Diagnosis of New World leishmaniasis: Specific detection of species of the Leishmania braziliensis complex by amplification of kinetoplast DNA

Acta Tropica, 52(1992)45 58 'i) 1992 Elsevier Science Publishers B.V. All rights reserved 0001-706X/92/$05.00

45

ACTROP 00234

Diagnosis of New World leishmaniasis: specific detection of species of the Leishmania braziliensis complex by amplification of kinetoplast DNA Maarten H.L. de Bruijn and Douglas C. Barker MRC Outstation ~?['N.1.M.R., Molteno Laboratories, Department q['Pathology, Cambridge, U.K. (Received I June 1992; accepted 23 June 1992)

We have sequenced single kinetoplast DNA minicircles from three species and part of a minicircle from the fourth major species within the Leishmania braziliensis complex. Alignment of these sequences with each other and with those of other kinetoplastids allowed the selection of a pair of oligonucleotides suitable as primers in a polymerase chain reaction which is highly specific for the Leishmania braziliensis complex. The reaction is capable of detecting less than one femtogramme of kinetoplast DNA. It has been tested with crude specimens from South American leishmaniasis patients, potential wild animal reservoirs and sandfly vectors. The tests indicate that these primers are suitable for diagnosis of leishmaniasis and potentially useful in epidemiological surveys. Key words: Leishmaniasis; Leishmania; Minicircle; kDNA: Diagnosis: PCR

Introduction

Leishmaniasis affects the populations of 79 countries at a rate of 400 000 cases per year with 12 million currently infected and 350 million at risk (Ashford et al., 1991). Infection invariably starts with a bite of the infected sandfly vector taking a blood meal followed by sequestration of the Leishmania parasites in the macrophages of the host. The earliest clinical symptoms, a cutaneous lesion or a fever, have no diagnostic or prognostic value. Symptomatic diagnosis confuses leishmaniasis with unrelated disorders such as tropical ulcers, malaria, leprosy, sporotrichosis, syphilis, yaws and some forms of tuberculosis (Manson-Bahr, 1987). A cutaneous lesion with L. braziliensis complex involvement may heal by itself, disseminate or metastasize to the oro-nasal tract, resulting in severe disfigurement and frequently fatal secondary complications (Hommel, 1978). Early detection and identification of the complex is therefore clinically relevant (Marsden, 1985: Ridley, Correspondence to." D.C. Barker, MRC Outstation of NA.M.R., Molteno Laboratories, Department of Pathology, Tennis Court Road, Cambridge, CB2 1QP, UK. Abbreviations: bp, base pairs; kDNA, kinetoplast DNA; PCR, polymerase chain reaction: Tm, melting temperature of a DNA hybrid at which 50% of the hybrid is dissociated; NET10, 10 mM Tris-HC1 (pH 8.0), l0 mM EDTA, 10 mM NaC1. Nucleotide sequence data reported in this paper have been submitted to the GenBank TM data base and assigned the accession numbers M87314, M87315, M87316 and M87317.

46 1980), but is complicated by the scarcity of parasites present in lesions. Current diagnostic tests include microscopic smear examination, in vitro culture from biopsy or lymph aspirate, Montenegro skin test, indirect fluorescent antibody test (IFAT), enzyme-linked immunoabsorbance assay (ELISA) and isoenzyme analysis. They are not sensitive enough or are indirect, requiring culture of the parasites or passage through an experimental animal which is time-consuming and often unsuccessful. The antibody-based tests cannot distinguish between past and present infections, cannot detect early infections and cross-react with antibodies against other pathogens (Hommel, 1978). In recent years, several hybridisation methods and DNA probes with diagnostic potential have been reported. With few exceptions, the latter were derived from kinetoplast minicircle DNA (kDNA) because, with 10000 such circles per parasite, it formed an excellent hybridisation target (Barker, 1987; Barker, 1989; Wirth et al., 1986). Nevertheless, field studies have shown that these methods and probes often did not provide adequate sensitivity for routine detection of the parasite in patient samples (Wilson, 1991). To overcome these deficiencies we have developed a simple and highly sensitive test utilizing a pair of oligonucleotide primers and the polymerase chain reaction (PCR) (De Bruijn, 1988; Saiki et al., 1988). These primers specifically amplify kDNA minicircles belonging to species of the L. hraziliensis complex directly from biological samples. Here we report the development and illustrate the application of these PCR primers.

Materials and Methods

Strains and culture The strains used for kDNA sequencing and PCR primer development were L. (V.) braziliensis M HOM/BR/75/M 2904, L. (V.) guyanensis UM B/BR/76/M4196, L.( V.) peruviana MHOM/PE/76/SL5 and L.(V.) panamensis MHOM/ PA/75/M4037. They were obtained from the Wellcome Parasitology Unit, Belem, Brazil, and the London School of Hygiene and Tropical Medicine and cultured in EBLB medium (Evans, 1989). Cultures of L.(V.) braziliensis MHOM/ BR/00/LTB300, L.(V.) guyanensis MHOM/BR/75/M4147, L.(V.) panamensis MHOM/PA/71/LS94, L.( L.) mexicana MHOM/BZ/82/BEL21, L.( L.) amazonensis MHOM/BR/73/M2269, L.(L.) chagasi MHOM/BR/74/M2682, L.(L.) donovani MHOM/IN/80/DDS, L.(L.) inJ'antum MHOM/TN/80/IPTI, L.(L.) tropica MHOM/SU/74/K27 and L.(L.) major MHOM/SU/73/5-ASKH were obtained from Winches Farm Laboratories (London School of Hygiene and Tropical Medicine) and directly processed for PCR amplification. Total DNA from L.(V.) peruviana MHOM/PE/84/LC26 and Trvpanosoma cruzi were gifts from Y. Montoya and J. Kelly, respectively.

Purification and cloning {~fkDNA kDNA was isolated from cultures as previously described (Kennedy, 1984). kDNA from isolates M2904, M4196, SL5 and M4037 was digested with the enzyme MboI, ligated to plasmid pUC8 DNA (Messing, 1983) linearized by digestion with the

47 enzyme BamHI and used to transform Escherichia coli JMl01 cells. Colonies were screened using [32p]kDNA from each isolate and colonies containing full-length minicircles selected after digestion and size fractionation on agarose gels. Cloning, propagation and plasmid DNA preparation were carried out using standard procedures (Sambrook et al., 1989).

DNA sequence analysis Full-length minicircle inserts were purified by restriction endonuclease digestion and electrophoresis in low melting point agarose gels. Purified inserts were digested with TaqI (isolates M2904 and SL5), SspI (M2904 and M4147), AluI and RsaI (M4147, SL5 and M4037), and DraI (M4037). A 'shotgun' sequencing strategy was used in which these digests were cloned in SmaI-cut bacteriophage vector M l3mpl0 (Messing, 1983) using E. coli JM101-TG2 as the host. Cloning, sequencing, sequence assembly and analysis were carried out as previously described (De Bruijn, 1983; De Bruijn and Fey, 1985). Oligonucleotides were synthesized using a Pharmacia LKB Gene Assembler Plus. The melting temperature for a primer was calculated using the formula of Bolton and McCarthy (Bolton and McCarthy, 1969; Sambrook et al., 1989).

Preparation of crude samples for amplification A logarithmically growing parasite culture (200 lal) was centrifuged at 13 600 x g for 10 min at room temperature. The pellet was resuspended in 20 lal of water, left at room temperature for 10 min and used directly for PCR or stored at -20°C. Tissue biopsy samples of approximately 1 mm 3 were frozen, thawed, transferred to 25 lal of 10 mM Tris-HC1 (pH 8.0), 5 mM EDTA and 20 lag of Proteinase K (Boehringer Mannheim) and incubated at 95°C for 30 min (Ref. 19; Rodriguez, N., personal communication). Alternatively, crude DNA was prepared by incubating the biopsy at 65°C for 2 h in 200 lal i0 mM Tris-HC1 (pH 8.0), 10 mM EDTA, l0 mM NaC1 (NET10), 1% SDS and 40 lag of Proteinase K followed by two phenol extractions and ethanol precipitation; the precipitate was dissolved in 20 lal of water. Crude DNA was prepared from lymph aspirates (50 lab as described for biopsies, except that 80 lag of Proteinase K was used. Whole sandflies were broken up in 50 lal of NET10, 1% SDS and 20 tag of Proteinase K, and further treated as described for biopsies.

Polymerase chain reaction Positive PCR controls consisted of L. braziliensis and negative controls of L. mexicana complex-specific kDNA. Unless stated otherwise, purified control kDNA (10 rig), purified total DNA (100 ng), 2 lal of culture lysate, biopsy lysate or crude biopsy DNA, or 4 lal of crude aspirate or sandfly DNA were amplified in 50 mM KCI, 10 mM Tris-HC1 (pH 8.3), i.5 mM MgC12 and 0.01% gelatin in the presence of 0.2 mM of each deoxyribonucleotide, 100 pmol of each primer and 2.5 units of Taq DNA polymerase (Perkin Elmer Cetus, Cambio or Promega) in a final volume of 100 lal. Samples were overlaid with mineral oil (Sigma) and initially

48 denatured at 96°C for 6 min. Cycles consisted of annealing at 67.5°C (unless stated otherwise) for l min, extension at 72°C for l min and denaturation at 93°C for 0.5 min. Programmes were run for either 30 or 35 cycles on a Cambio Intelligent Heating Block (Genesys Instruments, Cambridge, UK). Products (15rtl) were fractionated by electrophoresis in 1% agarose gels in 90 mM Tris-HC1 (pH 8.3), 90 mM boric acid and 25 mM EDTA.

Results

Full-length sequences were obtained for the minicircles of L. (V.) braziliensis M2904 (749 bp), L.(V.) guyanensis M4196 (741 bp), L.(V.) peruviana SL5 (751 bp). No minicircle-size clones representing L. (V.) panamensis M4037 were found. All kDNA sequences have been submitted in full under the database accession numbers mentioned. Comparisons between the full-length sequences of two species and between one of these and other kinetoplastid minicircle sequences are shown schematically in dotmatrix plots (Fig. 1). They show, as expected, greatest sequence identity between species within the L. braziliensis complex (Fig. IA). Practically all this identity is concentrated in a region spanning 28% (208 bp) of a minicircle. The remaining 72% of each minicircle is highly variable, as has been found in other sequenced minicircles (Kidane et al., 1984). These variable regions may nevertheless encode guide RNAs as has been found in T. brucei (Jayarama Bhat et al., 1990) and Sauroleishmania (Sturm and Simpson, 1990). Sequence identity between L.(V.) braziliensis and L. (L.) amazonensis (Rogers and Wirth, 1988) (Fig. 1B) or L.[L.] major (Smith et al., 1989) (Fig. 1C) is markedly less but concentrated within the same region of the minicircle. In the comparison between L.(V.) hraziliensis and the related kinetoplastid, T. cruzi (Fig. 1D), only a small vestige of identity is left that occurs only once in the Leishmania minicircle but four times in the larger T. cruzi minicircle which is made up of four repeat units (Macina et al., 1986). The conserved minicircle region identified in the matrix comparisons is shown in more detail in Fig. 2, where the corresponding sequences have been aligned. Sequences conserved within the order Kinetoplastida and presumably essential for minicircle function or maintenance (nucleotides 41 55, 86 89, 117 120 and 141 160 in Fig. 2) are immediately apparent. Flanking these are Leishmania-specific and L. braziliensis complex-specific sequences. Their conservation is presumably due to selective pressure associated with maintenance of the kinetoplastid-specific sequences.

Selection ~1~PCR prhners with diagnostic potential High specificity is required for PCR primers to be suitable for diagnosis of leishmaniasis. They will be used on biological samples taken from patient lesions that will contain a variety of bacteria and may be due to an unrelated disease mimicking leishmaniasis. Such a patient may have other infections, for instance Chagas' disease (T. cruzi) in addition to leishmaniasis. Finally, any biological sample will contain an excess of human DNA. All D N A other than Leishmania DNA is a potential but undesirable target for the PCR primers. The primers must also drive a sensitive PCR

49

,A

B

', ~.

¢.

•

•

"' ..:;_

.

•

,

.

• ,

.

.

"•

;.-

•

'

. . . . . . . . .

°

"

.

-'.:" ,.,'. . . . . . .

-,-""

".

,o.'.

,

-

i..-..,."

, ,t

."..-,~ .~:., ;:, :,, .. ,. ~:"

.,."....~,"

.+

/

• "¢,"~ .'-~, ",.,.~ ,•. ,.'~.,;' ...~.t, , ,,:,',:( ~.~..,:',, . ~,~,..~ ,~,:

""

•

.. " -

•,

.

"

".~ .:~.

,.

" ~:,~"'~,::.

..~,,: .....

'""

"

;:'-':

~

;

.,":i~;

;::'-

,~.;:

,)1..

-

t"

,,

/

~

",

;t . . . . .

• ,/-...:.

._~. . ...:.p..,

, ;,

; ..

,

~,~:"

~

~

w.~_ ~- .

.'i*;'7,, .;.~..~

• •~.

,

.,

•

~.

.

°

7 -

D

C : . ,

•

.

.*

,, ,

.

;'...,. "-,..,..,;.. .o

.

_

..

. .

"':" ~'"~" ":~

~ .

~

.

. : -

.

•

~.

:

.~,:., •

..,

:.. - . . . . . : •

:

: . . . . . .

"?,:

•/f

•

::.

;g...:'~.:,,i

•'

;7

"~.~.

• " ;,"

".

.

• -

,

.~ .

o

_

.

" i - . .

"'"' •

~" :~; '" '~'...... .~

. .: :

_

.;,, ~..-'".-,'~.:'.

"~'. :.

-,:-"

"

4:

/7 - -

Fig. 1. Dot-matrix comparisons of kinetoplast minicircle D N A sequences. The comparisons are between L . ( V . ) braziliensis M2904 (749 bp) along the horizontal axes and (A) L . ( V . ) guyanensis M4196 (741 bp), (B) L.(L.) amazonensis (709 bp, Rogers and Wirth, 1988), (C) L . ( L . ) major (683 bp; Smith et al., 1989) and (D) T. cruzi (1430 bp, Macina et al., 1986) along the vertical axes. The circular sequences have been

linearized at equivalent points after preliminary alignment and all sequences start at the bottom left-hand corner• The comparisons have been compiled using the computer programme D I A G O N (Staden, 1982). The same criteria were used for all plots• The four homologous sequences in the comparison with T. cruzi are indicated by arrow heads•

reaction in order to allow for the scarcity of parasites present in lesions• Ultimately, they need to be validated in a clinical laboratory. We have identified such a sequence with specificity for the L . b r a z i l i e n s i s complex (sequence B2 in Fig. 2). The B2 primer has a length of 19 nucleotides, a G + C content of 58% and a calculated Tm of 68°C. The second primer (sequence B1 in Fig. 2) annealing to the strand complementary to the target strand of B2, has a length of 21 nucleotides, a G + C content of 48% and a calculated Tm of 67°C. The T m values of B1 and B2 thus differ only by I°C. BI is largely kinetoplastid-specific

50 S'

~A ~u~ pAN AMA M~ TC1 TC2 TC3 TC4

A~T C A T AA~A T G~G G G ~ T TATA TGA~TCC T~GATA~i~CT A~CT C T ~ T C ~ T T ^ ~ C T C ~ A ~ G~TTTGGCCTGAAAAATGG~ GG GG T C A A T~ C C C G TGTTGC~G~ATT~TCCGG~ T T A T T G G ~ ' r ~ T T GA G G G C T ~ T~GAAA~AT~TTGAGGTT~ T~ATGG~TGTAACATGTCTG

B3 60

CC~CC~AAA~TTT~TGC~ T ~r c A A C T T T T C T G G T ~ ~AAA~T~CAGAAA~TCCTGA ~AAT~GTGAATGTTGTGT ~ A A T ~iC A C G G A A A G T T G~I,T T GAAAATTCTGGAA~GC~TGT 13A 13Y e c

F~

G

T~ GC A A A A A~ i ~

AVa

"~i~ii~TGGCAAAAA~I~G"

TCI TC2 TC3 TC4

G T T CG A A A A A~ G TTTGGGCGGGAAA~TcATGc TTC~GGGCCTAAA~TCATGC TTGGGGCCGGAAA~TCATGC TTGGGGTCGGAAAATCATGC 3'

i~ ~ i ~ i ~ i ~ i ~ G ~i41f~!~ii~i~ °

G

~i~ AT AT AT AT

;~G~f C G G G~G T GI~ A i A ~ C GiG~T C G G A G~C~G G A ~C ACG~GAGGT~G~GTTCGA " CGAGGAGGT~G~GTTCGA " CGGGGAGGT~G~GTTCGA ° CGGGGAGGT~IIG~GTT CGA

<

PAN

AMA MAJ TC1 TC2 TC3 TC4

12o

T ~i T T G~ T T T T T T T ~T T T~ T T T T

T~ T T T T~ T~ T~

A

G

~

G

~

A

~

A

~

C G G O O A ~ T 1" c G G G O A A ~ C T G G ¢ ~ G ~ A ~ T G ~ C A ~ T G G :r A T T 1" T A G G G G G~ C A T eG A A T T T G~G G A T ~ A TGGGATTTTGG~GGAA~ C C GG A T T T T G G GGA A

5'

B2

~ : : ~ i ~

~ ~ ~i~i~

~

~IE!

C G C ~ G 180

~ ~i~ ~ ~i~

"r T ~T ~ : . i ~ Q : ' ~ , ~ ~ S'

BRA Gu~

~ i~i ~ i ~ [ ~![i~

~iC A ~i~i~/:~,~i!~i~.~i~~ ~ i ~ ~ e T C ~!01~!~ G T A e A C T C~:~::i~::~ G T A C A C T C~i¢i~i~iG T A C A C T C !Ai~P..:,~ G T A C A

~ ~ ~ " T " • * *

G~~

~i~

~ ~:.~

AMA MAJ Tel TC2 TC3 TC4

A~ ~ ~ T

~

B1

~ A C ~;C

AC* ~ A A C A~;A G C ~'r O ~A T T

"r "r G "r "r c A J GT OT GGGT G ~'r ~ T G A G T ~ATT GOA

* A T A T A GA

"r "r G t ' r

A TGAT "r A G A "r A GA GT

~'

13Z

A~T ~i~A A C T C GA T A ~ C T e ~:~ c ~:~ c "r c T c G T e G CV o~ v G A T e A "r "r A A TG O~C ~i~G A T T G A C A A ~e T GTTTCTTTTTGAGGTCGCGT AAATTCTCTGGGGTGGCCGG AATAGT~GTTTTGATT~TTG GQT G~ T G T T T G T T T T G/~ GT T~AA~GTTATTTTGATTTTG TTTAGGATTTTATTGG~TGC

13B

A~ ! ~

20B

A~ i ~ i ~

"r ~ A~

~i~::i~E~ ~:.~ii~i~

T T ~ T T~::GG GTTGTGTG AATGTATG GCTATGA~ T T~TG~A'IF GTATG~A~

Fig. 2. Alignment of the 'conserved region" present in kinetoplastid minicircles. The sequences aligned are from L.(V.) braziliensis M2904 (BRA), L.(V.) guyanensis M4196 (GUY), L.(V.) peruviana SL5 (PER),

L. (V.) panamensis M4037 (PAN), L. (L.) amazonensis PH8 (AMA; Rogers and Wirth, 1988), L. (L.) major (MAJ, Smith et al., 1989) and the four repeat units of the T. cruzi minicircle (TCI 4, Macina et al., 1986). A few padding characters (*) have been inserted in the sequences to allow optimal alignment. Nucleotides identical in the four L. braziliensis complex species are shaded as well as nucleotides in the other sequences that are identical to those in the L. braziliensis complex sequences. PCR primers B1 (GGGGTTGGTGTAATATAGTGG), B2 (CTAATTGTGCACGGGGAGG) and B3 (CCCGACATGCCTCTGGGTAG) are discussed in the main text. PCR primers 13A (nucleotides 41-58), 13B (158 138), 13Y (54-38) and 13Z (139 160) have been published (Rodgers et al., 1990) and are based on the L.(L.) amazonensis sequence shown.

with a short L. braziliensis complex-specific sequence at the 3' end where extension takes place. The specificity of the amplification reaction is thus largely generated by primer B2. Primer B3 (20 nucleotides, 65% G + C , Tm 73°C) is currently being assessed and will be discussed below.

Sensitivity and specificity of PCR primers B1 and B2 Fig. 3 shows a serial dilution experiment in which progressively less k D N A of L. (V.) peruviana isolate LC26 was used to drive an amplification reaction. At 67.5°C, halfway between the calculated Tm values of primers B 1 and B2, the lower detection

51

ng A

10 1 0.1 10

pg

fg

1 0.1 10 1

0

M

B

Fig. 3. Sensitivity of the PCR reaction with primers BI and B2. Serial dilutions of kDNA from L. (V.) peruviana isolate LC26 (amounts indicated) were amplified by 35 cycles of PCR using an annealing temperature of 67.5~C (A) or 60.5°C (B). The end-products were fractioned by electrophoresis and visualized by staining with ethidium bromide and UV illumination. The molecular weight markers [M] are PhiX174 DNA digested with HaeIII (from top: 1353, 1078, 872 and 603 bp). The concentration of the original sample was determined by spectrophotometry and quantitation on agarose gels.

limit is 1 pg. At 60.5°C, however, this detection limit is down to at most 1 fg or 1000 minicircles. The diagnostic and smallest product observed is a whole linearized minicircle (750 bp). All products hybridise to radiolabeled kDNA (data not shown). Fig. 4 shows the amplification products obtained with crude culture lysates or purified total D N A from the main man-infecting Leishmania species and T. cruzi over a range of annealing temperatures. As expected, the amplification reaction is most specific at 67.5°C (Fig. 4A). Absolute specificity is maintained down to about 60.5°C (Fig. 4B), below which products become visible for L . ( L . ) amazonensis and L . ( L . ) mexicana as well as T. cruzi (55°C, Fig. 4C) and at 45°C (Fig. 4D) also for

52 212

B

C

D

~%~ii iliii~I ~

,~

Fig. 4. Specificity of the PCR reaction with primers BI and B2. Amplification products from 100 ng of purified total DNA of L.(V.) peruviana (LC26) and T. cruzi, and of 2 p.1 of crude culture lysate of L. (V.) braziliensis (LTB300), L. ( V. ) guyanensis (M4147), L. ( V. ) panamensis (LS94), L. (L.) amazonensis (M2269), L.(L.) mexicana (Bel21), L.(L.) chagasi (M2682), L.(L.) tropica (K27), L.(L.) major (5ASKH), L.(L.) donovani (DD8) and L.(L.) in/~mtum (IPTI) were analysed as described in Fig. 3. The PCR reaction was for 35 cycles using 67.5'~C (A), 60~C (B), 55"C (C) and 4 5 C (D) as annealing temperatures. The diagnostic product of 750 bp is indicated in (A) by an arrowhead and is identical in subsequent panels.

53

L.(L.) chagasi, L.(L.) donovani and L.(L.) infantum and L.(L.) major. We now routinely anneal at 60.5°C, since this provides an optimal combination of sensitivity and specificity. The nonspecific products seen at lower temperatures do not correspond to whole minicircles with the exception of L. (L.) amazonensis (709 715 bp; Rogers and Wirth, 1988) and possibly T. cruzi (approx. 1450 bp; Macina et al., 1986). The minicircles of L.(L.) mexicana, L.(L.) chagasi, L.(L.) donovani and L. (L.) infantum are about 800 bp (Eresh, S. and Smyth, A. personal communication) and ofL. (L.) major 683 bp (Smith et al., 1989). Despite the appearance of nonspecific products at the lower temperatures, the PCR reaction still remains specific by product size. Field applications A compilation of results obtained with samples taken from infected patients, sandfly vectors and wild animal reservoirs is shown in Fig. 5. In panel A the detection by PCR of Leishmania is shown in two of three patients at the regional health centre in Araira, Venezuela. All three patients had lesions but those of the negative patient were atypical of leishmaniasis. The negative patient shows that human DNA does not generate the diagnostic PCR product. These results were obtained after crude DNA isolation from biopsies taken from the lesions. In panel B, detection in biopsies and lymph aspirates is shown for two patients in Medellin, Colombia. In this example biopsies were prepared by the fast lysis method while crude DNA was isolated from the aspirates (see Materials and Methods). Patient 1 was positive for leishmaniasis by microscopic smear examination, Montenegro skin test and by IFAT. Patient 2 was positive only by Montenegro skin test (Isaza Gomez, D., Gomez, M.E. and Restrepo, M., personal communication). Panel C shows analysis by PCR of biopsy and lymph aspirate samples, both after crude DNA preparation, from patients attending surgery in a farmer's community building with no clinical facilities in Cusco, Southern Per~. Patient 9 had a history of leishmaniasis with pharyngal involvement, suffered from secondary bacterial infection in the area of the lesions and was receiving treatment. Patient 10 was a new patient with inflammation of the nose as typically seen in mucocutaneous leishmaniasis (espundia). Both patients were independently assessed by in vitro culture using the same samples and considered positive for leishmaniasis (Llanos-Cuentas, A., personal communication). All the field tests were done blindly. At all three locations appropriate positive and negative controls (see Materials and Methods) and patient samples negative by both PCR and by existing diagnostic methods were included. A more extensive field test in Call, Colombia, comparing diagnosis by PCR with existing diagnostic methods will be described in detail elsewhere (De B., M.H.L., Labrada, L.A., Smyth, A.J., Santrich, C. and D.C.B., unpublished data). The method has so far proved negative for Chagas' disease, sporotrichosis, leprosy, tropical and vascular ulcers, acute dermatitis, hematoma, syphilis, histoplasmosis and for samples from uninfected patients (e.g., Fig. 5A). We have also assessed the potential usefulness of the PCR method in studying other parameters important in the epidemiology of leishmaniasis. Panel D shows results with Lutzomyia longipalpis from uninfected and infected experimental sandfly colonies held at CIDEIM, Cali, Colombia. Finally, panel E illustrates the results obtained with biopsies from wild animals caught in Serra dos CarajS,s, Pardi, Brazil.

54

12

34

5

6 7 M

A

M 2p 2f

M

E

(Fig.5. See facing page.)

Discussion

The identification of a single 200 bp conserved region in the minicircles of four different species of the L. braziliensis complex (Fig. 1) containing kinetoplastid-, genus-, complex- and possibly species-specific sequences (Fig. 2), cannot be reconciled

55

with the results of deletion analysis of a minicircle of L . ( L . ) amazonensis (Rogers and Wirth, 1987). The latter study suggested that this minicircle contained a 230 bp region conserved within the genus flanked by a 170 bp complex-specific and a 400 bp variable region. The actual experimental data however, are compatible with the single 200 bp region observed in L. braziliensis complex minicircles. The discrepancy is therefore most likely due to the fact that deletion analysis is inherently less precise than sequence analysis. We have not been able to find genus-specific primer sequences. PCR primers BI and B2 drive a highly specific and sensitive reaction capable of detecting parasites belonging to the L. braziliensis complex (Fig. 3 and 4). A number of unexpected PCR products were observed. The approximately 1350-1400 bp products in Fig 3 are specific by hybridisation to labelled kDNA. Their size, equivalent to about double that of a linearized minicircle, and their "dose-dependent' appearance are consistent with their being low frequency readthrough products beyond the annealing site for the second primer. The size estimation may, however, be influenced by aberrant electrophoretic mobility due to secondary structure. The smaller products visible in Fig. 5E have not been further analysed. None of these extra products appears consistently and therefore none has any diagnostic value. They have a sufficiently different size from the main 750 bp product not to confuse diagnosis. Our lower detection limit is 1 fg, equivalent to about 1000 minicircles of 750 bp. Since the primer sequences are conserved across four species of the complex, we assume that they are also conserved in different minicircle classes within each species, so that all 104 minicircles per parasite are probably amplified. We therefore can theoretically detect 10% of a single parasite after 35 cycles of PCR without the need for hybridisation with a labelled kDNA probe. Such sensitivity is needed because detection in crude biological samples is hampered by inhibitory effects of other substances present and by impaired accessibility of the kinetoplast (Rodgers et al., 1990). The weak signal seen for sandfly 59V IFig. 5) illustrates this. The infected fly must contain a minimum of one parasite or 10 fg of kDNA, but the signal is equivalent to that seen with l fg of purified kDNA (Fig. 3). Where necessary, sensitivity can be substantially increased by hybridisation of the PCR product to (non)radioactively labelled total kDNA. The sensitivity of the B1/B2 primer pair compares well to that of previously published primers 13A/13B and 13Y/13SZ (Rodgers et al., 1990: see Fig. 2) which

Fig. 5. Amplification products from infected hosts using PCR primers BI and B2. (A) Products of 10 ng of kDNA from L.(V.) hraziliensis M2904 (1), guyanensi~s M4147 (2), peruviana LC26 (3) and panamensis M4037 (4), and of crude DNA prepared from biopsies of patients (5-7) attending surgery in Araira, Venezuela. (B) Products of crude biopsy lysates (lb, 2b) and of crude DNA prepared from lymph aspirates (la, 2a) of two patients attending surgery at the Servicio Sectional de Salud de Antioquia, Medellin, Colombia. (C) Products of crude DNA from biopsies (b9, bl0) and lymph aspirates (a9, a [0) of patients visiting "Casa Campesina', Cusco, Peril. (D) Products of crude DNA prepared from Lutzom) ia longipalpis (C2) and L. longipalpis experimentally infected with L.(V.) panamensis (59V, 56V). The flies were reared and infected at CIDEIM, Cali, Colombia, and sent intact and dry to our laboratory. (E) Products using crude DNA isolated from skin (2p) and liver (2f) biopsies from the rodent Proechil*os (same animal) and skin biopsies from the opossums Didelphis marsupialis (Sp) and Philander opossum (9p). The mammals were dissected by the Wellcome Parasitology Unit, Bel6m, Brasil, and biopsies were transported to our laboratory in liquid nitrogen. Annealing temperatures were 67.5'C (A,C) or 60.5' C (B,D,E). Markers (M) are as in Fig 3. All PCR reactions were done with appropriate negative controls Inot shown).

56 were based on L.(L.; amazonensis minicircle sequence and were considered to be Leishmania-specific and kinetoplastid-specific, respectively. Rodgers et al. report a lower detection limit for L. braziliensis complex species by PCR followed by hybridisation to radiolabeled k D N A of 10 fg (13A/13B) and 100 fg (13Y/13Z). Allowing for 50-fold more sensitivity due to five extra PCR cycles and a larger sample size (Fig. 3), and for a conservatively estimated 5000-fold difference in sensitivity between a gel stained with ethidium bromide (10 ng limit) and a radiolabeled dot of kDNA on a membrane (2 pg limit; Rodgers et al., 1990; Labrada and Smith, 1990) the primers BI/B2 are 103-fold and 104-fold more sensitive than primers 13A/13B and 13Y/13Z, respectively. The most likely explanation for this is that detection of L. hraziliensis species by 13A/13B and 13Y/13Z is based on mismatched hybrids between primers and targets. This lowers the actual Tm levels to near or below the annealing temperature used and thus depresses the yield of amplified product in addition to substantially increasing the risk of mispriming in a patient sample. Field testing of the PCR primer set B1/B2 was essential for several reasons. Firstly, the primers are based on and have been characterized using former or current World Health Organization reference strains of Leishmania., which are not necessarily equivalent to currently circulating strains. Secondly, the technically advanced methodology is not per se suited to clinical laboratories and rural health centres in endemic countries. Thirdly, the method had to be evaluated using crude patient samples. And finally, specificity of the primers had to be assessed with samples from patients with other diseases, particularly those that can be confused with leishmaniasis. The examples given in Fig. 5 illustrate that the method can be used in endemic areas and with a variety of biological samples (Fig. 5). They also show that its use as a diagnostic method for South American leishmaniasis cases is feasible. Such a method should provide the means for early detection and therefore early drug treatment of the disease which at present is not possible. It would subsequently allow proper assessment of the patient's response to chemotherapy and also to a variety of native remedies. This diagnostic potential is currently being assessed further within a network of South American laboratories in order to achieve full clinical validation. The method should also prove useful in epidemiological studies aimed at identifying vectors and reservoirs of the parasite and at establishing the frequency of latent infections present in populations. A potentially important advantage of highly sensitive diagnostic methods is the use of less invasive patient sampling than is possible now. This is not only desirable but necessary in epidemiological surveys. For this reason we have tested lymph aspirates (Fig. 5). Fast lysis as used for biopsies has not been satisfactory due to the often low number of parasites per unit volume of aspirate, but reliable results have been achieved after crude DNA isolation and at a primer annealing temperature of 60.5c'C. Results with saliva and blood samples have so far been ambiguous, unlike those with blood samples taken from patients with visceral leishmaniasis. We have recently reported PCR primers similar to B 1/B2 capable of detecting L. (L.) donovani complex parasite DNA in total DNA prepared from splenic aspirates and from the buffy coat fraction of blood taken from such patients (Smyth et al., 1992). Interestingly, neither in the case of D N A prepared from blood (Smyth et al., 1992) nor with crude biopsy lysates containing blood (Fig. 5) have we noticed the presence of PCR inhibitors reported by others (De Franchis et al., 1988; Avila et al., 1991).

57 To increase the sensitivity of PCR detection of parasites potentially present in body fluids of cutaneous patients it may be necessary to break down the concatenated k D N A network either chemically (Avila et al., 1991) or enzymatically (Ldpez et al., 1990) in order to increase the number of target D N A molecules per unit volume of fluid. Random nicking of minicircles would lower the sensitivity of primers B1/B2 but not that of primers amplifying a small section of minicircle. For this particular purpose we are testing primer B3 (Fig. 2), which in combination with B2 amplifies a 1 14 bp L. braziliensis complex-specific product.

Acknowledgements We would like to thank L.J. Gibson and S. Eresh for technical assistance and, Y. Montoya (Instituto de Medicina Tropical 'Alexander von Humboldt', Universidad Peruana Cayetano Heredia, Lima, Peril) and Dr. J. Kelly (London School of Hygiene & Tropical Medicine) for gifts of DNA. We are most grateful to Dr. B. Guzman (Instituto de Biomedicina, Caracas, Venezuela), M.E. Gomez (Servicio Seccional de Salud de Antioquia, Medellin, Colombia), Dr. M. Restrepo and D. Isaza Gomez (lnstituto Colombiano de Medicina Tropical, Medellin), Dr. M. Cruz (Cusco, Per6) and Dr. A. Llanos-Cuentas (Instituto de Medicina Tropical 'Alexander von Humboldt', Lima) for patient samples and independent diagnostic tests. We are indebted to C. Jaramillo and Dr. B. Travi ( C I D E I M , Cali, Colombia) for sandflies and to Prof. R. Lainson and Dr. J, Shaw (Wellcome Parasitology Unit, Beldm, Brasil) for animal biopsies. We thank M.E. Gomez, Dr. M. Restrepo, Dr. J. Arevalo (Universidad Peruana Cayetano Heredia, Lima), staff at the regional health centre in Araira, Venezuela, and of "Casa Campesina', Cusco, Peril, for their hospitality. This work received the financial support of the Medical Research Council (U.K.) and the UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases.

References Ashford, R.W., Desjeux, P. and deRaadt, P. (1991) Estimation of population at risk of infection with leishmaniasis. Parasitol. Today 8, 104 105. Avila, H.A., Sigman, D.S., Cohen, L.M., Millikan, R.C. and Simpson, L. (1991) Polymerase Chain reaction amplification of Trvpanosoma cruzi kinetoplast minicircle DNA isolated from whole blood lysates: diagnosis of chronic Chagas" disease. Mol. Biochem. Parasitol. 48, 211 222. Barker, D.C. (1987) DNA diagnosis of human leishmaniasis. Parasitol. Today 3, 177-184. Bolton, E.T. and McCarthy, B.J. (1969) A general method for the isolation of RNA complementary to DNA. Proc. Natl. Acad. Sci. USA 48, 1390 1397. Barker, D.C. (1989) Molecular approaches to DNA diagnosis. Parasitology 99, SI25 S146. De Bruijn, M.H.L. (1983) Drosophila melanogaster mitochondrial DNA, a novel organization and genetic code. Nature 304, 234 241. De Bruijn, M.H.L. (1988) Diagnostic DNA amplification. No respite for the elusive parasite. Parasitol. Today 4, 293-295. De Bruijn, M.H.L. and Fey, G.H. (1985) Human complement component C3: cDNA coding sequence and derived primary structure. Proc. Natl. Acad. Sci. USA 82, 708 712. Evans, D. (1989) Handbook on isolation, characterization and cryopreservationof Leishmania, pp. 10-15.

58 UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases (TDR), 121 l Geneva, Switzerland. De Franchis, R., Cross, N.C.P., Foulkes, N.S. and Cox, T.M. (1988) A potent inhibitor of Taq polymerase copurifies with human genomic DNA. Nucleic Acids Res. 16, 10355. Hommel, M. (1978) The genus Leishmania: biology of the parasites and clinical aspects. Bull. Inst. Pasteur 75, 5 102. Jayarama Bhat, G., Koslowsky, D.J., Feagin, J.E., Smiley, B.L. and Stuart, K. (1990) An extensively edited mitochondrial transcript in kinetoplastids encodes a protein homologous to ATPase subunit 6. Cell 61,885-894. Kennedy, W.P.K. (1984) Novel identification of differences in the kinetoplast DNA of Leishmania isolates by recombinant DNA techniques and in situ hybridisation. Mol. Biochem. Parasitol. 12, 313 325. Kidane, G.Z., Hughes, D. and Simpson, L. (1984) Sequence heterogeneity and anomalous electrophoretic mobility of kinetoplast minicircle DNA from Leishmania tarentolae. Gcne 27, 265 277. Labrada, L.A. and Smith, D.S. (1990) Latin American workshop for the evaluation of DNA probes for leishmaniasis. Parasilol. Today 6, 30. Ldpez, M., Orrego, C., Cangalaya, M.A., lnga, R.M. and Arevalo, J.L. (1990) Detection of Leishmania hraziliensis from minimally processed human biopsies via the polymerase chain reaction. A.S.M. Annual Meeting Abstract, Anaheim, California, May 13 17, pp. 26 28. Macina, R.A., Sanchez, D.O., Gluschankof, D.A., Burrone, O.R. and Frasch, A.C.C. (1986) Sequence diversity in the kinetoplast DNA rninicircles of Trypanosoma cruci. Mol. Biochem. Parasitol. 21, 25-32. Manson-Bahr, P.C. (1987) Diagnosis. In: The Leishmaniases in Biology and Medicine (Peters, W. and Killick-Kendrick, R., eds.), Vol II, pp. 703 729, Academic Press, London. Marsden, P.D. (1985) Clinical presentations of Leishmania hraziliensis hra-iliensis. Parasitol. Today 1, 129 133. Messing, J. (1983) New MI3 vectors for cloning. Methods Enzymol. 101, 20 78. Ridley, D.C. (1980) A histological classification of cutaneous leishmaniasis and its geographical expression. Trans. R. Soc. Trop. Med. Hyg. 74, 515 521. Rodgers, M.R., Popper, S.J. and Wirth, D.F. (1990) Amplification of kinetoplast DNA as a tool in the detection and diagnosis of Leishmania. Exp. Parasitol. 71, 267 275. Rogers, W.O. and Wirth, D.F. (1987) Kinetoplast DNA minicircles: Regions of extensive sequence divergence. Proc. Natl. Acad. Sci. USA 84, 565 569. Rogers, W.O. and Wirth, D.F. (1988) Generation of sequence diversity in the kinetoplast DNA minicircles of Leishmania mexicana anmzonensis. Mol. Biochem. Parasitol. 30, I 8, Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and Ehrlich, H.A. (1988) Primer-directed enzymatic amplilication of DNA with a thermostable DNA polymerase. Science 239, 487 491. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Smith, D.F., Searle, S., Ready, P.D., Grammicia, M. and Ben-lsmail, R. (I989) A kinetoplast DNA probe diagnostic for Leishmania major: Sequence homologies between regions of Leishmania minicircles. Mol. Biochem. Parasitol. 37. 213 224. Smyth, A.J., De Bruijn, M.H.L., Ghosh, A., Hassan, M., Basu, D., Mallik, K.K., Adhya, S. and Barker, D.C. (1992) Rapid and sensitive detection of Leishmania kinetoplast DNA from spleen and blood samples of kahl-azar patients. Parasitology, in press. Staden, R. (1982) An interactive graphics program for comparing and aligning nucleic acid and amino acid sequences. Nucleic Acids Res. 10. 2951 2961. Sturm, N.C. and Simpson, L. (1990) Kinetoplast DNA minicircles encode guide RNAs for editing of cytochrome oxidase subunit 11I mRNA. Cell 61,879 884. Wilson, S.M. (1991) Nucleic acid techniques and the detection of parasitic diseases. Parasitol. Today 7, 255 259. Wirth, D.F., Rogers, W.O., Barker, R., Dourado, H., Suesebang, L. and Albuquerque, B. (1986) Leishmaniasis and malaria: New tools for epidemiologic analysis. Science 234, 975-979.