Developmentally regulated gene expression of Th2 cytokines in the brain

Brain Research 870 (2000) 27–35 www.elsevier.com / locate / bres

Research report

Developmentally regulated gene expression of Th2 cytokines in the brain a,b , c a,b a Amy E. Lovett-Racke *, Mary E. Smith , LaChelle R. Arredondo , Patrice S. Bittner , a,b d d a,b,e Robert B. Ratts , Carey L. Shive , Thomas G. Forsthuber , Michael K. Racke b

a Department of Neurology, Washington University School of Medicine, St. Louis, MO, USA Department of Neurology, University of Texas–Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75235 -9036, USA c DAIDS, NIAID, National Institutes of Health, Bethesda, MD, USA d Department of Pathology, Case Western Reserve University, Cleveland, OH, USA e Center for Immunology, University of Texas–Southwestern Medical Center, Dallas, TX, USA

Accepted 11 April 2000

Abstract Given the critical role of cytokines in the regulation of an inflammatory response, we investigated whether certain cytokines are expressed in the brains of normal mice during maturation that could contribute to the immune-privileged nature of the CNS or potentially influence an immune-mediated illness such as experimental allergic encephalomyelitis. The gene expression of IFNg (Th1 cytokine) and IL-4 (Th2 cytokine) was analyzed in the brain of several strains of mice. IFNg was not detectable. However, IL-4 was present in the brains of neonatal mice, but not adult mice. Resident CNS cells are believed to be the source of the IL-4, because mice deficient in T cells (SCID and RAG22 / 2) expressed the IL-4 gene in the CNS. Further analysis indicated that the gene expression of the Th2 cytokine transcription factor, GATA-3, correlated with IL-4 and IL-10 expression in the brain. Since GATA-3-deficient mice have an abnormal CNS, brain-derived Th2 cytokines may play an important role in CNS development, as well as potentially contribute to the immune-privileged nature of the brain.  2000 Elsevier Science B.V. All rights reserved. Theme: Development and regeneration Topic: Developmental genetics Keywords: Experimental allergic encephalomyelitis; GATA-3; Immune-privilege; Interleukin-4; Interleukin-10

1. Introduction Certain tissues have been described as immune privileged because allografts within these tissues have prolonged or indefinite survival. Immune privileged sites include the eye, testis, ovary, adrenal cortex, liver, hair follicles and brain [2]. Our understanding of the mechanisms that provide privilege has evolved over the past 50 years. It was initially believed that sites such as the brain lacked lymphatic drainage [21], but this was later refuted [5]. However, we now know that the tight junctions of the *Corresponding author. Present address: Department of Neurology, University of Texas–Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75235-9036, USA. Tel.: 11-214-648-2315; fax: 11214-648-9129. E-mail address: [email protected] (A.E. Lovett-Racke)

blood–brain barrier (BBB) prevent large molecules and cells from exiting the vasculature and entering the brain parenchyma [8]. Consequently, immune surveillance is limited in the brain. In addition, resident cells of the brain express little, if any, MHC molecules which significantly reduces the opportunity for lymphocytes to recognize antigens in the brain [12,18,28,35]. Although Fas ligand (FasL) expression in the anterior chamber of the eye was recently found to induce apoptosis in lymphocytes that enter that site [11], it is unclear whether FasL is expressed in normal brain [27,31]. However, some resident central nervous system (CNS) cells are capable of expressing FasL under adverse conditions, such as malignancy and multiple sclerosis [6,27,31]. The cytokine, transforming growth factor beta (TGFb), appears to downregulate the immune response in the brain. This results in a positive role of TGFb in autoimmune and viral diseases of the CNS

0006-8993 / 00 / $ – see front matter  2000 Elsevier Science B.V. All rights reserved. PII: S0006-8993( 00 )02398-2

A.E. Lovett-Racke et al. / Brain Research 870 (2000) 27 – 35

28

in which inflammation is responsible for the pathology [7,26]. In contrast, malignancies of the CNS where T cells play a critical role in eliminating the tumor, TGFb secreted by CNS tumors may inhibit an effective immune response against the tumor [34]. Understanding the mechanisms that underlie the immune privileged nature of the brain, as well as conditions that compromise this status, are important in understanding how immune-mediated diseases of the CNS, such as multiple sclerosis (MS), are initiated and perpetuated. Given the critical role of cytokines in the induction and regulation of experimental allergic encephalomyelitis (EAE), an animal model of MS [22], we investigated whether certain cytokines are present in normal brains of several strains of mice during maturation. The gene expression of IFNg, a pro-inflammatory Th1 cytokine, and IL-4, an anti-inflammatory Th2 cytokine, were analyzed. Both EAE-resistant and EAE-susceptible strains of mice were used in this study to determine if susceptibility to disease correlated with endogenous expression of either of these cytokines in the brain.

2. Materials and methods

2.1. Mice and tissues B10.PL, B10.S, B6 and SJL / J mice were bred at the Washington University School of Medicine pathogen-free animal facility. IL-4KO [16] and IL-5KO [15] mice were a generous gift from Eric Pearlman (Case Western Reserve University, Cleveland, Ohio). SCID and RAG22 / 2 mice were bred at Case Western Reserve University under pathogen-free conditions. A total of 60 mice were used in this study. Mice were anesthetized with methoxyflurane before being sacrificed. Tissues (lung, kidney, small intestine, thymus, spleen, heart, liver and brain) were removed from mice and placed in 2 ml of Trizol (Life Technologies, Gaithersburg, MD). Only non-perfused mice were used because young mice can not be efficiently perfused.

2.2. RNA isolation and cDNA preparation Tissues were homogenized in Trizol with an 18G needle and RNA was extracted according to the manufacturer’s

instructions. RNA (2.5 mg) was reverse transcribed into cDNA using the Ready-To-Go T-Primed First Strand cDNA kit (Pharmacia Biotech, Piscataway, NJ) with an additional 0.2 mg of random primers.

2.3. Determination of gene expression by PCR The quality of the tissue cDNA was determined by PCR amplification of the housekeeping gene HPRT. The PCR reactions included 1 / 40 of the cDNA sample, 5 mM of each primer, 200 mM dNTPs (Perkin-Elmer, Foster City, CA), and 1.25 U of Taq polymerase (Life Technologies, Gaithersburg, MD) in buffer supplied by the polymerase manufacturer in a final volume of 50 ml. The PCR conditions were 948C for 1 min, 558C for 1 min and 728C for 1.5 min for 20 cycles. The PCR products were run on a 1% agarose gel containing ethidium bromide. The PCR products were transferred from the gel to nylon membranes by capillary transfer and hybridized with an internal oligonucleotide probe (see Table 1) as previously described [20]. The cDNA samples were diluted, if necessary, to give similar HPRT signals on Southern blots. In order to semi-quantitate the amount of message present in each tissue sample, the PCR products for all reactions and primers sets was below detection by ethidium bromide staining to ensure that the saturation point of the PCR reactions was not reached. The PCR conditions were 948C for 1 min., 558C for 1 min. and 728C for 1.5 min. for 20 cycles (HPRT), 25 cycles (IFNg, IL-10 and CD3g) or 30 cycles (IL-4 and GATA-3). The bands on the blots were quantitated using a Storm 860 (Molecular Dynamics, Sunnyvale, CA). Relative gene expression of cytokines genes was determined by calculating the ratio of the quantity of cytokine gene expression to the quantity of HPRT gene expression.

3. Results

3.1. IL-4 and IFNg gene expression in mouse tissues during development To determine if endogenous cytokine expression in the brain may be a mechanism which contributes to the CNS immune-privileged nature, we determined the relative gene expression of IFNg and IL-4 in the brain of several strains

Table 1 Oligonucleotide primers and probes Gene

Sense primer

Anti-sense primer

Probe

HPRT IL-4 IFNg IL-10 CD3g GATA3

GTTGGATACAGGCCAGACTTTGTTG GAATGTACCAGGAGCCATATC AACGCTACACACTGCATCTTGG CGGGAAGACAATAACTG ATGGAGCAGAGGAAGGGTCTG AGCCCCTTCTCCAAGACGTCCATC

GATTCAACTTGCGCTCATCTTAGGC CTCAGTACTACGAGTAATCCA GACTTCAAAGAGTCTGAGG CATTTCCGATAAGGCTTGG TCACTTCTTCCTCAGTTGGTT ACACTCCCTGCCTTCTGTGCTGGA

GTTGTTGGATATGCCCTTGAC AGGGCTTCCAAGGTGCTTCGCATATT GGAGGAACTGGCAAAAGGA GGACTGCCTTCAGCCAGGTGAAGACTTT GGAGACGGTTCTGTACTTCTG TCTTCACCTTCCCGCCCACCCCGAA

A.E. Lovett-Racke et al. / Brain Research 870 (2000) 27 – 35

of mice during maturation. Initially, we examined whether there was an unusually high gene expression of IL-4 or IFNg in the brain relative to other tissues. The lung, kidney, small intestine, thymus, brain, spleen, heart and liver were removed from non-perfused healthy mice at age 1, 3, 7, 10 and 14 days, as well as adult mice (.6 week old). Non-perfused mice were used because neonatal mice can not be efficiently perfused. Fig. 1a,b show the relative gene expression of IL-4 and IFNg at day 7 and 14, as well as adulthood in B10.S mice. The brain shows very little cytokine expression except for IL-4 expression at day 7

29

which is comparable to the level of IL-4 expression in the spleen. Fig. 1c is the Southern blot of the IL-4 expression in the various tissues demonstrating the high level of expression in the brain at day 7 which is significantly reduced by day 14. Comparable IL-4 gene expression was seen in the brains of EAE-resistant strains (B10.S and B6) and EAE-susceptible strains (B10.PL and SJL / J). Data from the different strains of mice is presented throughout the paper. IL-4 gene expression was seen in about 50% of 1 day old B10.S, B10.PL, B6 and SJL / J mice (data not shown). IL-4 expression was seen in almost all mice

Fig. 1. The IL-4 gene is expressed in the brains of neonatal mice. (a) The relative gene expression of IL-4 normalized to HPRT was determined in various tissues of 7-, 14-day old, and adult B10.S mice. The data shown is from individual mice that were analyzed simultaneously. (b) The relative gene expression of IFNg normalized to HPRT is shown from the same samples used in (a). (c) The Southern blot of IL-4 expressed in 7 and 14 day old tissues which was semi-quantitated in (a) is shown. The ‘no cDNA’ lane is the negative control illustrating that there was no contaminating DNA. The ‘con A spl’ lane is the positive control for each experiment. The cDNA for these reactions was obtained from mouse splenocytes that were stimulated in vitro with the mitogen, concanavalin A, which non-specifically activates T cells.

30

A.E. Lovett-Racke et al. / Brain Research 870 (2000) 27 – 35

examined at 3–10 days of age in the strains B10.S, B10.PL and B6 (SJL / J mice were not examined at these ages). In contrast, IL-4 gene expression was only seen in about 10% of adult mice and when detected, the level in adult mice was usually 5–10-fold lower than the level in the 3–10 day old mice. As expected, immune organs (thymus and spleen) constitutively expressed high levels of IFNg and IL-4 mRNA (Fig. 1).

3.2. T lymphocytes are not the source of IL-4 in neonatal mouse brains To determine if the source of the IL-4 was coming from the T lymphocytes in the blood contaminating the tissue, we examined the gene expression of CD3g chain of the T cell receptor. As seen in Fig. 2, there is very little CD3g expression in the 3 and 7 day old B10.PL mice, yet significant levels of IL-4 message are present. In contrast, CD3g transcripts were readily detected in the adult mice, suggesting that T lymphocytes were not responsible for the IL-4 expression in the young mice. However, T lymphocytes may be responsible for the low level of IL-4 and IFNg transcripts occasionally detected in the adult mice. To verify that lymphocytes were not the source of the IL-4 transcripts in the brain, SCID and RAG22 / 2 mice, which are deficient in both B and T lymphocytes, were examined. IL-4 and IFNg gene expression was determined in the brains of 1, 7 and 14 day old mice, as well as adult mice. High levels of IL-4 transcripts were detected at day 1

and 7, and no IL-4 was seen in the adult mice (Fig. 3). This strongly suggested that IL-4 was being expressed by resident brain cells.

3.3. The gene responsible for IL-4 expression in the brain is the same as the gene in T lymphocytes To determine that the IL-4 gene expressed in the brains of these mice was the same as the IL-4 gene expressed in T lymphocytes, knockout mice deficient for the IL-4 and IL-5 gene defined in lymphocytes were examined. As seen in Fig. 4, IL-4 expression was absent in the brains of IL-4KO mice at all ages examined, confirming that the transcripts in the brain were from the same gene responsible for IL-4 expression in T lymphocytes. In contrast, the IL-5KO mice had similar levels of IL-4 expression in their brains as wild-type mice. Of note, the adult IL-5KO mouse shown in Fig. 4 was the only mouse in any of these experiments that showed significant expression of IFNg in the brain. Since this was a rare observation and it was likely that the source of the IFNg was T cells contaminating the tissue, we did not pursue this any further.

3.4. Expression of the IL-4 transcription factor, GATA3, correlates with IL-4 expression in the brain We also examined the expression of the IL-4 transcription factor GATA-3 in the brain to determine if its expression correlated with IL-4 expression. Fig. 5 illus-

Fig. 2. T cells contaminating the brain tissue does not appear to be the source of the IL-4 in brain. A Southern blot comparing IL-4, IFNg and CD3g gene expression in the brains of B10.PL mice illustrates that as the number of T cells, represented by CD3g, in the tissues increases, the IL-4 expression diminishes. Of note, the sample labeled ‘6 weeks’ is from a mouse that was perfused to determine how effective perfusion was on eliminating T cells from the brain. The cDNA samples were initially diluted such that they contained similar levels of HPRT transcripts (not shown).

A.E. Lovett-Racke et al. / Brain Research 870 (2000) 27 – 35

31

Fig. 3. T cells are not the source of IL-4 in the brains of neonatal mice. The relative gene expression of IL-4 in the brain was determined in SCID and RAG22 / 2 mice which are both deficient in T cells. The data shown is from individual mice that were analyzed simultaneously.

Fig. 4. The IL-4 gene expressed in the brain is the same gene expressed in T cells. Mice deficient for the IL-4 gene, which was originally identified in T cells, were analyzed for IL-4 expression in the brain. IL-4 was not detected in the brains of IL-4KO mice, but was readily detectable in IL-5KO mice. The data shown is from individual mice that were analyzed simultaneously.

32

A.E. Lovett-Racke et al. / Brain Research 870 (2000) 27 – 35

Fig. 5. The expression of the IL-4 transcription factor, GATA3, correlates with IL-4 gene expression in the brain. (a) The brains of B10.PL mice were examined by PCR and Southern hybridization for IL-4 and GATA3. (b) The relative gene expression was determined by normalizing the level of IL-4 and GATA3 to HPRT. The data shown is from individual mice that were analyzed simultaneously.

trates that the expression of GATA-3 in B10.PL mice correlates with IL-4 expression. This observation was also seen in B6 and B10.S (data not shown).

3.5. IL-10 transcripts are also found in the developing CNS Since mice with a disrupted GATA-3 gene have an

abnormal CNS, GATA-3 must regulate genes essential for normal development [24]. The only genes known to be regulated by GATA-3 are the genes for cytokines produced by Th2 lymphocytes [37]. Since IL-4KO mice have an apparently normal CNS [16], GATA-3 must be regulating genes other than IL-4, which results in CNS malformation. As IL-4 has overlapping functions with IL-10 in lymphocytes, IL-10 gene expression which is also regulated by GATA-3 was analyzed in the brain as a possible molecule that may provide functional compensation for the loss of IL-4 in IL-4KO mice with regard to CNS development. As seen in Fig. 6, IL-10 expression in B10.PL mice brains appears to be developmentally regulated and correlates with IL-4 expression in the brain. IL-10 gene expression was also seen in young B10.S mice (data not shown). In addition, SCID and RAG22 / 2 mice also expressed IL-10 during development indicating that T lymphocytes were not the source of the IL-10 (data not shown).

4. Discussion

Fig. 6. The Th2 cytokine, IL-10, is also expressed in the brains of neonatal mice. The relative gene expression of IL-4 and IL-10 was determined in B10.PL mice by PCR and Southern hybridization. The data shown is from individual mice that were analyzed simultaneously.

The cytokine milieu in the microenvironment of an immune response plays a critical role in the outcome of that response. We examined whether there was cytokine expression in developing mouse brains that could potentially influence an immune response in the brain. Initially, we analyzed the gene expression of IFNg (a Th1 proinflammatory cytokine) and IL-4 (a Th2 anti-inflammatory cytokine) in the brain of mice during maturation. We found

A.E. Lovett-Racke et al. / Brain Research 870 (2000) 27 – 35

no detectable IFNg, but readily detected IL-4 transcripts in the brain during the first 2 weeks of life. As previously demonstrated, normal adult brains did not express IL-4 [29]. The IL-4 appears to be made by resident CNS cells because mice deficient in T lymphocytes (including NK1.11 CD41 T cells), the only known producer of IL-4, still express IL-4 message in the brain. Further analysis revealed that transcripts for IL-10, another Th2 cytokine, were present in the CNS of young mice also. We did not observe any difference in IL-4 gene expression or lack of IFNg gene expression in any of the strains of mice that were studied. Since EAE is usually induced in adult mice, it is unlikely that expression of Th2 cytokines during the first 2 weeks of life would affect EAE induction in adult mice. The possibility that IL-4 and / or IL-10 expression may affect EAE induction in young mice is discussed later. The role that Th2 cytokines play in the developing brain may be diverse. First, they may protect the developing CNS from damage caused by inflammatory immune responses. IL-4 is generally described as an anti-inflammatory cytokine that is a critical factor in differentiating naive T cells in a Th2 phenotype [16,19]. In EAE, an inflammatory CNS disease, it is speculated that Th2 cytokines play a role in disease severity, recovery and remission [3,9,13,14]. In addition, IL-4 administration has been shown to prevent chronic-relapsing murine EAE [25]. IL-4 is found in EAE brains at varying levels throughout the course of the disease and IL-10 expression appears to be upregulated during recovery [13]. Although it is believed that infiltrating Th2 cells are the source of the IL-4 and IL-10, perhaps resident CNS cells are actively participating in limiting the inflammatory response in the CNS by producing anti-inflammatory cytokines. Differentiating the sources of the IL-4 and IL-10 in EAE-affected brains may be difficult since they are secreted proteins. However, we are currently using in situ hybridization to identify which cells in the CNS are producing IL-4 mRNA in young normal mice. Once this is accomplished, we plan to use in situ hybridization to determine if these CNS cells produce IL-4 in adult mice during the course of EAE. Interestingly, actively sensitized neonatal Lewis rats fail to develop EAE and remain resistant when actively challenged with MBP as adults, but are susceptible to passive induction of disease. This suggests that the disease-causing cells are altered or eliminated when the neonatal rats are exposed to the potentially encephalitogenic antigen. Neonatal SJL / J mice injected with encephalitogenic T cells do not develop EAE until they are several weeks old [32], suggesting that some factor is suppressing disease during the first few weeks of life. To determine if Th2 cytokines are responsible for suppressing EAE in neonatal mice, we plan to assess the susceptibility of neonatal mice deficient in IL-4, IL-10 or both to EAE induction. Epidemiological data suggests that one’s risk of developing MS is determined in childhood, yet clinical symptoms rarely occur before adulthood [17]. Whether this is due to expression of a

33

molecule, such as IL-4 or IL-10, that is developmentally regulated in the target organ or due to the plasticity of the developing nervous system has yet to be determined. Another potential role for IL-4 in the brain is that it plays a role in normal development of the CNS. It has recently been shown that IL-4 induces expression of nerve growth factor (NGF) in astrocytes. NGF is expressed in the developing nervous system and plays a critical role in the survival, growth and differentiation of peripheral sympathetic and neural crest-derived sensory neurons [30]. NGF is only expressed in adult brains following injury because it is essential for the repair of some axons [33]. Since astrocytes have been shown to express functional IL-4 receptors and IL-4 has been shown to induce NGF secretion by cortical and cerebellar astrocytes, IL-4 may be a regulatory factor in NGF expression in the developing CNS [1,4]. An additional observation that supports the hypothesis that Th2 cytokines play a role in normal development of the CNS is the fact that mice with a disrupted GATA-3 gene have abnormal nervous systems [24]. Although GATA-3 expression has been seen in the placenta, kidney, adrenal gland, peripheral nervous system, CNS, liver and T lymphocytes during embryonic development, the only genes known to be directly regulated by GATA-3 are cytokine genes expressed by Th2 cells [10,23,36,37]. Since mice genetically deficient in IL-4 have no apparent defect in their CNS development (16), GATA-3 must regulate other genes that affect CNS development. We have also shown that IL-10, another Th2 cytokine, is expressed in the maturing brain and correlates with IL-4 expression. Since IL-4 and IL-10 have overlapping functions in lymphocytes, they may have a redundant role in the brain. Consequently, loss of one of these Th2 cytokines may not adversely affect the developing CNS, but the collective loss of IL-4, IL-10 and other Th2 cytokines via GATA-3 disruption may be responsible for the CNS abnormality. Of course, GATA-3 may be regulating other genes, yet to be identified, in the CNS that are essential for normal CNS development. This study supports the hypothesis that brain-derived Th2 cytokines can potentially contribute to the immuneprivileged nature of the developing CNS. Further study is necessary to determine the cell types expressing the IL-4 and IL-10 in the CNS. In addition, the ability of resident brain cells to produce Th2 cytokines under adverse conditions, such as MS, may contribute to our understanding of the mechanisms that regulate an immune response in the CNS.

Acknowledgements A.E. Lovett-Racke was a Lucille P. Markey Pathway postdoctoral fellow at Washington University. M.K. Racke and T.G. Forsthuber are Harry Weaver Neuroscience

34

A.E. Lovett-Racke et al. / Brain Research 870 (2000) 27 – 35

Scholars of the National Multiple Sclerosis Society. M.K. Racke is also the Young Investigator in Multiple Sclerosis of the American Academy of Neurology Education and Research Foundation. This work was supported by grants from the National Multiple Sclerosis Society.

References [1] H. Awatsuji, Y. Furukawa, M. Hirota, Y. Murakami, S. Nii, S. Furukawa, K. Hayashi, Interleukin-4 and -5 as modulators of nerve growth factor synthesis / secretion in astrocytes, J. Neurosci. Res. 34 (1993) 539–545. [2] C.F. Barker, R.E. Billingham, Immunologically privileged sites, Adv. Immunol. 25 (1977) 1–54. [3] E. Bettelli, M.P. Das, E.D. Howard, H.L. Weiner, R.A. Sobel, V.K. Kuchroo, IL-10 is critical in the regulation of autoimmune encephalomyelitis as demonstrated by studies of IL-10- and IL-4deficient and transgenic mice, J. Immunol. 161 (1998) 3299–3306. [4] C. Brodie, N. Goldreich, T. Haiman, G. Kazimirsky, Functional IL-4 receptors on mouse astrocytes: IL-4 inhibits astrocyte activation and induces NGF secretion, J. Neuroimmunol. 81 (1998) 20–30. [5] H.F. Cserr, P.M. Knoff, Cervical lymphatics, the blood–brain barrier and immunoreactivity of the brain: a new view, Immunol. Today 13 (1992) 507–512. [6] P. Dowling, G. Shang, S. Raval, J. Menonna, S. Cook, W. Husar, Involvement of the CD95 (APO-1 / Fas) receptor / ligand system in multiple sclerosis brain, J. Exp. Med. 184 (1996) 1513–1518. [7] K.M. Drescher, P.D. Murray, X. Lin, J.A. Carlino, M. Rodriguez, TGF-beta 2 reduces demyelination, virus antigen expression, and macrophage recruitment in a viral model of multiple sclerosis, J. Immunol. 164 (2000) 3207–3213. [8] Z. Fabry, C.S. Raine, M.N. Hart, Nervous tissue as an immune compartment: the dialect of the immune response in the CNS, Immunol. Today 15 (1994) 218–224. [9] M. Falcone, A.J. Rajan, B.R. Bloom, C.F. Brosnan, A critical role for IL-4 in regulating disease severity in experimental allergic encephalomyelitis as demonstrated in IL-4-deficient C57BL / 6 mice and BALB / c mice, J. Immunol. 160 (1998) 4822–4830. [10] K.M. George, M.W. Leonard, M.E. Roth, K.H. Lieuw, D. Kioussis, F. Grosveld, J.D. Enge, Embryonic expression and cloning of the murine GATA-3 gene, Development 120 (1994) 2673–2686. [11] T.S. Griffith, T. Brunner, S.M. Fletcher, D.R. Green, T.A. Ferguson, Fas ligand-induced apoptosis as a mechanism of immune privilege, Science 270 (1995) 1158–1159. [12] E. Joly, L. Mucke, M.B. Oldstone, Viral persistence in neurons explained by lack of major histocompatibility class I expression, Science 253 (1991) 1283–1285. [13] M.K. Kennedy, D.S. Torrance, K.S. Picha, K.M. Mohler, Analysis of cytokine mRNA expression in the central nervous system of mice with experimental allergic encephalomyelitis reveals that IL-10 mRNA expression correlates with recovery, J. Immunol. 149 (1992) 2496–2505. [14] S.J. Khoury, W.W. Hancock, H.L. Weiner, Oral tolerance to myelin basic protein and natural recovery from experimental allergic encephalomyelitis are associated with downregulation of inflammatory cytokines and differential upregulation of transforming growth factor-b, interleukin-4, and prostaglandin E expression in the brain, J. Exp. Med. 176 (1992) 1355–1364. [15] M. Kopf, F. Brombacher, P.D. Hodgkin, A.J. Ramsay, E.A. Milbourne, W.J. Dai, K.S. Ovington, C.A. Behm, G. Kohler, I.G. Young, K.I. Matthaei, IL-5-deficient mice have a developmental defect in CD51 B-1 cells and lack eosinophilia but have normal antibody and cytotoxic T cell responses, Immunity 4 (1996) 15–24.

[16] M. Kopf, G.L. Gros, M. Bachmann, M.C. Lamers, H. Bluethmann, G. Kohler, Disruption of the murine IL-4 gene blocks Th2 cytokine responses, Nature 362 (1993) 245–247. [17] J.F. Kurtzke, Epidemiology of multiple sclerosis, in: J.F. Hallpike, C.W.M. Adams, W.W. Tourtellotte (Eds.), Multiple Sclerosis, Williams and Wilkins, Baltimore, 1983, pp. 47–96. [18] L.A. Lampson, G. Siegel, Defining the mechanisms that govern immune acceptance or rejection of neural tissue, Prog. Brain Res. 78 (1988) 243–247. [19] G. Le Gros, S.Z. Ben-Sasson, R. Seder, F.D. Finkleman, W.E. Paul, Generation of interleukin 4 (IL-4)-producing cells in vivo and in vitro: IL-2 and IL-4 are required for in vitro generation of IL-4producing cells, J. Exp. Med. 172 (1990) 921–929. [20] A.E. Lovett-Racke, R. Martin, H.F. McFarland, M.K. Racke, U. Utz, Longitudinal study of myelin basic protein-specific T-cell receptors during the course of multiple sclerosis, J. Neuroimmunol. 78 (1997) 162–171. [21] P. Medawar, Immunity to homologous grafted skin. III. The fate of skin homografts transplanted to the brain, to subcutaneous tissue, and to the anterior chamber of the eye, Br. J. Exp. Pathol. 29 (1948) 58–69. [22] T. Olsson, Critical influences of the cytokine orchestration on the outcome of myelin antigen-specific T-cell autoimmunity in experimental autoimmune encephalomyelitis and multiple sclerosis, Immunol. Rev. 144 (1995) 245–268. [23] M. Oosterwegel, J. Timmerman, J. Leiden, H. Clevers, Expression of GATA-3 during lymphocyte differentiation and mouse embryogenesis, Dev. Immunol. 3 (1992) 1–11. [24] P.P. Pandolfi, M.E. Roth, A. Karis, M.W. Leonard, E. Dzierzak, F.G. Grosveld, J.D. Engel, M.H. Lindenbaum, Targeted disruption of the GATA3 gene causes severe abnormalities in the nervous system and in fetal liver haematopoieses, Nat. Genet. 11 (1995) 40–44. [25] M.K. Racke, A. Bonomo, D.E. Scott, B. Canella, A. Levine, C.S. Raine, E.M. Shevach, M. Rocken, Cytokine-induced immune deviation as a therapy for inflammatory autoimmune disease, J. Exp. Med. 180 (1994) 1961–1966. [26] M.K. Racke, B. Cannella, P. Albert, M. Sporn, C.S. Raine, D.E. McFarlin, Evidence of endogenous regulatory function of transforming growth factor-beta 1 in experimental allergic encephalomyelitis, Int. Immunol. 4 (1992) 615–620. [27] P. Saas, P.R. Walker, M. Hahne, A.L. Quiquerez, V. Schnuriger, G. Perrin, L. French, E.G. Van Meir, N. de Tribolet, J. Tschopp, P.Y. Dietrich, Fas ligand expression by astrocytoma in vivo: maintaining immune privilege in the brain?, J. Clin. Invest. 99 (1997) 1173– 1178. [28] M. Schachner, U. Hammerling, The postnatal development of antigens on mouse brain cell surfaces, Brain Res. 73 (1974) 362– 371. [29] D. Schluter, N. Kaefer, H. Hof, O.D. Wiestler, M. Deckert-Schluter, Expression pattern and cellular origin of cytokines in the normal and Toxoplasma gondii-infected murine brain, Am. J. Pathol. 150 (1997) 1021–1035. [30] J.L. Scully, U. Otten, NGF: Not just for neurons, Cell Biol. Int. 19 (1995) 459–469. [31] S.-W. Shin, J.-W. Park, M.-H. Suh, S.-I. Suh, B.-K. Choe, Persistent expression of Fas / FasL mRNA in the mouse hippocampus after a single NMDA injection, J. Neurochem. 71 (1998) 1773–1776. [32] M.E. Smith, N.L. Eller, M.K. Racke, H.F. McFarland, C.S. Raine, Ontogeny of clinical and pathological manifestations of autoimmune demyelination: Implications for multiple sclerosis, Am. J. Pathol. 155 (1999) 1147–1161. [33] S. Varon, J.M. Connor, Nerve growth factor in CNS repair, J. Neurotrauma 11 (1994) 473–486. [34] M. Weller, A. Fontana, The failure of current immunotherapy for malignant glioma. Tumor-derived TGF-beta, T-cell apoptosis, and

A.E. Lovett-Racke et al. / Brain Research 870 (2000) 27 – 35 the immune privilege of the brain, Brain Res. Rev. 21 (1995) 128–151. [35] K.A. Williams, D.N.J. Hart, J.W. Fabre, P.J. Morris, Distribution and quantitation of HLA-ABC and DR (Ia) antigens on human kidney and other tissues, Transplantation 29 (1980) 274–279. [36] M. Yamamoto, L.J. Ro, M.W. Leonard, H. Beug, S.H. Orkin, J.D.

35

Engel, Activity and tissue-specific expression of the transcription factor NF-E1 multigene family, Genes Dev. 4 (1990) 1650–1662. [37] W.-P. Zheng, R.A. Flavell, The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine expression in CD4 T cells, Cell 89 (1997) 587–596.