / Aquatic Toxicology 136–137 (2013) 13–21

17

Fig. 2. Concentration response curve for the dorsal curvature of the body axis (% of total live embryos) detected during the embryo test at 72 hpf.

Fig. 5. Relative expression (mRNA) levels of vitellogenin-1 in 120 hpf zebrafish larvae, normalized to the untreated control and to the mRNA expression of the housekeeping (␤-actin) gene with correction for individual qPCR efficiencies (data were considered significant at *p < 0.05, **p < 0.01, or ***p < 0.001).

3.2. Estrogenic potency of zearalenone in zebrafish larvae

Fig. 3. The gap in the melanophore streak at the base of the caudal fin (indicated by arrowheads) is missing in 72 hpf embryos exposed to 250 ␮g/L and higher zearalenone concentrations.

respectively) in the experiment, while those of LC50 ranged from 893 ␮g/L to 2854 ␮g/L (2854 ␮g/L for 24 hpf, 2067.8 ␮g/L, 1298.6 ␮g/L, 1099.4 ␮g/L and 893 ␮g/L for 48, 72, 96 and 120 hpf).

Fig. 4. Concentration response curves for lethality at 24, 48, 72, 96 and 120 hpf. Embryos were exposed to 1 ng/L to 5000 ␮g/L zearalenone. On the basis of these, LC50 and LC10 values were calculated (Table 3).

It was found that zearalenone induced vtg-1 mRNA expression in a concentration-dependent manner following 120 h of exposure. Low vtg-1 mRNA levels were detected in untreated controls as well, as found previously by Muncke et al. (2007). All concentrations, except for the lowest (0.001 ␮g/L, the mean of which showed no significant difference from the negative control) were able to trigger the response of the biomarker as compared to the control. The highest relative mRNA level was measured in 250 ␮g/L, then the rate of induction started to decline (Fig. 5). Thus, a concentration–response curve was determined on the basis of results obtained for concentrations under 250 ␮g/L. The median effective concentration was 3.247 ␮g/L. Statistical analysis revealed significant differences between the control and treatment groups above 5 ␮g/L (Figs. 5 and 6). vtg-1 induction was also compared to the positive control. The rate of induction observed in 0.1 ␮g/L 17-ß estradiol treated embryos was shown to be between the response to 100 and 250 ␮g/L ZEA.

Fig. 6. Dose–response curve for vitellogenin-1 mRNA induction in 120 hpf zebrafish larvae treated with different concentrations of ZEA (EC50 = 3247 ␮g/L) (negative control: water, positive control: 0.1 ␮g/L 17-␤-estradiol).

18

K. Bakos et al. / Aquatic Toxicology 136–137 (2013) 13–21

Fig. 7. Results of the vitellogenin ELISA in whole body homogentates of adult males. Y axis shows detected amount of Vitellogenin protein (Vtg ng/g fish), X axis shows exposure conditions (negative control: water, positive control: 0.1 ␮g/L 17␤-estradiol) (data were considered significant at *p < 0.05, **p < 0.01, or ***p < 0.001).

3.3. Vitellogenin ELISA and quantitative real-time PCR–comparison of two methods to determine the estrogenic potency of zearalenone in adult males To test if transcriptional vtg-1 induction could be measured by a duplex real-time PCR (qRT PCR), we tested the method on adult zebrafish males. The time of exposure compared to the embryo test was extended to 21 days and the highest concentration used was increased to make sure that a response will be triggered. ZEA concentrations in the incubation tanks were measured analytically and ranged between 64 and 134% of the nominal concentration, but in most of the cases stayed within ±20% (in accordance with OECD guidelines). In the negative control ZEA was below the detection limit. vtg mRNA levels were determined by qRT-PCR and Vtg protein levels by a conventional ELISA technique. We found that all used ZEA concentrations could induce vitellogenin mRNA or protein production in treated males, and in case of the real-time PCR low level of vtg-1 mRNA was also detected in the negative control, as it was seen in the embryo test. In case of ELISA, the level of Vtg induction in the positive control slightly exceeded the level observed in individuals exposed to 10 ␮g/L ZEA (Fig. 7). However, it was not that clear in case of the qRT PCR, as individual differences were very high in this treatment group (Fig. 8). Normalized induction rates detected by ELISA and real-time PCR were compared statistically by Pearson correlation. Results correlated well (R2 = 0.9789, p = 0.0037), supporting the findings of Muncke et al. (2007) that a qRT PCR can be used as alternative transcriptional method to protein analysis in measuring estrogenicity response.

4. Discussion ZEA is among the most common mycotoxins worldwide and the only known mycoestrogen. Its occurrence has been examined extensively. However, the biological effects on fish have been revealed only in larvae and adults of a few species. Toxicity and vtg induction tests in critical life stages of fish have not been reported, yet it may be of crucial importance especially when considering economically important farmed species (e.g. common carp) that are exposed to high ZEA concentrations due to cereal-based feeding.

Fig. 8. Relative vitellogenin-1 mRNA levels normalized to the negative control to ␤-actin abundance in whole body homogenates of adult males exposed to different concentrations of ZEA for 21 days. Y axis shows relative abundance of vtg-1 mRNA, compared to that of the housekeeping gene, X axis shows exposure conditions. Data were corrected by individual qPCR efficiencies and were considered significant at *p < 0.05, **p < 0.01, or ***p < 0.001.

Short and long term (life-cycle exposure) and transgenerational effects of ZEA on zebrafish have been studied previously (Schwartz et al., 2010, 2011). However, the consequences of early stage exposure have not been evaluated. In this study we performed FET test on zebrafish embryos according to the draft proposal for an OECD guideline (2006). The recommended duration of the test is 48 h, which was extended to 120 hpf in order to get comprehensive results and generate samples for vtg induction tests (Muncke et al., 2007). LC10 and LC50 values were determined for 24, 48, 72, 96 and 120 h, and were much higher (10–1000×) than environmental concentrations. This underlies that ZEA exposure to environmentally experienced concentrations is not causing observable effects, confirming little concern for environmental toxicity (as previously suggested by Schwartz et al., 2011; Maragos, 2012). The main abnormality detected during the tests was the upward curvature of the body axis, observed from 250 ␮g/L. This concentration is close to the LC10 value for 120 hpf and to the threshold where vtg-1 mRNA expression starts to decline. According to our previous findings (data unpublished) the phenotype is typical for some estrogenic substances. The degree of the curvature was concentration-dependent. This type of deformation was also described in has (heart and soul) mutants as a consequence of a mutation in the atypical protein kinase C (aPKC) gene. In these mutants the curved tail phenotype is accompanied by enlarged pericardium, epithelial defects in the digestive track, eye and neural tube, most of which was also observed in case of ZEA exposure. has mutation affects the Par3/Par6/aPKC complex that determines cell polarity, epithelial formation and organ morphogenesis in vertebrates and so might also account for abnormal spine orientation (Horne-Badovinac et al., 2001, Peterson et al., 2001). The same phenotype could be induced by the phytoestrogen genistein, the inhibitor of protein tyrosine kinases. Genistein also caused other typical has-phenotype characteristics like haemorrhages, major blood vessel deficiencies, enlarged pericardium and eye development defects (Bakkiyanathan et al., 2010). On the basis of these similarities we suggest that the mycoestrogen ZEA might also act as a kinase inhibitor.

K. Bakos et al. / Aquatic Toxicology 136–137 (2013) 13–21

An interesting developmental effect was also detected, the gap in the melanophore streak along the ventral side at the base of the caudal fin was missing in 72 hpf larvae exposed to 500 ␮g/L ZEA or more. The phenomenon has been observed by Hadzhiev et al. (2007) in Shh (sonic hedgehog) loss-of-function mutants, and recently in response to methyl-mercury (MeHg) exposure (Yang et al., 2010). However, it seemed unlikely that the substance could act directly on the Shh signaling pathway. MeHg also caused effects that are typical to ZEA exposure, like altered pigmentation, smaller and less well-structured tail fin fold, in which upregulation of tissue remodeling metalloproteases (Mmp9 and Mmp13) might play a role. The phenotype could only be triggered by MeHg and no other metal compounds. MeHg also proved to be an endocrine disruptor (Darbre, 2006; Georgescu et al., 2011), so its mode of action underlying these specific phenotypes might be the same as for ZEA. Elevated Vtg levels were observed in zebrafish males too, treated with ZEA in a flow-through system for 21 days (Schwartz et al., 2010). Induction was measured by ELISA from the blood plasma. ELISA tests could hardly be performed on larvae because of the small samples obtained. Therefore a quantitative real-time PCR method was developed (Muncke and Eggen, 2006; Muncke et al., 2007). Due to the differences in RNA and protein stability and regulation processes and fundamentally different evaluation methods of the detection techniques (absolute vs. relative quantification), RNA and protein results were not directly comparable. Therefore, an indirect comparison of normalized results was carried out and showed that induction rates correlated well (R2 = 0.9789, p = 0.0037). Analytical measurements demonstrated that the detected concentrations remained within the permitted range of ±20% of the nominal concentration (according to OECD protocols), so changes in concentration could not significantly affect results. We found that mRNA measurement could provide sensitive detection of estrogenic effects regardless of the difference in half-life. This indirect comparison could provide valuable information for toxicology studies which address overall response of vitellogenin expression changes upon ZEA exposure. Transcriptional vtg-1 induction in larvae and adults could be detected from 0.1 ␮g/L that is in the range of ZEA concentrations detected in wastewaters. EC50 level was 3.247 ␮g/L, which is about 100 times higher than environmentally relevant concentrations and 53.5× lower than the EC50 value of transcriptional vtg-1 induction for EE2 in 5 dpf zebrafish larvae (Muncke et al., 2007). Considering that the ratio between EC50 values for E2 and EE2 is about 1:16.48 (Rose et al., 2002), based on the results of this study, ZEA seems to be 882.3× less potent than E2 in zebrafish, which is in the range of previous findings described above. In the larvae, highest vtg-1 mRNA level was detected in response to 250 ␮g/L ZEA, then the induction rate started to decline. This concentration is close to the LC10 value (335.1 ␮g/L) detected in the embryotoxicity test for 120 h, so lower vtg-1 response might be due to less active vital processes. Results of the real-time PCR measurements on 5 dpf larvae were also compared to adults, and found to correlate well with a correlation coefficient of 0.998, (p = 0.002). However, only two ZEA concentrations and the positive control could be compared and exposure times were different. Probably, vtg-1 levels in adult males reached the maximal level even after 5 days of exposure and the induction did not change significantly further on as found by Rose et al. (2002) in case of E2 and EE2. As previously described by Jin et al. (2009), zebrafish seems to be more sensitive to estrogenic substances (like E2 and nonylphenol) in early developmental stages. However, juveniles and adults showed higher induction levels in their experiment. Here we also found that larvae were greatly sensitive especially to higher toxicant levels (1000 ␮g/L ZEA). Muncke and Eggen (2006), Muncke et al. (2007) also developed a reliable system for testing estrogenicity on the basis of mRNA expression analysis in zebrafish

19

larvae. Although the metabolic capacity in different developmental stages may differ, estrogen receptors are expressed in the very early stage of development in zebrafish (Chandrasekar et al., 2010). The uptake of the substance via boundary surfaces (such as the chorion) could also be a limiting factor. We have found that the response of dechorionated embryos was similar to the response in those with chorion (unpublished data). Our results confirm previous findings that zebrafish larvae make good alternatives to adult protein-based tests in screening the effects of low concentrations of estrogenic substances, such as ZEA. 5. Summary and conclusions We have evaluated the developmental toxicity of zearalenone on zebrafish larvae exposed to different concentrations for 5 days and determined nominal LC50 , LC10 , NOEC and LOEC values in every 24 h (24, 48, 72, 96, 120 hpf) and EC50 for vtg-1 mRNA induction at 120 hpf. The recorded abnormalities varied according to the concentration and developmental stage. Besides general toxic effects such as edemas, a developmental phenotype reminiscent to the heart and soul (has) mutant and the lack of the pigmentation gap at the base of the caudal fin were also detected. These might indicate an indirect consequence of endocrine disruption. However, the underlying molecular background needs to be further investigated. Estrogenic potency of ZEA was confirmed in adult males and even in the larval stage on the basis of vtg-1 mRNA induction. In adult males, Vtg protein levels were also determined. For larval examinations we developed a duplex quantitative real-time PCR system, the applicability of which was tested on adults as well. Comparison of results revealed that ELISA and real time PCR methods correlate well as well as larval and adult vitellogenin induction rates. The results confirm the feasibility of the use of zebrafish larvae and real-time PCR methods for screening the estrogenic potency of chemicals, making examinations cheaper, faster and simpler than if life cycle tests are required. Moreover, in accordance with the new EU Directive 2010/63/EU and relevant national directives on the protection of animals used for scientific purposes, this approach of using larvae before the free feeding stage leads to efficient replacement of protected animals by non-protected larvae. We found that zebrafish are sensitive enough to detect ZEA concentrations observed in wastewaters. However, long-term exposures could also enable the detection of environmentally relevant levels. For evaluating the real threat posed by ZEA on fish, further long-term studies would be required. Environmental concentrations of ZEA in waters were found to be relatively low, so the contribution of the toxin to environmental estrogens in waters appears to be relatively small. On the other hand, besides ecotoxicological risk, ZEA also represents potential nutritional and health hazard. As high ZEA concentrations were found in fish feed, commercial species may be exposed to much higher concentrations via feeding, leading to adverse reproductive health and developmental effects. To reveal the real threat to farmed fish, feeding experiments should also be conducted. Embryotoxic effects described here suggest that similar developmental abnormalities may occur in some farmed fish species. Acknowledgements This work was supported by the Gábor Baross (HALEDC09REG-KM-09-2-2009-0066), OTKA (NNF 78834), Mycostop (NKTH TÁMOP-4.2.2.B-10/1-2010-0011, TECH 08-A3/2-2008-0385), TÁMOP-4.2.1.B-11/2KMR-2011-0003 research programmes and the ZF–Health Integrating project of Framework 7 by the European Commission. The authors gratefully acknowledge Dóra Bencsik and Annamária Holes for their assistance in the sampling sessions

20

K. Bakos et al. / Aquatic Toxicology 136–137 (2013) 13–21

or real-time PCR experiments, and Éva Fetter for helping in the evaluation of those results.

References Arukwe, A., Grotmol, T., Haugen, T.B., Knudsen, F.R., Goksoyr, A., 1999. Fish model for assessing the in vivo estrogenic potency of the mycotoxin zearalenone and its metabolites. Science of the Total Environment 236, 153–161. Bakkiyanathan, A., Joseph, A.M., Tharani, L., Malathi, R., 2010. Genistein, the phytoestrogen induces heart-and-soul (has) phenotypes in zebrafish embryo. Journal of Developmental Biology and Tissue Engineering 2 (2), 18–22. Bennett, J.W., Klich, M., 2003. Mycotoxins. Clinical Microbiology Reviews 16, 497–516. Bucheli, T.D., Wettstein, F.E., Hartmann, N., Erbs, M., Vogelgsang, S., Forrer, H.R., Schwarzenbach, R.P., 2008. Fusarium mycotoxins: overlooked aquatic micropollutants? Journal of Agricultural and Food Chemistry 56, 1029–1034. Chandrasekar, G., Archer, A., Gustafsson, J-A., Andersson Lendahl, M., 2010. Levels of 17␤-estradiol receptors expressed in embryonic and adult zebrafish following in vivo treatment of natural or synthetic ligands. PLoS ONE 5 (3), e9678. Darbre, P.D., 2006. Metalloestrogens: an emerging class of inorganic xenoestrogens with potential to add to the oestrogenic burden of the human breast. Journal of Applied Toxicology 26, 149–153. Dudziak, M., 2011. Analysis of zearalenone in aqueous environment using GC-MS. Polish Journal of Environmental Studies 20 (1), 231–235. Eriksen, G.S., Pennington J., Schlatter J., Alexander, J., Thuvander, A., 2000. Safety evaluation of certain food additives and contaminants. WHO Food Additives Series, 44. Fenske, M., van Aerle, R., Brack, S., Tyler, C.R., Segner, H., 2001. Development and validation of a homologous zebrafish (Danio rerio Hamilton Buchanan) vitellogenin enzyme-linked immunosorbent assay (ELISA) and its application for studies on estrogenic chemicals. Comparative Biochemistry and Physiology. C: Comparative Pharmacology 129, 217–232. Georgescu, B., Georgescu, C., D˘ar˘aban, S., Bouaru, A., Pas¸cal˘au, S., 2011. Heavy metals acting as endocrine disrupters. Journal of Animal Science and Biotechnology 44 (2), 89–93. ´ ´ Gromadzka, K., Wa´skiewicz, A., Golinski, P., Swietlik, J., 2009. Occurrence of estrogenic mycotoxin – Zearalenone in aqueous environmental samples with various NOM content. Water Research 43 (4), 1051–1059. Hadzhiev, Y., Lele, Z., Schindler, S., Wilson, S.W., Ahlberg, P., Strähle, U., Müller, F., 2007. Hedgehog signaling patterns the outgrowth of unpaired skeletal appendages in zebrafish. BMC Developmental Biology 7, 75. Hartmann, N., Erbs, M., Wettstein, F.E., Schwarzenbach, R.P., Bucheli, T.D., 2007. Quantification of estrogenic mycotoxins at the ng/L level in aqueous environmental samples using deuterated internal standards. Journal of Chromatography A 1138 (1–2), 132–140. Holbech, H., Andersen, L., Petersen, G.I., Korsgaard, B., Pedersen, K.L., Bjerregaard, P., 2001. Development of an ELISA for vitellogenin in whole body homogenate of zebrafish (Danio rerio). Comparative Biochemistry and Physiology. C: Comparative Pharmacology 130, 119–131. Horne-Badovinac, S., Lin, D., Waldron, S., Schwarz, M., Mbamalu, G., Pawson, T., Jan, Y-N., Stainier, D.Y.R., Abdelilah-Seyfried, S., 2001. Positional cloning of heart and soul reveals multiple roles for PKC(in zebrafish organogenesis. Current Biology 11, 1492–1502. Jakic-Dimic, D., Jeremic, S., Nesic, K., Radosavljevic, V., 2005. The influence of mycotoxins in food on fish health status. Matica Srpska Proceedings for Natural Sciences 109, 73–79. Jin, Y., Chen, R., Sun, L., Qian, H., Liu, W., Fu, Z., 2009. Induction of estrogenresponsive gene transcription in the embryo, larval, juvenile and adult life stages of zebrafish as biomarkers of short-term exposure to endocrine disrupting chemicals. Comp Biochem Phys C 150, 414–420. Johns, S.M., Denslow, N.D., Kane, M.D., Watanabe, K.H., Orlando, E.F., Sepúlveda, M.S., 2011. Effects of estrogens and antiestrogens on gene expression of fathead minnow (Pimephales promelas) early life stages. Environmental Toxicology 26 (2), 195–206. Kolpin, D.W., Hoerger, C.C., Meyer, M.T., Wettstein, F.E., Hubbard, L.E., Bucheli, T.D., 2010. Phytoestrogens and mycotoxins in Iowa streams: an examination of underinvestigated compounds in agricultural basins. Journal of Environmental Quality 39, 2089–2099. Kramer, V.J., Miles-Richardson, S., Piernes, S.L., Giesy, J.P., 1998. Reproductive impairment and induction of alkaline-labile phosphate, a biomarker of estrogen exposure, in fathead minnows Pimephales promelas exposed to water-borne 17␤-estradiol. Aquatic Toxicology 40, 335–360. Kuiper-Goodman, T., Scott, P.M., Watanabe, H., 1987. Risk assessment of the mycotoxin zearalenone. Regulatory Toxicology and Pharmacology 7, 253–306. Lagana, A., Bacaloni, A., De Leva, I., Faberi, A., Fago, G., Marino, A., 2004. Analytical methodologies for determining the occurrence of endocrine disrupting chemicals in sewage treatment plants and natural waters. Analytica Chimica Acta 501, 79–88. Lagana, A., Fago, G., Marino, A., Santarelli, D., 2001. Development of an analytical system for the simultaneous determination of anabolic macrocyclic lactones in aquatic environmental samples. Rapid Communications in Mass Spectrometry 15, 304–310.

Lazier, C.B., McKay, M.E., 1993. Vitellogenin gene expression in teleost fish. In: Hochachka, P.W., Mommsen, T.P. (Eds.), Biochemistry and Molecular Biology of Fishes, vol. 2. Elsevier, Amsterdam, pp. 391–405. Le Guevel, R., Packdel, F., 2001. Assessment of oestrogenic potency of chemicals used as growth promoter by in-vitro methods. Human Reproduction 16, 1030–1036. Liao, T., Jin, S., Yang, F.X., Hui, Y., Xu, Y., 2006. An enzyme-linked immunosorbent assay for rare minnow (Gobiocypris rarus) vitellogenin and comparison of vitellogenin responses in rare minnow and zebrafish (Danio rerio). Science of the Total Environment 364, 284–294. Liedtke, A., Muncke, J., Rüfenacht, K., Eggen, R.I.L., 2008. Molecular multi-effect screening of environmental pollutants using the MolDarT. Environmental Toxicology 23 (1), 59–67. Lundgren, M.S., Novak, P.J., 2009. Quantification of phytoestrogens in industrial waste streams. Environmental Toxicology and Chemistry 28, 2318–2323. Maragos, C.M., 2012. Zearalenone occurrence in surface waters in central Illinois, USA. Food Additives and Contaminants: Part B Surveillance 5 (1), 55–64. Matthews, J., Celius, T., Halgren, R., Zacharewski, T., 2000. Differential estrogen receptor binding of estrogenic substances: a species comparison. Journal of Steroid Biochemistry 74, 223–234. Metzler, M., Pfeiffer, E., Hildebrand, A.A., 2010. Zearalenone and its metabolites as endocrine disrupting chemicals. World Mycotoxin Journal 3 (4), 385–401. Muncke, J., Eggen, R.I.L., 2006. Vitellogenin 1 mRNA as an early molecular biomarker for endocrine disruption in developing zebrafish (Danio rerio). Environmental Toxicology and Chemistry 25 (10), 2734–2741. Muncke, J., Junghans, M., Eggen, R.I.L., 2007. Testing estrogenicity of known and novel (xeno-)estrogens in the MolDarT using developing zebrafish (Danio rerio). Environmental Toxicology 22 (2), 185–193. Müller, H.M., Reimann, J., Schumacher, U., Schwadorf, K., 1997a. Natural occurrence of Fusarium toxins in barley harvested during five years in an area of southwest Germany. Mycopathologia 137, 185–192. Müller, H.M., Reimann, J., Schumacher, U., Schwadorf, K., 1997b. Fusarium toxins in wheat harvested during six years in an area of southwest Germany. Natural Toxins 5, 24–30. Olsen, C.A., Meussen-Elholm, E.T.M., Hongslo, J.K., Stenersen, J., Tollefsen, K.E., 2005. Estrogenic effects of environmental chemicals: An interspecies comparison. Comparative Biochemistry and Physiology. C: Comparative Pharmacology 141, 267–274. OECD Guidelines for testing of Chemicals – Fish, Acute Toxicity Test. No. 203–17/07/1992. OECD Draft proposal for a new guideline: fish embryo toxicity (FET) test, 2006. Peterson, R.T., Mably, J.D., Chen, J.N., Fishman, M.C., 2001. Convergence of distinct pathways to heart patterning revealed by the small molecule concentramide and the mutation heart-and-soul. Current Biology 11, 1481–1491. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29 (9), e45. Pfaffl, M.W., Horgan, G.W., Dempfle, L., 2002. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Research 30 (9), 36. Rose, J., Holbech, H., Lindholst, C., Nˇrrum, U., Povlsen, A., Korsgaard, B., Bjerregaard, P., 2002. Vitellogenin induction by 17␤-estradiol and 17␣-ethinylestradiol in male zebrafish (Danio rerio). Comparative Biochemistry and Physiology. C: Comparative Pharmacology 131, 531–539. Sandor, G., Vanyi, A., 1990. Mycotoxin research in the Hungarian Central Veterinary Institute. Acta Veterinaria Hungarica 38 (1–2), 61–68. Scholz, S., Fischer, S., Gündel, U., Küster, E., Luckenbach, T., Voelker, D., 2008. The zebrafish embryo model in environmental risk assessment-applications beyond acute toxicity testing. Environmental Science and Pollution Research 15 (5), 394–404. Schwartz, P., Bucheli, T.D., Wettstein, F.E., Burkhardt-Holm, P., 2011. Life-cycle exposure to the estrogenic mycotoxin zearalenone affects zebrafish (Danio rerio) development and reproduction. Environmental Toxicology (available online) http://onlinelibrary.wiley.com/advanced/search/results Schwartz, P., Thorpe, K.L., Bucheli, T.D., Wettstein, F.E., Burkhardt-Holm, P., 2010. Short-term exposure to the environmentally relevant estrogenic mycotoxin zearalenone impairs reproduction in fish. Science of the Total Environment 409, 326–333. Sumpter, J.P., Jobling, S., 1995. Vitellogenesis as a biomarker for estrogenic contamination of the aquatic environment. Environmental Health Perspectives 103, 173–178. Tollefsen, K.E., Mathisen, R., Stenersen, J., 2003. Induction of vitellogenin synthesis in an Atlantic salmon (Salmo salar) hepatocyte culture: a sensitive in vitro bioassay for the oestrogenic and antioestrogenic activity of chemicals. Biomarkers 8, 394–407. Tyler, C.R., Van Aerle, R., Hutchinson, T.H., Maddix, S., Trip, H., 1999a. An in vivo testing system for endocrine disruption in fish early life stages using induction of vitellogenin. Environmental Toxicology and Chemistry 18, 337–347. Tyler, C.R., van der Eerden, B., Jobling, S., Panter, G., Sumpter, J.P., 1996. Measurement of vitellogenin, a biomarker for exposure to estrogenic chemicals, in a wide variety of cyprinid fish. Journal of Comparative Physiology B 166, 418–426. Tyler, C.R., van Aerle, R., Nilsen, M.V., Blackwell, R., Maddix, S., Nilsen, B.M., Berg, K., Hutchinson, T.H., Goksøyr, A., 2002. Monoclonal antibody enzyme-linked immunosorbent assay to quantify vitellogenin for studies on environmental

K. Bakos et al. / Aquatic Toxicology 136–137 (2013) 13–21 estrogens in the rainbow trout (Oncorhynchus mykiss). Environmental Toxicology and Chemistry 21 (1), 47–54. Tyler, C.R., van Aerle, R., Hutchinson, T.H., Maddix, S., Trip, H., 1999b. An in vivo testing system for endocrine disruptors in fish early life stages using induction of vitellogenin. Environmental Toxicology and Chemistry 18, 337–347. Urry, W.H., Wehrmeister, H.L., Hodge, E.B., Hidy, P.H., 1966. The structure of zearalenone. Tetrahedron Letters 27, 3109–3114. Van den Belt, K., Verheyen, R., Witters, H., 2003. Comparison of vitellogenin responses in zebrafish and rainbow trout following exposure to environmental estrogens. Ecotoxicology and Environment Safety 56, 271–281. Vanyi, A., Buza, L., Széka, A., 1974. Fusariotoxicosis IV. The effect of F-2 toxin (zearalenone) on the spermiogenesis of the carp. Hungarian Veterinary Journal 29, 457–461. Wallace, R.A., Jared, D.W., 1968. Studies on amphibia yolk. VII. Serum phosphoprotein synthesis by vitellogenic females and estrogen-treated males of Xenopus laevis. Canadian Journal of Biochemistry 46, 953–959.

21

Williams, B.A., Mills, K.T., Burroughs, C.D., Bern, H.A., 1989. Reproductive alterations in female C57BLCrgl mice exposed neonatally to zearalenone, an estrogenic mycotoxin. Cancer Letters 46 (3), 225–230. ´ Wozny, M., Brzuzan, P., Wolinska, L., Góra, M., Luczynski, K.M., 2010. Preliminary evaluation of ER and AhR-mediated gene expression patterns in rainbow trout (Oncorhynchus mykiss) liver after short-term exposure to zearalenone in binary mixtures. Environmental Biotechnology 6 (1), 16–23. ´ ´ ´ Wozny, M., Brzuzan, P., Wolinska, L., Góra, M., Łuczynski, M. K., 2012. Differential gene expression in rainbow trout (Oncorhynchus mykiss) liver and ovary after exposure to zearalenone. Comparative Biochemistry and Physiology. C: Comparative Pharmacology, 156 (3-4), 221-228. Yang, L., Ho, N.Y., Müller, F., Strähle, U., 2010. Methyl mercury suppresses the formation of the tail primordium in developing zebrafish embryos. Toxicological Sciences 115 (2), 379–390. ˜ Zinedine, A., Soriano, J.M., Moltó, J.C., Manes, J., 2007. Review on the toxicity, occurrence, metabolism, detoxification, regulations and intake of zearalenone: an oestrogenic mycotoxin. Food and Chemical Toxicology 45 (1), 1–18.