- Email: [email protected]
Diagnosis of tuberculous meningitis: clinical and laboratory parameters
International Journal of Infectious Diseases (2007) 11, 348—354
http://intl.elsevierhealth.com/journals/ijid
Diagnosis of tuberculous meningitis: clinical and laboratory parameters Ahmed Iqbal Bhigjee a,*, Rivashnee Padayachee a, Hoosain Paruk a, Kumari Devi Hallwirth-Pillay a, Suzaan Marais a, Cathy Connoly b a b
Department of Neurology, Nelson R. Mandela School of Medicine, University of KwaZulu-Natal, South Africa Biostatistics Unit, Medical Research Council of South Africa, KwaZulu-Natal, South Africa
Received 15 December 2005; accepted 8 July 2006 Corresponding Editor: Timothy Barkham, Singapore
KEYWORDS Tuberculous meningitis; Culture; PCR
Summary Background: Confirming the clinical suspicion of tuberculous meningitis (TBM) has always been problematic. Whilst smear and culture positivity are diagnostic, these tests have low sensitivity. The polymerase chain reaction (PCR) assay has given variable results. Aim: This study attempted to improve the diagnostic yield by: (a) increasing the cerebrospinal fluid (CSF) volumes; (b) testing the yield from three specimens of CSF assumed to represent lumbar, cervico-thoracic cord, and base of brain CSF samples; (c) undertaking PCR assays using multiple primer sets; and (d) using real-time PCR. Method: Patients suspected of having cranial or spinal meningeal tuberculosis were entered into the study. Three aliquots of CSF were subjected to smear, culture, and conventional and real-time PCR. Three sets of primers — IS6110, MPB64, and PT8/9 — were used. Patients were retrospectively classified into four categories: ‘definite TB’ (culture positive), ‘probable TB’ (clinical and other tests suggestive of TB), ‘not TB’, and ‘uncertain diagnosis’. Results: A total of 68 patients were studied. There were 20 patients classified as definite TB, 24 probable TB, 17 not TB, and seven uncertain diagnosis. Forty-eight of 57 (84.2%) patients tested were HIV seropositive. The IS6110 PCR was positive in 27 patients which included 18/20 culture positive cases, six in the probable TB group, and three in the not TB group. The MPB64 and PT8/9 primers did not increase the yield. Real-time PCR was positive in seven additional patients. Combining the definite and probable TB, the sensitivity of all PCR assays was 70.5% (31/44) and specificity 87.5% (21/24). Conclusion: Targeting multiple sites of the TB genome using conventional PCR did not increase the number of positive cases. Real-time PCR was more sensitive. However, all the current techniques are still too insensitive to confidently exclude the diagnosis on laboratory grounds. # 2006 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
* Corresponding author. Current address: Department of Neurology, Inkosi Albert Luthuli Central Hospital, Private bag X03, Mayville 4058, South Africa. Tel.: +27 31 2402359; fax: +27 31 2402358. E-mail address: [email protected] (A.I. Bhigjee). 1201-9712/$32.00 # 2006 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.ijid.2006.07.007
349
Diagnosis of tuberculous meningitis
Introduction Tuberculosis (TB) is a major cause of morbidity and mortality. The World Health Organization has noted that the global incidence of TB is increasing by 0.4% per annum.1 For example, in South Africa the prevalence has increased from 190/100 000 in 1980 to 339/100 000 in 2001.2 The human immunodeficiency virus (HIV) contributes to the increased disease burden of TB. Central nervous system TB accounts for about 5% of all extrapulmonary TB and tuberculous meningitis (TBM) is the most serious complication.3 Without treatment most patients die and any delay in treatment results in significant morbidity. The mortality rates vary from 7% to 45%.4 Confirming the clinical suspicion of TBM has always been problematic. Extraneurological clues are often not present. Only about 45% of patients will have chest radiographic evidence of past or present TB5 and only about half will have a positive tuberculin test.6 While the typical routine cerebrospinal fluid (CSF) profile is that of a lymphocyte predominant pleocytosis, a raised protein and a low glucose, there are too many exceptions to exclude the diagnosis of TBM on the absence of these parameters alone. The CSF may be acellular in as many as 3—6% of HIV negative patients and this can be as high as 16% in HIV positive patients.4 There may be a neutrophilic predominance in 20—25% of HIV negative patients.4 The protein level may be normal in about 6% and the glucose level in about 25% of HIV negative patients.4 The figures are higher in HIV positive patients. Smears of the CSF, although diagnostic, are positive in only 5—20% of cases.4 Culture, though the gold standard, is positive in only about 40% of cases4 and may take up to 6 weeks to return a positive result. A number of strategies have been attempted to improve the laboratory diagnosis of TBM. These include techniques to improve smear and culture positivity, biochemical tests, antigen and antibody tests, immunocytochemical studies, and bacterial DNA detection kits. The CSF of most patients with TBM contains only 100— 102 organisms/ml6 yet approximately 104 organisms/ml are required for reliable detection with Ziehl—Neelsen and auramine stains.4 The detection rate in CSF smears can be improved by taking large volumes7,8 of CSF and spinning it at high speeds for a prolonged period (3000 g for 30 min) as the high lipid content of the Mycobacterium tuberculosis cell wall makes it more buoyant than other bacteria.9 Diligent and prolonged duration of microscopy increases smear positivity. For example, Thwaites et al. have reported a smear pick-up rate of 58% with search times varying from 1 to 50 min (median 10 min).8 Traditionally, solid media such as Lowenstein—Jensen, have been used to culture Mycobacterium tuberculosis. It may take 4—6 weeks to obtain a positive culture. Newer radiometric and non-radiometric, semi-automated and fully automated liquid culture systems have decreased the time to a positive result to 1—3 weeks.10,11 Thwaites et al.8 obtained a culture positivity of 71.2% (94/132) using liquid mycobacterial growth indicator tubes and Lowenstein—Jensen medium. To improve the laboratory diagnosis of TBM a number of mycobacterial antigen12,13 and antibody kits14,15 have been designed. However, all have varying degrees of sensitivity and positivity and have not gained wide acceptance. Sumi et al.16 have recently developed an immunocytochemical method to detect mycobacterial antigen in CSF monocytoid
cells. This test was specific (100%) and the sensitivity was 70%. Biochemical markers such as CSF adenosine deaminase (ADA) have been found to be elevated in TBM.14,17 However, elevated CSF ADA levels are seen in a variety of other disorders such as lymphoma and sarcoidosis. An alternative approach would be the detection of biochemical mycobacterial markers such as tuberculostearic acid (TBSA), which is a structural component of mycobacteria. Using gas chromatography/mass spectrometry, French et al.18 found the detection of TBSA in the CSF to be highly specific and sensitive. Further, the TBSA may still be detectable for weeks after initiation of therapy. The drawback is that this test requires expensive equipment and skilled staff. The CSF polymerase chain reaction (PCR) assay represents a significant advance in the diagnosis of microbial diseases and TBM is no exception. The results of PCR studies in the CSF have shown a 94—100% specificity but sensitivities ranging from 75% to 100%.19—22 Variations in the PCR methodologies have been attempted to improve the sensitivity and specificity of the test. Primers targeting regions other than the insertional sequence IS6110 have been used. Narayanan et al.23 used a TRC4 target, a conserved repetitive element specific for Mycobacterium tuberculosis, and found that the sensitivity of the PCR can be increased by using both IS6110 and TRC4 primer sets. Nested PCR is another variation to improve the diagnostic sensitivity and specificity.24 The paucity of Mycobacterium tuberculosis in the CSF may contribute to false negative PCR tests. Immunomagnetic enrichment of the CSF sample has led to improved sensitivity.25 Commercially available nucleic acid amplification kits such as the Gen-Probe Amplified Direct test26 and modification thereof,27 and PCR kits such as the Cobas Amplicor,28,29 have demonstrated sensitivities ranging from 60% to 83% and specificity of 100%. A recent PCR advance is the use of real-time amplification and product detection by fluorescence using FRET (fluorescence resonance energy transfer) probes or SYBR green.30,31 A modification of this test is the quantitative nested realtime PCR.32 Real-time PCR is the fastest system and holds promise. However, to date most studies have used sputa. A more recently developed technique is the use of mycobacteriophage amplification, which detects viable organisms in specimens.33,34 The technique is simple, does not require expensive equipment, and results are obtained within 24— 48 hours. The sensitivity of the FAST plaque TB kit ranges from 76% to 87% and the specificity is about 95%. These studies were on sputum samples. The role of this technique in the diagnosis of TBM remains to be defined, but unpublished data (Sturm W, personal communication) would suggest that it has an unacceptably low sensitivity. In an attempt to improve the diagnosis of TBM we prospectively evaluated the clinical features, sample collection methods, and a variety of laboratory techniques in patients suspected to have neurotuberculosis. The study was approved by the ethics committee of the Nelson R. Mandela School of Medicine.
Patients, materials, and methods Patients suspected to have neurotuberculosis (either cranial or spinal meningitis) on clinical grounds were entered into the study. They were retrospectively classified into four
350 categories: (1) If Mycobacterium tuberculosis was cultured from the CSF (gold standard), they were regarded as ‘definite TB’ cases. (2) If clinical, laboratory and radiological features suggested TBM but the culture was negative, these patients were regarded as ‘probable TB’ cases. These patients may have had chest radiological changes of past or present pulmonary tuberculosis, cranial CT or MRI features such as basal or spinal meningeal enhancement, a CSF profile typically seen in TBM, and negative results for Gram stain, India ink, bacterial and fungal cultures, syphilis serology, and PCR for herpes simplex I and II, herpes zoster and cytomegalovirus. (3) If another cause was found to explain the neurological presentation, these cases were considered to be ‘not TB’ cases. In these cases, other tests, e.g., cryptococcal antigen or response to specific non-tuberculous therapy (e.g., co-trimoxazole for toxoplasmosis), led to the alternative diagnosis. (4) An ‘uncertain diagnosis’ category was used where extensive investigations as described above gave equivocal results. No patient was on anti-tuberculous therapy at the time of neurological presentation. Routine blood tests included complete blood count, erythrocyte sedimentation rate, urea and electrolytes, liver function tests, HIV antibody test, and rapid plasma reagin. Before treatment, CSF was collected in three consecutive lots of approximately 10 ml. The first lot was considered to represent lumbar CSF (specimen 1 = S1), the second to represent thoracic and cervical CSF (specimen 2 = S2), and the last to represent CSF at the base of the brain (specimen 3 = S3). It was not possible to collect exactly 10 ml in all instances (see results). From each specimen of 10 ml of CSF, 5 ml were used for smear and culture. The samples were spun down for 5 min at 3000 g, which is a standard procedure. Under these conditions it is unlikely that buoyant bacteria were lost when the supernatant was discarded. Some organisms may be stuck on the inside of the tubes. To take care of this problem a small amount of buffer and albumin was added to the sediment, vortexed and then cultured. A portion of the pellet was smeared on a slide and viewed under a fluorescent microscope after auramine staining. Fifty fields were viewed. The rest was cultured on 7H 11 agar and in mycobacterial indicator growth tubes. These specimens were cultured at 37 8C for 6 weeks and examined weekly for growth. The remaining 5 ml of CSF from each lot of 10 ml was divided as follows: 4.5 ml was centrifuged at 3000 g for 15 min and set aside for molecular studies. The rest was frozen at 70 8C for later use if required. The supernatant was discarded. Different protocols for DNA extraction were used to obtain optimum DNA purity. These included the boiling method and the Puregene DNA isolation kit (Puregene TM, Gentra, Minneapolis, USA). Once extracted, the DNA was quantified using gel electrophoresis. The extracted DNA was aliquoted and stored at 70 8C for future analysis. Three regions of the Mycobacterium tuberculosis genome were targeted. These were the IS6110 sequence, which is a repeat sequence present in a large number of Mycobacterium tuberculosis strains in a variable number of copies. The MPB64 gene codes for the MPB64 protein and is a 240 bp region (nucleotides 460—700). The third target was a 541 bp region within the IS6110 sequence. Three sets of primers targeting different regions of the Mycobacterium tuberculosis genome were: IS6110R (50 CCCCTGCGAGCGTAGGTAGGCGTCGG30 ), IS6110F (50 CTCGTCC-
A.I. Bhigjee et al. AGCGCCGCTTCGG30 ), MPB64R (50 TCCGCTGCCAGTCGT0 0 CTTCC3 ), MPB64F (5 GCTTCCGCGAGTCTAGGCCA30 ), PT8R (50 GTGCGGATGGTCGCAGAGAT30 ), and PT9F (50 CTCGATGCCCTCACGGTTGA30 ). The PCR mix was made according to recommendations listed in the Amplitaq (Applied Biosystems) handbook. Optimization for each primer set, final concentration of magnesium, and Taq were carried out. The ideal PCR mix for all three PCRs were primer concentrations of 10 pmol/ml and 25 pmol/ml, MgCl2 of 0.5 mM, and Taq volume of 0.25 ml in a 50-ml reaction. Guidelines for PCR conditions were obtained from published data and then optimized in our laboratory. The final PCR conditions were as follows: IS6110 (forward and reverse) — initial denaturation of double stranded DNA molecules at 94 8C for 2 min. This was followed by cycling, which included denaturation at 94 8C for 45 s, annealing at 68 8C for 45 s, and extension at 72 8C for 3 min. After the 40th cycle, the final extension was performed for another 3 min at 72 8C. A cooling step was then performed at 15 8C. MPB64 (forward and reverse) — initial denaturation of double stranded DNA molecules at 94 8C for 4 min. This was followed by cycling, which included denaturation at 94 8C for 1 min, annealing at 60 8C for 1 min, and extension at 72 8C for 4 min. After the 40th cycle, the final extension was performed for another 3 min at 72 8C. A cooling step was then performed at 15 8C. PT8 and PT9 (forward and reverse) — initial denaturation of double-stranded DNA molecules at 94 8C for 1.5 min. This was followed by cycling, which included denaturation at 94 8C for 30 s, annealing at 68 8C for 50 s, and extension at 72 8C for 3 min. After the 30th cycle, the final extension was performed for another 3 min at 72 8C. A cooling step was then performed at 15 8C. For PCR standardization and sensitivity detection, assays were performed by spiking first saline and then culture and smear negative (sterile) CSF with the H37Rv strain of Mycobacterium tuberculosis (source). Dilution was performed according to the McFarland’s standards.35 The PCR conditions were the same as for patient samples and all three sets of primers were used. The real-time PCR was performed using the standard LightCycler (Roche) protocols. Briefly, the commercially available ready-to-use hot start reaction mixture (LightCycler Fast Start DNA, Roche Molecular Biochemicals) supplemented with 4 mM MgCl2 was used. The final concentration was 5.5 mM MgCl2. The same IS6110 primer set as for conventional PCR was used for real-time PCR. The amplification program began with a denaturation step at 95 8C for 10 min, followed by cycling, which included denaturation at 95 8C for 10 s, annealing at 68 8C for 10 s, and extension at 45 8C for 10 s. The instrument was then allowed to cool to 40 8C. In each run a positive and negative control was included. The positive control was from a patient sample known to be positive. The negative control contained all the reagents except DNA, which was replaced with PCR-grade distilled water. The molecular researcher (RP) was blinded to the culture and clinical findings. The clinicians (HP, SM) were blinded to the molecular results at the time of category allocations of definite and probable TB, not TB, and uncertain diagnosis.
351
Diagnosis of tuberculous meningitis Matched Chi-square tests were used to compare sensitivity and specificity of PCR for specimens 1—3. SAS version 9 was used for analysis.
Results Patient data A total of 68 patients were studied. There were 28 men and 40 women. Forty-eight of 57 (84.2%) patients tested were seropositive for HIV. The HIV status was unknown in 11. In the definite TB category (culture positive) there were 20 patients. In the probable TB category there were 24 patients. In the not TB category there were 17 patients. In this category there were three patients who were PCR positive. One had cryptococcal meningitis and another had presumed toxoplasmosis. In neither could a dual infection with TB be excluded. The third patient, who was HIV positive, presented with seizures for which no other cause was found. Her CSF showed a mild pleocytosis and normal biochemistry. There were seven patients in the uncertain diagnosis category where no other cause was found. The chest radiographic (CXR) and routine CSF findings are summarized in Table 1. The CXR, lymphocyte, polymorph, and glucose ratio were significantly different in the combined definite and probable categories when compared with the not TB and uncertain diagnosis categories.
Smear results
Three lots of CSF assumed to reflect lumbar (specimen 1), cervico-thoracic (specimen 2), and base of brain (specimen 3) samples were cultured (Table 2). Seventeen of 20 specimen 1 samples (85.0%) with definite TB were positive. In three patients there was insufficient CSF for specimens 2 and 3. For specimen 2, 16/17 (94.1%) patients with definite TB were culture positive and for specimen 3, 12/17 (70.6%) with definite TB were positive. A further specimen 3 was contaminated and excluded from analysis but included in the denominator.
Conventional PCR Using the IS6110 primer pair, 27 patient samples were positive on conventional PCR in any specimen. These included the 18/20 culture positive cases (any specimen), six in the probable category, and three in the not TB group. The same results were obtained with the MPB64 primer sets. The PT8 and PT9 primer pair was positive in only nine patients, all belonging to the definite category. Combining and using the definite and probable TB as the gold standard, the sensitivity was 54.5% (24/44) and the specificity was 87.5% (21/24). Three additional patients who had other diagnoses had positive conventional and real-time PCR (see above). Since dual infections are possible, including these three patients increased the sensitivity to 61.4% (27/44).
Real-time PCR Real-time PCR was positive in seven additional patients in whom the conventional PCR was negative. All these patients were in the probable category. Combining and using the
No mycobacteria were seen on any smear.
Table 1
Culture results
Comparison of the definite TB and probable TB categories against patients in the uncertain (uncert) and not TB categories Definite/probable
Uncert/not TB
p Value
Age (mean SD) Sex, (%) male HIV, n (%) positive CXR, n (%)
32.2 (10.0) 20/44 (45.4%) 31/36 (86.1%) 32/40 (80.0%)
30.8 (8.7) 8/24 (33.3%) 17/21 (81.0%) 4/24 (16.7%)
0.6 0.3 0.6 0.001
Presentation Cranial Spinal Combination Total
31 (70.5%) 9 (20.5%) 4 (9.1%) 44 (100%)
15 (62.5%) 8 (33.3%) 1 (4.2%) 24 (100%)
Disease severity Grade1 Grade 2 Grade 3
11 (25.0%) 28 (63.6%) 5 (11.4%)
7 (30.4%) 10 (43.5%) 6 (26.1%)
Lymphocytes (mean SD) Polymorphs (mean SD) CSF/blood glucose mmol/l (mean SD) CSF protein (g/l) (mean SD)
68 (157) 155 (335) 0.39 (0.21) 3.67 (10.2)
38 (123) 10 (16) 0.54 (0.18) 1.09 (1.96)
0.006 0.03 0.008 0.0002
SD, standard deviation; CXR, chest radiograph. Cranial = intracranial presentation; spinal = spinal presentation; combination = cranial + spinal. Statistical tests used: age, polymorphs, and glucose compared using the t-test; lymphocytes, CSF, and protein using the rank sum test; sex, HIV, and CXR compared using Chi-square tests.
352
A.I. Bhigjee et al.
Table 2 Comparison of the specimens in each category to the positivity yield from culture, conventional PCR (C-PCR), and realtime PCR (RT-PCR) Diagnostic tests n
Culture n (% pos)
C-PCR n (% pos)
RT-PCR n (%)
Definite TB Specimen 1 Specimen 2 Specimen 3
20 17 17
17 (85.0%) 16 (94.1%) 12 (70.6%)
18 (90.0%) 16 (94.1%) 16 (94.1%)
18 (90.0%) 16 (94.1%) 16 (94.1%)
Probable TB Specimen 1 Specimen 2 Specimen 3
24 24 24
0 (0%) 0 (0%) 0 (0%)
6 (25.0%) 6 (25.0%) 6 (25.0%)
13 (54.2%) 13 (54.2%) 13 (54.2%)
7 7 7
0 (0%) 0 (0%) 0 (0%)
0 (0%) 0 (0%) 0 (0%)
0 (0%) 0 (0%) 0 (0%)
17 17 17
0 (0%) 0 (0%) 0 (0%)
3 (17.6%) 3 (17.6%) 3 (17.6%)
3 (17.6%) 3 (17.6%) 3 (17.6%)
Uncertain diagnosis Specimen 1 Specimen 2 Specimen 3 Not TB Specimen 1 Specimen 2 Specimen 3
definite and probable TB as a gold standard, the sensitivity was 70.5% (31/44) whilst the specificity was 87.5% (21/24).
Site of sample and comparison of culture, conventional PCR, and real-time PCR The results of the definite and probable categories are summarized in Table 3. In these two categories the percent positive on culture decreased from 38.6% at specimen 1 to 29.3% at specimen 3. The difference was not statistically significant. On conventional and real-time PCR there was no significant difference between specimen 1 versus specimen 2 and specimen 1 versus specimen 3.
Discussion Various attempts have been made to improve the diagnosis of TBM using clinical and routine laboratory criteria.36,37 These have included duration of illness, presence of focal signs,
history of exposure, total peripheral white cell count, extent and type of CSF pleocytosis, and CSF glucose level. Depending on combinations of criteria, diagnostic sensitivities have varied from 55% to 98% and specificities from 44% to 98%. These wide ranges point to the limitations of the use of these criteria in the individual patient. There are many exceptions and despite a high index of suspicion in endemic areas, cases are still missed with fatal consequences. The HIV epidemic complicates the picture further. The typical CT or MRI findings of basal enhancement are less common38 and extrameningeal disease is more common.39 The CSF is more frequently acellular and may have a normal protein or glucose level.4,39 It may be impossible to differentiate TBM from cryptococcal meningitis on clinical and routine CSF findings. The majority (48/57; 84.2%) of our patients were HIV seropositive. Atypical features were common. Extraneurological evidence of TB may be of some value. In our study 32/36 (88.9%) patients with either definite or probable TB had an abnormal chest radiograph. This figure
Table 3 Comparison between culture, conventional PCR (C-PCR), and real-time PCR (RT-PCR) according to the specimens 1—3 in the definite TB and probable TB categories (n = 44) Culture
Specimen 1 Specimen 2 Specimen 3 Any specimen Total (95% CI)
C-PCR
RT-PCR
n
Pos.
%
n
Pos.
%
n
Pos.
%
44 41 41 44 126
17 16 12 20 45
38.6 39.0 29.3 45.5 35.7 (27.3—44.7)
44 41 41 44 126
24 22 22 24 68
54.5 53.6 53.6 54.5 54.0 (45.0—62.9)
44 41 41 44 126
31 29 29 31 89
70.4 70.7 70.7 70.4 70.6 (61.9—78.4)
For each specimen, the real-time PCR was significantly more likely to be positive than either the conventional PCR or culture ( p < 0.01 and p < 0.01, respectively).
353
Diagnosis of tuberculous meningitis is similar to that reported by others.4 The serum sodium level was low in 17/44 (38.6%) patients with definite and probable TB. The CSF pleocytosis and the CSF/plasma glucose ratio were significantly abnormal in the definite and probable TB categories compared to the other categories (Table 1). The results of the smears (none positive) were disappointing despite collecting large volumes of CSF and adhering to correct preparation of samples. Using an estimate of 5—20% smear positivity4 we would have expected 1—4 of the 20 culture positive cases to be smear positive. Furthermore daily positive and negative controls for auramine staining were set up. To account for focus shift with fluorescent microscopy a quality control slide is read first. In the past we have checked scanty positive auramine slides with ZiehlNeelsen overlay and have not found it to be better (LR, personal observation). After auramine staining 50 fields were examined. This is equivalent to about 100 oil immersion fields. Although none of the patients were on anti-tuberculous therapy at the time of the neurological presentation, many had evidence of previous pulmonary TB and would have been on treatment then. This may be a possible explanation for our negative results. These findings differ from those of Thwaites et al.8 who saw the organisms in 58% of the cases and in more than half within 15 min. Culture was positive in 20/44 (45.5%) of patients (definite and probable TB). This figure is disappointingly lower than that 71% reported by Thwaites et al.,8 more so since that study found that the organism could be isolated from much smaller volumes of CSF if the patients were HIV seropositive. A drawback of our study is that we were not able to follow up patients to assess response to treatment as confirmatory evidence of TB. It is possible that some of our patients in the probable TB group may not have had TB. If one excludes the PCR negative patients in the probable group then the culture positivity rate increases to 58.8% (20/34). The culture yields from specimens 1—3 were 85%, 94%, and 70%, respectively. Although the numbers are small we did not find an increased yield in the last sample, the one that we assumed to reflect the CSF from the base of brain. The advent of the PCR technique held promise in the confirmation of the diagnosis of TBM. A recent meta-analysis of PCR40 found a high specificity (0.98) but an estimated sensitivity of only 0.56. This meta-analysis examined single amplification sites and reviewed studies using standard PCR tests. There have been few studies attempting to amplify more than one target region of the Mycobacterium tuberculosis genome in the same CSF sample.23 We attempted to detect the IS6110, MPB64 and the PT8 and PT9 target regions. We found that adding a second and a third target did not improve the diagnostic yield. The PT8 and PT9 site was singularly disappointing. Real-time PCR combines rapid cycle DNA amplification with fluorimetry. It eliminates the need to perform amplification and product analysis separately.30,31 In culture samples it has 100% specificity and can detect as few as 10 organisms. Broccolo et al.41 were able to confirm the TBM diagnosis in 14 samples of which only three were culture positive. We targeted the IS6110 region and compared conventional PCR with real-time PCR using the LightCycler instrument. The pickup rate was consistently higher with real-time PCR. No conventional PCR positive result was negative with real-time.
The lower specificity of both conventional (87%) and realtime (87.5%) PCR in our study differs from the 98% obtained in the meta-analysis.40 This might reflect the fact that some of our cases selected as probable TB may not have had TB. The paucity of organisms is well established and is usually in the range of 100—102/ml of CSF.6 The highest concentrations of mycobacteria are thought to be at the base of the brain. To test this finding we collected CSF in three lots of approximately 10 ml each on the assumption that the last lot would represent a CSF sample from the base of the brain and have highest concentration of organisms. However, we found no difference in the sampling sites using culture, conventional PCR, and real-time PCR.
Conclusion This study highlights, once again, the difficulty in confirming the diagnosis of TBM. Whilst the routine cellular and biochemical CSF findings may be suggestive, they are not very specific. Priority should be given to improving smear and culture techniques. Despite the use of auramine staining, where 50 fields are equivalent to 100 oil immersion fields, no smears were positive. This is in contrast to another study8 where the pick-up rate was over 50%. Real-time PCR represents an advance over conventional PCR. All seven additional cases were in the probable TB group, thus improving the PCR sensitivity from 55.8% in the conventional PCR to 72.1% in the real-time PCR. Nested real-time PCR may further improve the sensitivity.32 This approach needs to be explored in greater depth. Future studies should evaluate techniques to detect a specific immune response in the CSF42 or to detect specific mycobacterial proteins.43 The former, however, may have limited success due to paucity of cells in the CSF, whilst the latter requires expensive equipment.
Acknowledgements SM was the recipient of the K.M. Browse Research Scholarship. Secretarial assistance was provided by Mrs V. Pillay. Conflict of interest: No conflict of interest to declare.
References 1. WHO annual report on global TB control–—summary. Wkly Epidemiol Rec 2003;78:122—8. 2. World Health Organization (WHO). Global tuberculosis control report 2003: profiles of high-burden countries. Geneva: WHO; 2003. p. 132—42 3. Hopewell PC. Overview of clinical tuberculosis. In: Bloom BR, editor. Tuberculosis pathogenesis, protection, and control. Washington DC: American Society for Microbiology; 1994 . p. 25—46. 4. Garcia-Monco JC. Central nervous system tuberculosis. Neurol Clin 1999;17:737—59. 5. Girgis NI, Sultan Y, Farid Z, Mansour MM, Erian MW, Hanna LS, et al. Tuberculous meningitis, Abbassia Fever Hospital—Naval Medical Research Unit No. 3, Cairo, Egypt from 1976 to 1996. Am J Trop Med Hyg 1998;58:28—34. 6. Davis LE, Rastogi KR, Lambert LC, Skipper BJ. Tuberculous meningitis in the southwest United States: a community-based study. Neurology 1993;43:1775—8.
354 7. Teoh R, Humphries M. Tuberculous meningitis. In: Lambert HP, editor. Kass handbook of infectious diseases: infections of the central nervous system. Philadelphia PA: BC Decker; 1991 . p. 189—206. 8. Thwaites GE, Chau TTH, Farrar JJ. Improving the bacteriological diagnosis of tuberculous meningitis. J Clin Microbiol 2004;42: 378—9. 9. Kent PT, Kubica GP. Public health mycobacteriology: a guide for the level III laboratory. Atlanta, GA: US Department of Health and Human Services, Public Health Service, The Centers for Disease Control and Prevention; 1985. 10. Heifets LB, Good RB. Current laboratory methods for the diagnosis of tuberculosis. In: Bloom RR, editor. Tuberculosis, pathogenesis, protection and control. Washington: American Society for Microbiology; 1994. p. 85—110. 11. Pfyffer GE, Cieslak C, Welscher H-M, Kissling P, Rusch-Gerdes S. Rapid detection of mycobacteria in clinical specimens by using the automated BACTEC 9000 MB system and comparison with radiometric and solid culture systems. J Clin Microbiol 1977;35: 2229—34. 12. Prabhakar S, Oommen A. ELISA using mycobacterial antigen as a diagnostic aid for tuberculous meningitis. J Neurol Sci 1987;78:203—11. 13. Sumi MG, Mathai A, Sarada C, Radhakrishnan VV. Rapid diagnosis of tuberculous meningitis by a dot immunobinding assay to detect mycobacterial antigen in cerebrospinal fluid specimens. J Clin Microbiol 1999;37:3925—7. 14. Coovadia YM, Dawood A, Ellis ME, Coovadia HM, Daniel TM. Evaluation of adenosine deaminase activity and antibody to Mycobacterium tuberculosis antigen 5 in cerebrospinal fluid and the radioactive bromide partition test for the early diagnosis of tuberculosis meningitis. Arch Dis Child 1986;61:428—35. 15. Kameswaran M, Shetty K, Ray MK, Jaleel MA, Kadival GV. Evaluation of an in-house-developed radio-assay kit for antibody detection in cases of pulmonary tuberculosis and tuberculous meningitis. Clin Diagn Lab Immunol 2002;9:987—93. 16. Sumi MG, Mathai A, Reuben S, Sarada C, Radhakrishnan VV. Immunocytochemical method for early laboratory diagnosis of tuberculous meningitis. Clin Diag Lab Immunol 2002;9:344—7. 17. Mishra OP, Loiwal V, Ali Z, Nath G, Chandra L. Cerebrospinal fluid adenosine deaminase activity for the diagnosis of tuberculous meningitis in children. J Trop Pediatr 1996;42:129—32. 18. French GL, Teoh R, Chan CY, Humphries MJ, Cheung SW, O’Mahony G. Diagnosis of tuberculous meningitis by detection of tuberculostearic acid in cerebrospinal fluid. Lancet 1987;330: 117—9. 19. Shankar P, Manjunath N, Shriniwas KK, Mohan K, Prasad M, Behari G, et al. Rapid diagnosis of tuberculous meningitis by polymerase chain reaction. Lancet 1991;337:5—7. 20. Miorner H, Sjobring U, Nayak P, Chandramuki A. Diagnosis of tuberculous meningitis: a comparative analysis of 3 immunoassays, an immune complex assay and the polymerase chain reaction. Tuber Lung Dis 1995;76:381—6. 21. Nguyen LN, Kox LF, Pham LD, Kuijper S, Kolk AH. The potential contribution of the polymerase chain reaction to the diagnosis of tuberculous meningitis. Arch Neurol 1996;53:771—6. 22. Caws M, Wilson SM, Clough C, Drobniewski F. Role of IS6110 targeted PCR, biochemical, clinical and immunological criteria for diagnosis of tuberculous meningitis. J Clin Microbiol 2000;38:3150—5. 23. Narayanan S, Parandaman V, Narayanan PR, Venkatesan P, Girish C, Mahadevan S, et al. Evaluation of PCR using TRC4 and IA9110 primers in detection of tuberculous meningitis. J Clin Microbiol 2001;39:2006—8. 24. Scarpellini P, Racca S, Cinque P, Delfanti F, Gianotti N, Terreni MR, et al. Nested polymerase chain reaction for diagnosis and monitoring treatment response in AIDS patients with tuberculous meningitis. AIDS 1995;9:895—900.
A.I. Bhigjee et al. 25. Mazurek GH, Reddy V, Murphy D, Ansari T. Detection of Mycobacterium tuberculosis in cerebrospinal fluid following immunomagnetic enrichment. J Clin Microbiol 1996;34:450—3. 26. Lang AM, Feris-Iglesias J, Pena C, Sanchez JF, Stockman L, Rys P, et al. Clinical evaluation of Gen-Probe amplified direct test for the detection of Mycobacterium tuberculosis complex organisms in cerebrospinal fluid. J Clin Microbiol 1998;36:2191—4. 27. Cloud JL, Shutt C, Aldous W, Woods G. Evaluation of a modified Gen-Probe amplified direct test for detection of Mycobacterium tuberculosis complex organisms in cerebrospinal fluid. J Clin Microbiol 2004;42:5341—4. 28. Bonington A, Strang JI, Klapper PE, Hood SV, Rubombora W, Penny M, et al. Use of Roche AMPLICOR Mycobacterium tuberculosis PCR in early diagnosis of tuberculous meningitis. J Clin Microbiol 1998;36:1251—4. 29. Bayram A, Celikso ¨z C, Karsligil T, Balci I. Automatized PCR evaluation of Mycobacterium tuberculosis complex in respiratory and non-respiratory specimens. FEMS Immunol Med Microbiol 2006;46:48—52. 30. Lachnik J, Ackermann B, Bohrssen A, Maass S, Diephaus C, Puncken A, et al. Rapid cycle PCR and fluorimetry for detection of mycobacteria. J Clin Microbiol 2002;40:3364—73. 31. Heginbothom ML, Magee JT, Flanagan PG. Evaluation of the IdahoTechnology Light Cycler PCR for the direct detection of Mycobacterium tuberculosis in respiratory specimens. Int J Tuberc Lung Dis 2003;7:78—83. 32. Takahashi T, Nakayana T. Novel technique of quantitative nested real-time PCR assay for Mycobacterium tuberculosis DNA. J Clin Microbiol 2006;44:1029—39. 33. Marei AM, El-Behedy EM, Mohtady HA, Afify RF. Evaluation of a rapid bacteriophage-based method for the detection of Mycobacterium tuberculosis in clinical samples. J Med Microbiol 2003;52:331—5. 34. Albay A, Kisa O, Baylan O, Doganie L. The evaluation of fast plaque TB test for the rapid diagnosis of tuberculosis. Diagn Microbiol Infect Dis 2003;46:211—5. 35. Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken RH. Manual of clinical microbiology. 7th ed. Washington DC: ACM Press; 1999 . p. 1526—43. 36. Kumar R, Singh SN, Kohli N. A diagnostic rule for tuberculous meningitis. Arch Dis Child 1999;81:221—4. 37. Thwaites GE, Chan TT, Stepnieswska K, Phu NH, Chuong LV, Sinh DX, et al. Diagnosis of adult tuberculous meningitis by use of clinical and laboratory features. Lancet 2002;360:1287—92. 38. Katrak SM, Shembalkar PK, Bijwe SR, Bhandarkar LD. The clinical, radiological and pathological profile of tuberculous meningitis in patients with and without human immunodeficiency virus infection. J Neurol Sci 2000;181:118—26. 39. Karstaedt AS, Valtchanova S, Barriere R, Crewe-Brown HH. Tuberculous meningitis in South African urban adults. QJM 1998;91:743—7. 40. Pai M, Flores LL, Pai N, Hubbard A, Riley LW, Colford JM. Diagnostic accuracy of nucleic acid amplification tests for tuberculous meningitis: a systematic review and meta-analysis. Lancet Infect Dis 2003;3:633—43. 41. Broccolo F, Scarpellini P, Locatelli G, Zingale A, Brambilla AM, Cichero P, et al. Rapid diagnosis of mycobacterial infection and quantitation of Mycobacterium tuberculosis load by two realtime calibrated PCR assays. J Clin Microbiol 2003;41:4565—72. 42. Lalvani A, Pathan AA, Durkan H, Wilkinson KA, Whelen A, Deeks JJ, et al. Enhanced contact tracing and spatial tracking of Mycobacterium tuberculosis infection by enumeration of antigen-specific T cells. Lancet 2001;357:2017—21. 43. Schmidt F, Donahue S, Hagens K, Mattow J, Schaible UE, Kaufmann SH, et al. Complementary analysis of Mycobacterium tuberculosis proteome by two dimensional electrophoresis and isotope coded affinity tag technology. Mol Cell Proteomics 2004;3:24—42.
http://intl.elsevierhealth.com/journals/ijid
Diagnosis of tuberculous meningitis: clinical and laboratory parameters Ahmed Iqbal Bhigjee a,*, Rivashnee Padayachee a, Hoosain Paruk a, Kumari Devi Hallwirth-Pillay a, Suzaan Marais a, Cathy Connoly b a b
Department of Neurology, Nelson R. Mandela School of Medicine, University of KwaZulu-Natal, South Africa Biostatistics Unit, Medical Research Council of South Africa, KwaZulu-Natal, South Africa
Received 15 December 2005; accepted 8 July 2006 Corresponding Editor: Timothy Barkham, Singapore
KEYWORDS Tuberculous meningitis; Culture; PCR
Summary Background: Confirming the clinical suspicion of tuberculous meningitis (TBM) has always been problematic. Whilst smear and culture positivity are diagnostic, these tests have low sensitivity. The polymerase chain reaction (PCR) assay has given variable results. Aim: This study attempted to improve the diagnostic yield by: (a) increasing the cerebrospinal fluid (CSF) volumes; (b) testing the yield from three specimens of CSF assumed to represent lumbar, cervico-thoracic cord, and base of brain CSF samples; (c) undertaking PCR assays using multiple primer sets; and (d) using real-time PCR. Method: Patients suspected of having cranial or spinal meningeal tuberculosis were entered into the study. Three aliquots of CSF were subjected to smear, culture, and conventional and real-time PCR. Three sets of primers — IS6110, MPB64, and PT8/9 — were used. Patients were retrospectively classified into four categories: ‘definite TB’ (culture positive), ‘probable TB’ (clinical and other tests suggestive of TB), ‘not TB’, and ‘uncertain diagnosis’. Results: A total of 68 patients were studied. There were 20 patients classified as definite TB, 24 probable TB, 17 not TB, and seven uncertain diagnosis. Forty-eight of 57 (84.2%) patients tested were HIV seropositive. The IS6110 PCR was positive in 27 patients which included 18/20 culture positive cases, six in the probable TB group, and three in the not TB group. The MPB64 and PT8/9 primers did not increase the yield. Real-time PCR was positive in seven additional patients. Combining the definite and probable TB, the sensitivity of all PCR assays was 70.5% (31/44) and specificity 87.5% (21/24). Conclusion: Targeting multiple sites of the TB genome using conventional PCR did not increase the number of positive cases. Real-time PCR was more sensitive. However, all the current techniques are still too insensitive to confidently exclude the diagnosis on laboratory grounds. # 2006 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
* Corresponding author. Current address: Department of Neurology, Inkosi Albert Luthuli Central Hospital, Private bag X03, Mayville 4058, South Africa. Tel.: +27 31 2402359; fax: +27 31 2402358. E-mail address: [email protected] (A.I. Bhigjee). 1201-9712/$32.00 # 2006 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.ijid.2006.07.007
349
Diagnosis of tuberculous meningitis
Introduction Tuberculosis (TB) is a major cause of morbidity and mortality. The World Health Organization has noted that the global incidence of TB is increasing by 0.4% per annum.1 For example, in South Africa the prevalence has increased from 190/100 000 in 1980 to 339/100 000 in 2001.2 The human immunodeficiency virus (HIV) contributes to the increased disease burden of TB. Central nervous system TB accounts for about 5% of all extrapulmonary TB and tuberculous meningitis (TBM) is the most serious complication.3 Without treatment most patients die and any delay in treatment results in significant morbidity. The mortality rates vary from 7% to 45%.4 Confirming the clinical suspicion of TBM has always been problematic. Extraneurological clues are often not present. Only about 45% of patients will have chest radiographic evidence of past or present TB5 and only about half will have a positive tuberculin test.6 While the typical routine cerebrospinal fluid (CSF) profile is that of a lymphocyte predominant pleocytosis, a raised protein and a low glucose, there are too many exceptions to exclude the diagnosis of TBM on the absence of these parameters alone. The CSF may be acellular in as many as 3—6% of HIV negative patients and this can be as high as 16% in HIV positive patients.4 There may be a neutrophilic predominance in 20—25% of HIV negative patients.4 The protein level may be normal in about 6% and the glucose level in about 25% of HIV negative patients.4 The figures are higher in HIV positive patients. Smears of the CSF, although diagnostic, are positive in only 5—20% of cases.4 Culture, though the gold standard, is positive in only about 40% of cases4 and may take up to 6 weeks to return a positive result. A number of strategies have been attempted to improve the laboratory diagnosis of TBM. These include techniques to improve smear and culture positivity, biochemical tests, antigen and antibody tests, immunocytochemical studies, and bacterial DNA detection kits. The CSF of most patients with TBM contains only 100— 102 organisms/ml6 yet approximately 104 organisms/ml are required for reliable detection with Ziehl—Neelsen and auramine stains.4 The detection rate in CSF smears can be improved by taking large volumes7,8 of CSF and spinning it at high speeds for a prolonged period (3000 g for 30 min) as the high lipid content of the Mycobacterium tuberculosis cell wall makes it more buoyant than other bacteria.9 Diligent and prolonged duration of microscopy increases smear positivity. For example, Thwaites et al. have reported a smear pick-up rate of 58% with search times varying from 1 to 50 min (median 10 min).8 Traditionally, solid media such as Lowenstein—Jensen, have been used to culture Mycobacterium tuberculosis. It may take 4—6 weeks to obtain a positive culture. Newer radiometric and non-radiometric, semi-automated and fully automated liquid culture systems have decreased the time to a positive result to 1—3 weeks.10,11 Thwaites et al.8 obtained a culture positivity of 71.2% (94/132) using liquid mycobacterial growth indicator tubes and Lowenstein—Jensen medium. To improve the laboratory diagnosis of TBM a number of mycobacterial antigen12,13 and antibody kits14,15 have been designed. However, all have varying degrees of sensitivity and positivity and have not gained wide acceptance. Sumi et al.16 have recently developed an immunocytochemical method to detect mycobacterial antigen in CSF monocytoid
cells. This test was specific (100%) and the sensitivity was 70%. Biochemical markers such as CSF adenosine deaminase (ADA) have been found to be elevated in TBM.14,17 However, elevated CSF ADA levels are seen in a variety of other disorders such as lymphoma and sarcoidosis. An alternative approach would be the detection of biochemical mycobacterial markers such as tuberculostearic acid (TBSA), which is a structural component of mycobacteria. Using gas chromatography/mass spectrometry, French et al.18 found the detection of TBSA in the CSF to be highly specific and sensitive. Further, the TBSA may still be detectable for weeks after initiation of therapy. The drawback is that this test requires expensive equipment and skilled staff. The CSF polymerase chain reaction (PCR) assay represents a significant advance in the diagnosis of microbial diseases and TBM is no exception. The results of PCR studies in the CSF have shown a 94—100% specificity but sensitivities ranging from 75% to 100%.19—22 Variations in the PCR methodologies have been attempted to improve the sensitivity and specificity of the test. Primers targeting regions other than the insertional sequence IS6110 have been used. Narayanan et al.23 used a TRC4 target, a conserved repetitive element specific for Mycobacterium tuberculosis, and found that the sensitivity of the PCR can be increased by using both IS6110 and TRC4 primer sets. Nested PCR is another variation to improve the diagnostic sensitivity and specificity.24 The paucity of Mycobacterium tuberculosis in the CSF may contribute to false negative PCR tests. Immunomagnetic enrichment of the CSF sample has led to improved sensitivity.25 Commercially available nucleic acid amplification kits such as the Gen-Probe Amplified Direct test26 and modification thereof,27 and PCR kits such as the Cobas Amplicor,28,29 have demonstrated sensitivities ranging from 60% to 83% and specificity of 100%. A recent PCR advance is the use of real-time amplification and product detection by fluorescence using FRET (fluorescence resonance energy transfer) probes or SYBR green.30,31 A modification of this test is the quantitative nested realtime PCR.32 Real-time PCR is the fastest system and holds promise. However, to date most studies have used sputa. A more recently developed technique is the use of mycobacteriophage amplification, which detects viable organisms in specimens.33,34 The technique is simple, does not require expensive equipment, and results are obtained within 24— 48 hours. The sensitivity of the FAST plaque TB kit ranges from 76% to 87% and the specificity is about 95%. These studies were on sputum samples. The role of this technique in the diagnosis of TBM remains to be defined, but unpublished data (Sturm W, personal communication) would suggest that it has an unacceptably low sensitivity. In an attempt to improve the diagnosis of TBM we prospectively evaluated the clinical features, sample collection methods, and a variety of laboratory techniques in patients suspected to have neurotuberculosis. The study was approved by the ethics committee of the Nelson R. Mandela School of Medicine.
Patients, materials, and methods Patients suspected to have neurotuberculosis (either cranial or spinal meningitis) on clinical grounds were entered into the study. They were retrospectively classified into four
350 categories: (1) If Mycobacterium tuberculosis was cultured from the CSF (gold standard), they were regarded as ‘definite TB’ cases. (2) If clinical, laboratory and radiological features suggested TBM but the culture was negative, these patients were regarded as ‘probable TB’ cases. These patients may have had chest radiological changes of past or present pulmonary tuberculosis, cranial CT or MRI features such as basal or spinal meningeal enhancement, a CSF profile typically seen in TBM, and negative results for Gram stain, India ink, bacterial and fungal cultures, syphilis serology, and PCR for herpes simplex I and II, herpes zoster and cytomegalovirus. (3) If another cause was found to explain the neurological presentation, these cases were considered to be ‘not TB’ cases. In these cases, other tests, e.g., cryptococcal antigen or response to specific non-tuberculous therapy (e.g., co-trimoxazole for toxoplasmosis), led to the alternative diagnosis. (4) An ‘uncertain diagnosis’ category was used where extensive investigations as described above gave equivocal results. No patient was on anti-tuberculous therapy at the time of neurological presentation. Routine blood tests included complete blood count, erythrocyte sedimentation rate, urea and electrolytes, liver function tests, HIV antibody test, and rapid plasma reagin. Before treatment, CSF was collected in three consecutive lots of approximately 10 ml. The first lot was considered to represent lumbar CSF (specimen 1 = S1), the second to represent thoracic and cervical CSF (specimen 2 = S2), and the last to represent CSF at the base of the brain (specimen 3 = S3). It was not possible to collect exactly 10 ml in all instances (see results). From each specimen of 10 ml of CSF, 5 ml were used for smear and culture. The samples were spun down for 5 min at 3000 g, which is a standard procedure. Under these conditions it is unlikely that buoyant bacteria were lost when the supernatant was discarded. Some organisms may be stuck on the inside of the tubes. To take care of this problem a small amount of buffer and albumin was added to the sediment, vortexed and then cultured. A portion of the pellet was smeared on a slide and viewed under a fluorescent microscope after auramine staining. Fifty fields were viewed. The rest was cultured on 7H 11 agar and in mycobacterial indicator growth tubes. These specimens were cultured at 37 8C for 6 weeks and examined weekly for growth. The remaining 5 ml of CSF from each lot of 10 ml was divided as follows: 4.5 ml was centrifuged at 3000 g for 15 min and set aside for molecular studies. The rest was frozen at 70 8C for later use if required. The supernatant was discarded. Different protocols for DNA extraction were used to obtain optimum DNA purity. These included the boiling method and the Puregene DNA isolation kit (Puregene TM, Gentra, Minneapolis, USA). Once extracted, the DNA was quantified using gel electrophoresis. The extracted DNA was aliquoted and stored at 70 8C for future analysis. Three regions of the Mycobacterium tuberculosis genome were targeted. These were the IS6110 sequence, which is a repeat sequence present in a large number of Mycobacterium tuberculosis strains in a variable number of copies. The MPB64 gene codes for the MPB64 protein and is a 240 bp region (nucleotides 460—700). The third target was a 541 bp region within the IS6110 sequence. Three sets of primers targeting different regions of the Mycobacterium tuberculosis genome were: IS6110R (50 CCCCTGCGAGCGTAGGTAGGCGTCGG30 ), IS6110F (50 CTCGTCC-
A.I. Bhigjee et al. AGCGCCGCTTCGG30 ), MPB64R (50 TCCGCTGCCAGTCGT0 0 CTTCC3 ), MPB64F (5 GCTTCCGCGAGTCTAGGCCA30 ), PT8R (50 GTGCGGATGGTCGCAGAGAT30 ), and PT9F (50 CTCGATGCCCTCACGGTTGA30 ). The PCR mix was made according to recommendations listed in the Amplitaq (Applied Biosystems) handbook. Optimization for each primer set, final concentration of magnesium, and Taq were carried out. The ideal PCR mix for all three PCRs were primer concentrations of 10 pmol/ml and 25 pmol/ml, MgCl2 of 0.5 mM, and Taq volume of 0.25 ml in a 50-ml reaction. Guidelines for PCR conditions were obtained from published data and then optimized in our laboratory. The final PCR conditions were as follows: IS6110 (forward and reverse) — initial denaturation of double stranded DNA molecules at 94 8C for 2 min. This was followed by cycling, which included denaturation at 94 8C for 45 s, annealing at 68 8C for 45 s, and extension at 72 8C for 3 min. After the 40th cycle, the final extension was performed for another 3 min at 72 8C. A cooling step was then performed at 15 8C. MPB64 (forward and reverse) — initial denaturation of double stranded DNA molecules at 94 8C for 4 min. This was followed by cycling, which included denaturation at 94 8C for 1 min, annealing at 60 8C for 1 min, and extension at 72 8C for 4 min. After the 40th cycle, the final extension was performed for another 3 min at 72 8C. A cooling step was then performed at 15 8C. PT8 and PT9 (forward and reverse) — initial denaturation of double-stranded DNA molecules at 94 8C for 1.5 min. This was followed by cycling, which included denaturation at 94 8C for 30 s, annealing at 68 8C for 50 s, and extension at 72 8C for 3 min. After the 30th cycle, the final extension was performed for another 3 min at 72 8C. A cooling step was then performed at 15 8C. For PCR standardization and sensitivity detection, assays were performed by spiking first saline and then culture and smear negative (sterile) CSF with the H37Rv strain of Mycobacterium tuberculosis (source). Dilution was performed according to the McFarland’s standards.35 The PCR conditions were the same as for patient samples and all three sets of primers were used. The real-time PCR was performed using the standard LightCycler (Roche) protocols. Briefly, the commercially available ready-to-use hot start reaction mixture (LightCycler Fast Start DNA, Roche Molecular Biochemicals) supplemented with 4 mM MgCl2 was used. The final concentration was 5.5 mM MgCl2. The same IS6110 primer set as for conventional PCR was used for real-time PCR. The amplification program began with a denaturation step at 95 8C for 10 min, followed by cycling, which included denaturation at 95 8C for 10 s, annealing at 68 8C for 10 s, and extension at 45 8C for 10 s. The instrument was then allowed to cool to 40 8C. In each run a positive and negative control was included. The positive control was from a patient sample known to be positive. The negative control contained all the reagents except DNA, which was replaced with PCR-grade distilled water. The molecular researcher (RP) was blinded to the culture and clinical findings. The clinicians (HP, SM) were blinded to the molecular results at the time of category allocations of definite and probable TB, not TB, and uncertain diagnosis.
351
Diagnosis of tuberculous meningitis Matched Chi-square tests were used to compare sensitivity and specificity of PCR for specimens 1—3. SAS version 9 was used for analysis.
Results Patient data A total of 68 patients were studied. There were 28 men and 40 women. Forty-eight of 57 (84.2%) patients tested were seropositive for HIV. The HIV status was unknown in 11. In the definite TB category (culture positive) there were 20 patients. In the probable TB category there were 24 patients. In the not TB category there were 17 patients. In this category there were three patients who were PCR positive. One had cryptococcal meningitis and another had presumed toxoplasmosis. In neither could a dual infection with TB be excluded. The third patient, who was HIV positive, presented with seizures for which no other cause was found. Her CSF showed a mild pleocytosis and normal biochemistry. There were seven patients in the uncertain diagnosis category where no other cause was found. The chest radiographic (CXR) and routine CSF findings are summarized in Table 1. The CXR, lymphocyte, polymorph, and glucose ratio were significantly different in the combined definite and probable categories when compared with the not TB and uncertain diagnosis categories.
Smear results
Three lots of CSF assumed to reflect lumbar (specimen 1), cervico-thoracic (specimen 2), and base of brain (specimen 3) samples were cultured (Table 2). Seventeen of 20 specimen 1 samples (85.0%) with definite TB were positive. In three patients there was insufficient CSF for specimens 2 and 3. For specimen 2, 16/17 (94.1%) patients with definite TB were culture positive and for specimen 3, 12/17 (70.6%) with definite TB were positive. A further specimen 3 was contaminated and excluded from analysis but included in the denominator.
Conventional PCR Using the IS6110 primer pair, 27 patient samples were positive on conventional PCR in any specimen. These included the 18/20 culture positive cases (any specimen), six in the probable category, and three in the not TB group. The same results were obtained with the MPB64 primer sets. The PT8 and PT9 primer pair was positive in only nine patients, all belonging to the definite category. Combining and using the definite and probable TB as the gold standard, the sensitivity was 54.5% (24/44) and the specificity was 87.5% (21/24). Three additional patients who had other diagnoses had positive conventional and real-time PCR (see above). Since dual infections are possible, including these three patients increased the sensitivity to 61.4% (27/44).
Real-time PCR Real-time PCR was positive in seven additional patients in whom the conventional PCR was negative. All these patients were in the probable category. Combining and using the
No mycobacteria were seen on any smear.
Table 1
Culture results
Comparison of the definite TB and probable TB categories against patients in the uncertain (uncert) and not TB categories Definite/probable
Uncert/not TB
p Value
Age (mean SD) Sex, (%) male HIV, n (%) positive CXR, n (%)
32.2 (10.0) 20/44 (45.4%) 31/36 (86.1%) 32/40 (80.0%)
30.8 (8.7) 8/24 (33.3%) 17/21 (81.0%) 4/24 (16.7%)
0.6 0.3 0.6 0.001
Presentation Cranial Spinal Combination Total
31 (70.5%) 9 (20.5%) 4 (9.1%) 44 (100%)
15 (62.5%) 8 (33.3%) 1 (4.2%) 24 (100%)
Disease severity Grade1 Grade 2 Grade 3
11 (25.0%) 28 (63.6%) 5 (11.4%)
7 (30.4%) 10 (43.5%) 6 (26.1%)
Lymphocytes (mean SD) Polymorphs (mean SD) CSF/blood glucose mmol/l (mean SD) CSF protein (g/l) (mean SD)
68 (157) 155 (335) 0.39 (0.21) 3.67 (10.2)
38 (123) 10 (16) 0.54 (0.18) 1.09 (1.96)
0.006 0.03 0.008 0.0002
SD, standard deviation; CXR, chest radiograph. Cranial = intracranial presentation; spinal = spinal presentation; combination = cranial + spinal. Statistical tests used: age, polymorphs, and glucose compared using the t-test; lymphocytes, CSF, and protein using the rank sum test; sex, HIV, and CXR compared using Chi-square tests.
352
A.I. Bhigjee et al.
Table 2 Comparison of the specimens in each category to the positivity yield from culture, conventional PCR (C-PCR), and realtime PCR (RT-PCR) Diagnostic tests n
Culture n (% pos)
C-PCR n (% pos)
RT-PCR n (%)
Definite TB Specimen 1 Specimen 2 Specimen 3
20 17 17
17 (85.0%) 16 (94.1%) 12 (70.6%)
18 (90.0%) 16 (94.1%) 16 (94.1%)
18 (90.0%) 16 (94.1%) 16 (94.1%)
Probable TB Specimen 1 Specimen 2 Specimen 3
24 24 24
0 (0%) 0 (0%) 0 (0%)
6 (25.0%) 6 (25.0%) 6 (25.0%)
13 (54.2%) 13 (54.2%) 13 (54.2%)
7 7 7
0 (0%) 0 (0%) 0 (0%)
0 (0%) 0 (0%) 0 (0%)
0 (0%) 0 (0%) 0 (0%)
17 17 17
0 (0%) 0 (0%) 0 (0%)
3 (17.6%) 3 (17.6%) 3 (17.6%)
3 (17.6%) 3 (17.6%) 3 (17.6%)
Uncertain diagnosis Specimen 1 Specimen 2 Specimen 3 Not TB Specimen 1 Specimen 2 Specimen 3
definite and probable TB as a gold standard, the sensitivity was 70.5% (31/44) whilst the specificity was 87.5% (21/24).
Site of sample and comparison of culture, conventional PCR, and real-time PCR The results of the definite and probable categories are summarized in Table 3. In these two categories the percent positive on culture decreased from 38.6% at specimen 1 to 29.3% at specimen 3. The difference was not statistically significant. On conventional and real-time PCR there was no significant difference between specimen 1 versus specimen 2 and specimen 1 versus specimen 3.
Discussion Various attempts have been made to improve the diagnosis of TBM using clinical and routine laboratory criteria.36,37 These have included duration of illness, presence of focal signs,
history of exposure, total peripheral white cell count, extent and type of CSF pleocytosis, and CSF glucose level. Depending on combinations of criteria, diagnostic sensitivities have varied from 55% to 98% and specificities from 44% to 98%. These wide ranges point to the limitations of the use of these criteria in the individual patient. There are many exceptions and despite a high index of suspicion in endemic areas, cases are still missed with fatal consequences. The HIV epidemic complicates the picture further. The typical CT or MRI findings of basal enhancement are less common38 and extrameningeal disease is more common.39 The CSF is more frequently acellular and may have a normal protein or glucose level.4,39 It may be impossible to differentiate TBM from cryptococcal meningitis on clinical and routine CSF findings. The majority (48/57; 84.2%) of our patients were HIV seropositive. Atypical features were common. Extraneurological evidence of TB may be of some value. In our study 32/36 (88.9%) patients with either definite or probable TB had an abnormal chest radiograph. This figure
Table 3 Comparison between culture, conventional PCR (C-PCR), and real-time PCR (RT-PCR) according to the specimens 1—3 in the definite TB and probable TB categories (n = 44) Culture
Specimen 1 Specimen 2 Specimen 3 Any specimen Total (95% CI)
C-PCR
RT-PCR
n
Pos.
%
n
Pos.
%
n
Pos.
%
44 41 41 44 126
17 16 12 20 45
38.6 39.0 29.3 45.5 35.7 (27.3—44.7)
44 41 41 44 126
24 22 22 24 68
54.5 53.6 53.6 54.5 54.0 (45.0—62.9)
44 41 41 44 126
31 29 29 31 89
70.4 70.7 70.7 70.4 70.6 (61.9—78.4)
For each specimen, the real-time PCR was significantly more likely to be positive than either the conventional PCR or culture ( p < 0.01 and p < 0.01, respectively).
353
Diagnosis of tuberculous meningitis is similar to that reported by others.4 The serum sodium level was low in 17/44 (38.6%) patients with definite and probable TB. The CSF pleocytosis and the CSF/plasma glucose ratio were significantly abnormal in the definite and probable TB categories compared to the other categories (Table 1). The results of the smears (none positive) were disappointing despite collecting large volumes of CSF and adhering to correct preparation of samples. Using an estimate of 5—20% smear positivity4 we would have expected 1—4 of the 20 culture positive cases to be smear positive. Furthermore daily positive and negative controls for auramine staining were set up. To account for focus shift with fluorescent microscopy a quality control slide is read first. In the past we have checked scanty positive auramine slides with ZiehlNeelsen overlay and have not found it to be better (LR, personal observation). After auramine staining 50 fields were examined. This is equivalent to about 100 oil immersion fields. Although none of the patients were on anti-tuberculous therapy at the time of the neurological presentation, many had evidence of previous pulmonary TB and would have been on treatment then. This may be a possible explanation for our negative results. These findings differ from those of Thwaites et al.8 who saw the organisms in 58% of the cases and in more than half within 15 min. Culture was positive in 20/44 (45.5%) of patients (definite and probable TB). This figure is disappointingly lower than that 71% reported by Thwaites et al.,8 more so since that study found that the organism could be isolated from much smaller volumes of CSF if the patients were HIV seropositive. A drawback of our study is that we were not able to follow up patients to assess response to treatment as confirmatory evidence of TB. It is possible that some of our patients in the probable TB group may not have had TB. If one excludes the PCR negative patients in the probable group then the culture positivity rate increases to 58.8% (20/34). The culture yields from specimens 1—3 were 85%, 94%, and 70%, respectively. Although the numbers are small we did not find an increased yield in the last sample, the one that we assumed to reflect the CSF from the base of brain. The advent of the PCR technique held promise in the confirmation of the diagnosis of TBM. A recent meta-analysis of PCR40 found a high specificity (0.98) but an estimated sensitivity of only 0.56. This meta-analysis examined single amplification sites and reviewed studies using standard PCR tests. There have been few studies attempting to amplify more than one target region of the Mycobacterium tuberculosis genome in the same CSF sample.23 We attempted to detect the IS6110, MPB64 and the PT8 and PT9 target regions. We found that adding a second and a third target did not improve the diagnostic yield. The PT8 and PT9 site was singularly disappointing. Real-time PCR combines rapid cycle DNA amplification with fluorimetry. It eliminates the need to perform amplification and product analysis separately.30,31 In culture samples it has 100% specificity and can detect as few as 10 organisms. Broccolo et al.41 were able to confirm the TBM diagnosis in 14 samples of which only three were culture positive. We targeted the IS6110 region and compared conventional PCR with real-time PCR using the LightCycler instrument. The pickup rate was consistently higher with real-time PCR. No conventional PCR positive result was negative with real-time.
The lower specificity of both conventional (87%) and realtime (87.5%) PCR in our study differs from the 98% obtained in the meta-analysis.40 This might reflect the fact that some of our cases selected as probable TB may not have had TB. The paucity of organisms is well established and is usually in the range of 100—102/ml of CSF.6 The highest concentrations of mycobacteria are thought to be at the base of the brain. To test this finding we collected CSF in three lots of approximately 10 ml each on the assumption that the last lot would represent a CSF sample from the base of the brain and have highest concentration of organisms. However, we found no difference in the sampling sites using culture, conventional PCR, and real-time PCR.
Conclusion This study highlights, once again, the difficulty in confirming the diagnosis of TBM. Whilst the routine cellular and biochemical CSF findings may be suggestive, they are not very specific. Priority should be given to improving smear and culture techniques. Despite the use of auramine staining, where 50 fields are equivalent to 100 oil immersion fields, no smears were positive. This is in contrast to another study8 where the pick-up rate was over 50%. Real-time PCR represents an advance over conventional PCR. All seven additional cases were in the probable TB group, thus improving the PCR sensitivity from 55.8% in the conventional PCR to 72.1% in the real-time PCR. Nested real-time PCR may further improve the sensitivity.32 This approach needs to be explored in greater depth. Future studies should evaluate techniques to detect a specific immune response in the CSF42 or to detect specific mycobacterial proteins.43 The former, however, may have limited success due to paucity of cells in the CSF, whilst the latter requires expensive equipment.
Acknowledgements SM was the recipient of the K.M. Browse Research Scholarship. Secretarial assistance was provided by Mrs V. Pillay. Conflict of interest: No conflict of interest to declare.
References 1. WHO annual report on global TB control–—summary. Wkly Epidemiol Rec 2003;78:122—8. 2. World Health Organization (WHO). Global tuberculosis control report 2003: profiles of high-burden countries. Geneva: WHO; 2003. p. 132—42 3. Hopewell PC. Overview of clinical tuberculosis. In: Bloom BR, editor. Tuberculosis pathogenesis, protection, and control. Washington DC: American Society for Microbiology; 1994 . p. 25—46. 4. Garcia-Monco JC. Central nervous system tuberculosis. Neurol Clin 1999;17:737—59. 5. Girgis NI, Sultan Y, Farid Z, Mansour MM, Erian MW, Hanna LS, et al. Tuberculous meningitis, Abbassia Fever Hospital—Naval Medical Research Unit No. 3, Cairo, Egypt from 1976 to 1996. Am J Trop Med Hyg 1998;58:28—34. 6. Davis LE, Rastogi KR, Lambert LC, Skipper BJ. Tuberculous meningitis in the southwest United States: a community-based study. Neurology 1993;43:1775—8.
354 7. Teoh R, Humphries M. Tuberculous meningitis. In: Lambert HP, editor. Kass handbook of infectious diseases: infections of the central nervous system. Philadelphia PA: BC Decker; 1991 . p. 189—206. 8. Thwaites GE, Chau TTH, Farrar JJ. Improving the bacteriological diagnosis of tuberculous meningitis. J Clin Microbiol 2004;42: 378—9. 9. Kent PT, Kubica GP. Public health mycobacteriology: a guide for the level III laboratory. Atlanta, GA: US Department of Health and Human Services, Public Health Service, The Centers for Disease Control and Prevention; 1985. 10. Heifets LB, Good RB. Current laboratory methods for the diagnosis of tuberculosis. In: Bloom RR, editor. Tuberculosis, pathogenesis, protection and control. Washington: American Society for Microbiology; 1994. p. 85—110. 11. Pfyffer GE, Cieslak C, Welscher H-M, Kissling P, Rusch-Gerdes S. Rapid detection of mycobacteria in clinical specimens by using the automated BACTEC 9000 MB system and comparison with radiometric and solid culture systems. J Clin Microbiol 1977;35: 2229—34. 12. Prabhakar S, Oommen A. ELISA using mycobacterial antigen as a diagnostic aid for tuberculous meningitis. J Neurol Sci 1987;78:203—11. 13. Sumi MG, Mathai A, Sarada C, Radhakrishnan VV. Rapid diagnosis of tuberculous meningitis by a dot immunobinding assay to detect mycobacterial antigen in cerebrospinal fluid specimens. J Clin Microbiol 1999;37:3925—7. 14. Coovadia YM, Dawood A, Ellis ME, Coovadia HM, Daniel TM. Evaluation of adenosine deaminase activity and antibody to Mycobacterium tuberculosis antigen 5 in cerebrospinal fluid and the radioactive bromide partition test for the early diagnosis of tuberculosis meningitis. Arch Dis Child 1986;61:428—35. 15. Kameswaran M, Shetty K, Ray MK, Jaleel MA, Kadival GV. Evaluation of an in-house-developed radio-assay kit for antibody detection in cases of pulmonary tuberculosis and tuberculous meningitis. Clin Diagn Lab Immunol 2002;9:987—93. 16. Sumi MG, Mathai A, Reuben S, Sarada C, Radhakrishnan VV. Immunocytochemical method for early laboratory diagnosis of tuberculous meningitis. Clin Diag Lab Immunol 2002;9:344—7. 17. Mishra OP, Loiwal V, Ali Z, Nath G, Chandra L. Cerebrospinal fluid adenosine deaminase activity for the diagnosis of tuberculous meningitis in children. J Trop Pediatr 1996;42:129—32. 18. French GL, Teoh R, Chan CY, Humphries MJ, Cheung SW, O’Mahony G. Diagnosis of tuberculous meningitis by detection of tuberculostearic acid in cerebrospinal fluid. Lancet 1987;330: 117—9. 19. Shankar P, Manjunath N, Shriniwas KK, Mohan K, Prasad M, Behari G, et al. Rapid diagnosis of tuberculous meningitis by polymerase chain reaction. Lancet 1991;337:5—7. 20. Miorner H, Sjobring U, Nayak P, Chandramuki A. Diagnosis of tuberculous meningitis: a comparative analysis of 3 immunoassays, an immune complex assay and the polymerase chain reaction. Tuber Lung Dis 1995;76:381—6. 21. Nguyen LN, Kox LF, Pham LD, Kuijper S, Kolk AH. The potential contribution of the polymerase chain reaction to the diagnosis of tuberculous meningitis. Arch Neurol 1996;53:771—6. 22. Caws M, Wilson SM, Clough C, Drobniewski F. Role of IS6110 targeted PCR, biochemical, clinical and immunological criteria for diagnosis of tuberculous meningitis. J Clin Microbiol 2000;38:3150—5. 23. Narayanan S, Parandaman V, Narayanan PR, Venkatesan P, Girish C, Mahadevan S, et al. Evaluation of PCR using TRC4 and IA9110 primers in detection of tuberculous meningitis. J Clin Microbiol 2001;39:2006—8. 24. Scarpellini P, Racca S, Cinque P, Delfanti F, Gianotti N, Terreni MR, et al. Nested polymerase chain reaction for diagnosis and monitoring treatment response in AIDS patients with tuberculous meningitis. AIDS 1995;9:895—900.
A.I. Bhigjee et al. 25. Mazurek GH, Reddy V, Murphy D, Ansari T. Detection of Mycobacterium tuberculosis in cerebrospinal fluid following immunomagnetic enrichment. J Clin Microbiol 1996;34:450—3. 26. Lang AM, Feris-Iglesias J, Pena C, Sanchez JF, Stockman L, Rys P, et al. Clinical evaluation of Gen-Probe amplified direct test for the detection of Mycobacterium tuberculosis complex organisms in cerebrospinal fluid. J Clin Microbiol 1998;36:2191—4. 27. Cloud JL, Shutt C, Aldous W, Woods G. Evaluation of a modified Gen-Probe amplified direct test for detection of Mycobacterium tuberculosis complex organisms in cerebrospinal fluid. J Clin Microbiol 2004;42:5341—4. 28. Bonington A, Strang JI, Klapper PE, Hood SV, Rubombora W, Penny M, et al. Use of Roche AMPLICOR Mycobacterium tuberculosis PCR in early diagnosis of tuberculous meningitis. J Clin Microbiol 1998;36:1251—4. 29. Bayram A, Celikso ¨z C, Karsligil T, Balci I. Automatized PCR evaluation of Mycobacterium tuberculosis complex in respiratory and non-respiratory specimens. FEMS Immunol Med Microbiol 2006;46:48—52. 30. Lachnik J, Ackermann B, Bohrssen A, Maass S, Diephaus C, Puncken A, et al. Rapid cycle PCR and fluorimetry for detection of mycobacteria. J Clin Microbiol 2002;40:3364—73. 31. Heginbothom ML, Magee JT, Flanagan PG. Evaluation of the IdahoTechnology Light Cycler PCR for the direct detection of Mycobacterium tuberculosis in respiratory specimens. Int J Tuberc Lung Dis 2003;7:78—83. 32. Takahashi T, Nakayana T. Novel technique of quantitative nested real-time PCR assay for Mycobacterium tuberculosis DNA. J Clin Microbiol 2006;44:1029—39. 33. Marei AM, El-Behedy EM, Mohtady HA, Afify RF. Evaluation of a rapid bacteriophage-based method for the detection of Mycobacterium tuberculosis in clinical samples. J Med Microbiol 2003;52:331—5. 34. Albay A, Kisa O, Baylan O, Doganie L. The evaluation of fast plaque TB test for the rapid diagnosis of tuberculosis. Diagn Microbiol Infect Dis 2003;46:211—5. 35. Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken RH. Manual of clinical microbiology. 7th ed. Washington DC: ACM Press; 1999 . p. 1526—43. 36. Kumar R, Singh SN, Kohli N. A diagnostic rule for tuberculous meningitis. Arch Dis Child 1999;81:221—4. 37. Thwaites GE, Chan TT, Stepnieswska K, Phu NH, Chuong LV, Sinh DX, et al. Diagnosis of adult tuberculous meningitis by use of clinical and laboratory features. Lancet 2002;360:1287—92. 38. Katrak SM, Shembalkar PK, Bijwe SR, Bhandarkar LD. The clinical, radiological and pathological profile of tuberculous meningitis in patients with and without human immunodeficiency virus infection. J Neurol Sci 2000;181:118—26. 39. Karstaedt AS, Valtchanova S, Barriere R, Crewe-Brown HH. Tuberculous meningitis in South African urban adults. QJM 1998;91:743—7. 40. Pai M, Flores LL, Pai N, Hubbard A, Riley LW, Colford JM. Diagnostic accuracy of nucleic acid amplification tests for tuberculous meningitis: a systematic review and meta-analysis. Lancet Infect Dis 2003;3:633—43. 41. Broccolo F, Scarpellini P, Locatelli G, Zingale A, Brambilla AM, Cichero P, et al. Rapid diagnosis of mycobacterial infection and quantitation of Mycobacterium tuberculosis load by two realtime calibrated PCR assays. J Clin Microbiol 2003;41:4565—72. 42. Lalvani A, Pathan AA, Durkan H, Wilkinson KA, Whelen A, Deeks JJ, et al. Enhanced contact tracing and spatial tracking of Mycobacterium tuberculosis infection by enumeration of antigen-specific T cells. Lancet 2001;357:2017—21. 43. Schmidt F, Donahue S, Hagens K, Mattow J, Schaible UE, Kaufmann SH, et al. Complementary analysis of Mycobacterium tuberculosis proteome by two dimensional electrophoresis and isotope coded affinity tag technology. Mol Cell Proteomics 2004;3:24—42.