- Email: [email protected]
Dicrocoelium chinensis and Dicrocoelium dendriticum (Trematoda: Digenea) are distinct lancet fluke species based on mitochondrial and nuclear ribosomal DNA sequences
Molecular Phylogenetics and Evolution 79 (2014) 325–331
Contents lists available at ScienceDirect
Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev
Dicrocoelium chinensis and Dicrocoelium dendriticum (Trematoda: Digenea) are distinct lancet fluke species based on mitochondrial and nuclear ribosomal DNA sequences Guo-Hua Liu a,1, Hong-Bin Yan a,1, Domenico Otranto b, Xing-Ye Wang a,c, Guang-Hui Zhao c, Wan-Zhong Jia a,⇑, Xing-Quan Zhu a,⇑ a State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu Province 730046, PR China b Dipartimento di Sanità Pubblica e Zootecnia, Università degli Studi di Bari, 70010 Valenzano, Bari, Italy c College of Veterinary Medicine, Northwest A&F University, Yangling, Shaanxi Province 712100, PR China
a r t i c l e
i n f o
Article history: Received 4 March 2014 Revised 30 June 2014 Accepted 2 July 2014 Available online 10 July 2014 Keywords: Dicrocoelium chinensis Dicrocoelium dendriticum Mitochondrial DNA Nuclear ribosomal DNA Phylogeny Evolution
a b s t r a c t Lancet flukes parasitize the bile ducts and gall bladder of a range of mammals, including humans, causing dicrocoeliosis. In the present study, we sequenced and characterized the complete mitochondrial (mt) genomes as well as the first and second internal transcribed spacers (ITS-1 and ITS-2 = ITS) of nuclear ribosomal DNA (rDNA) of two lancet flukes, Dicrocoelium chinensis and D. dendriticum. Sequence comparison of a conserved mt gene and nuclear rDNA sequences among multiple individual lancet flukes revealed substantial nucleotide differences between the species but limited sequence variation within each of them. Phylogenetic analysis of the concatenated amino acid and multiple mt rrnS sequences using Bayesian inference supported the separation of D. chinensis and D. dendriticum into two distinct species-specific clades. Results of the present study support the proposal that D. dendriticum and D. chinensis represent two distinct lancet flukes. While providing the first mt genomes from members of the superfamily Plagiorchioidea, the novel mt markers described herein will be useful for further studies of the diagnosis, epidemiology and systematics of the lancet flukes and other trematodes of human and animal health significance. Ó 2014 Elsevier Inc. All rights reserved.
1. Introduction Dicrocoelium spp. (Trematoda: Digenea), known as the ‘lancet fluke’ or ‘small liver fluke’, is the etiological agent of dicrocoeliosis of ruminants, although it may also infest pigs, dogs, horses and humans (Le Bailly and Bouchet, 2010; Otranto and Traversa, 2002, 2003). Dicrocoeliosis causes mild clinical symptoms (e.g., anemia and emaciation) and may exert a significant economic impact on infected animals due to weight loss and reduced meat and milk production (Otranto and Traversa, 2002, 2003). The most important species of this genus are D. chinensis Tang and Tang, 1978 (Tang and Tang provided a new name for D. orientalis Sudarikov and Ryjikov, 1951, a junior homonym of D. orientalis Narain and Das, 1929), D. dendriticum Rudolphi, 1819, D. hospes Looss, 1907 and D. orientalis Narain and Das, 1929 (syn. D. moschiferi Oschmarin, 1952). Furthermore, D. suppereri Hinaiday, 1983 is ⇑ Corresponding authors. E-mail addresses: [email protected] (W.-Z. Jia), [email protected] (X.-Q. Zhu). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.ympev.2014.07.002 1055-7903/Ó 2014 Elsevier Inc. All rights reserved.
morphologically identical to D. chinensis and is considered to be a junior synonym of D. chinensis. Although lancet fluke infections are considered neglected parasites, they are widely distributed in many regions of the world (e.g., D. chinensis in Asia, D. dendriticum in America, Asia, North Africa, and Europe, D. hospes in Africa, and D. orientalis in the former Soviet Union and Austria) (Manga-González et al., 2001). So far, no practical vaccine is available against dicrocoeliosis. However, this disease can be treated effectively via the administration of anthelminthics, such as albendazole, albendazole sulphoxide, and a combination of thiophanate and brotianide (Bártíková et al., 1988, 2011; Cvilink et al., 2009). D. chinensis and D. dendriticum are the most common lancet flukes in many Asian countries, particularly in China (Li, 2012). In spite of the economic and public health significance of dicrocoeliosis, its diagnosis, epidemiology, genetics, and biology remain poorly understood. Lancet fluke species are currently identified based on morphological characteristics of the adult trematodes (e.g., testes orientation, overall size, and body width) (Tang and Tang, 1978). Although previous studies have shown that D. chinensis and D. dendriticum are morphologically distinct species (Otranto et al., 2007), the unequivocal delineation of both species may be
326
G.-H. Liu et al. / Molecular Phylogenetics and Evolution 79 (2014) 325–331
troublesome due to the occurrence of morphological variations in specimens from different hosts or geographical origin (Arbabi et al., 2012). In addition, D. chinensis and D. dendriticum may simultaneously infest the same hosts (Li, 2012), thus requiring accurate identification and differentiation. Molecular tools, using genetic markers in mitochondrial (mt) DNA and in the internal transcribed spacer (ITS) regions of nuclear ribosomal DNA (rDNA), have been used effectively to identify trematode species (Al-Kandari et al., 2012; Urabe et al., 2012; Zhao et al., 2012a; Georgieva et al., 2013; Tantrawatpan et al., 2013). For lancet flukes, mtDNA has proved to be a useful molecular marker for accurate identification and differentiation of Dicrocoelium specimens (Wang et al., 2013; Zhao et al., 2013). Although a previous investigation has shown that D. chinensis and D. dendriticum are distinct species (Otranto et al., 2007), there is still a paucity of information from different species of animals and countries around the world. Advances in long-range PCR-coupled sequencing and bioinformatic methods (Hu et al., 2002a, 2007; Jex et al., 2008) are providing unique opportunities to explore the biology of these parasites. Therefore, in the present study, we sequenced, analyzed and compared the mt genomes as well as ITS rDNA of D. chinensis and D. dendriticum, and tested the hypothesis that D. chinensis and D. dendriticum are genetically distinct via phylogenetic analyses of both nucleotide and amino acid sequence data sets. 2. Methods 2.1. Parasites and total genomic DNA isolation Adult specimens of D. chinensis (n = 11) and D. dendriticum (n = 10) were collected, post-mortem, from the gall bladders of naturally infected yaks and goats, respectively, in Maqu (Gansu Province, China) and, for D. dendriticum, also from naturally infected goats in Minxian (Gansu Province, China). Specimens were washed in physiological saline, identified morphologically to species (Taira et al., 2006; Otranto et al., 2007), fixed in ethanol and then stored at 20 °C until use. Total genomic DNA was isolated separately from mid-body sections of each fluke by small-scale sodium dodecyl-sulfate (SDS)/proteinase K digestion (Gasser et al., 2006) and mini-column purification (WizardÒ SV Genomic DNA Purification System, Promega). Single samples were identified as D. chinensis and D. dendriticum based on PCR-based sequencing of regions in the ITS-2 using an established method (Otranto et al., 2007). 2.2. Long-PCR and sequencing Using primers (Table 1) designed to relatively conserved regions of mtDNA nucleotide sequences from these lancet flukes (Wang et al., 2013) and other closely-related taxa, the complete mt genomes of D. chinensis and D. dendriticum were amplified by long-PCR as five or six overlapping amplicons from the genomic DNA from a single specimen from each species. PCR was conducted in 25 ll using 2 mM MgCl2, 0.2 mM each of dNTPs, 2.5 ll 10 Taq buffer, 2.5 lM of each primer and 0.5 ll LA Taq DNA polymerase (5 U/ll, Takara) in a thermocycler (BioRad) under the following conditions: 92 °C for 2 min (initial denaturation), then 92 °C for 10 s (denaturation), 52–58 °C for 30 s (annealing), and 60 °C for 10 min (extension) for 10 cycles, followed by 92 °C for 10 s, 52–58 °C for 30 s (annealing), and 60 °C for 10 min for 20 cycles, with a cycle elongation of 10 s for each cycle and a final extension at 60 °C for 10 min. Genomic DNA (2 ll) was added to PCR. A no-DNA control was included in each amplification run. Each amplicon (5 ll) was examined by agarose (1%) gel electrophoresis, stained with ethidium bromide and photographed using a gel documentation system (UVItec). PCR products were sent to Sangon
Company (Shanghai, China) for sequencing from both directions using a primer walking strategy (Hu et al., 2007). 2.3. Annotation and bioinformatic analysis Sequences were assembled manually and aligned against the mt genome sequences of Paragonimus westermani (GenBank accession number NC_002354) using MAFFT 7.122 (Katoh and Standley, 2013) to identify gene boundaries. Each protein-coding gene was translated into amino acid sequences using the trematode mt genetic code in MEGA 5 (Tamura et al., 2011). The tRNA genes were identified using the program tRNAscan-SE (Lowe and Eddy, 1997) or by visual inspection (Hu et al., 2002b) and rRNA genes were predicted by comparison with those of P. westermani. The amino acid sequences conceptually translated from individual genes of the mt genomes of the two lancet fluke were concatenated. For comparative purposes, amino acid sequences predicted from published mt genomes from selected Digenea, including the family Opisthorchiidae [Clonorchis sinensis, FJ381664 (Shekhovtsov et al., 2010), Opisthorchis felineus, EU921260 (Shekhovtsov et al., 2010), and O. viverrini, JF739555 (Cai et al., 2012)], Fasciolidae [(Fasciola hepatica, NC_002546 (Le et al., 2001); F. gigantica, KF543342 (Liu et al., 2014)], Heterophyidae (Haplorchis taichui, KF214770) (Lee et al., 2013), Paramphistomidae (Paramphistomum cervi, KF475773) (Yan et al., 2013), Paragonimidae (Paragonimus westermani, NC_002354), and Schistosomatidae [(Trichobilharzia regenti, NC_009680 (Webster et al., 2007), Schistosoma turkestanicum, HQ283100 (Wang et al., 2011), Schistosoma mansoni, NC_002545 (Le et al., 2000), S. japonicum, HM120846 (Zhao et al., 2012b), S. mekongi, NC_002529 (Le et al., 2000), S. spindale, DQ157223 (Littlewood et al., 2006), S. haematobium, DQ157222 (Littlewood et al., 2006)], were also included in the analyses. A sequence from a Gyrodactylus species (Gyrodactylus derjavinoides, GenBank accession number NC_010976) was included as an outgroup (Huyse et al., 2008). All amino acid sequences were aligned using MAFFT 7.122 and subjected to phylogenetic analysis using Bayesian inference (BI) as described previously (Ronquist and Huelsenbeck, 2003). Phylograms were viewed using the Tree View program v.1.65 (Page, 1996). 2.4. Sequencing of ITS rDNA and mt rrnS The complete ITS rDNA region including primer flanking 18S and 28S rDNA sequences was PCR-amplified from individual DNA samples using universal primers BD1 (forward; 50 -GTCGTAAC AAGGTTTCCGTA-30 ) and BD2 (reverse; 50 -TATGCTTAAATTCAGC GGGT-30 ) described previously (Morgan and Blair, 1995). Two primers, rrnSF (50 -CGACCTGTGTTTCCTATGAGTTGAG-30 ) and rrnSR (50 -CGAACTAAATCCAGATACAAATAAC-30 ), were employed for PCR amplification (750 bp) and subsequent sequencing of the complete mt rrnS from multiple individuals of D. chinensis (coded DC1–DC11) and D. dendriticum (coded DD1–DD10). A mt rrnS sequence from P. westermani (accession number NC_002354) was used as an outgroup in the phylogenetic analyses. All mt rrnS sequences were aligned using MAFFT, and the alignment was adjusted manually, and then subjected to phylogenetic analysis using the same methods as described above. 3. Results 3.1. Identity of the two lancet flukes, and genome content and organization The ITS-2 sequences of D. chinensis (coded DC11) and of D. dendriticum (coded DD10) shared 98% and 99% identity with previously published sequences of D. chinensis from sika deer in
G.-H. Liu et al. / Molecular Phylogenetics and Evolution 79 (2014) 325–331
327
Table 1 Sequences of primers used to long-PCR amplify regions of the mt genomes of Dicrocoelium chinensis and D. dendriticum. Primer designation
Sequence (50 –30 )
Size (kb)
Amplified region (c.f. Fig. 1)
For D. chinensis DC1F DC1R DC2F DC2R DC3F DC3R DC4F DC4R DC5F DC5R
CTCCTGTGACGATAAAGCCTGAGTGAT AAGACAACCAATCCCGAAACTGAGAAACC GGTCTTTGACTTTTGAAGCGTGTTTTTTATGT CGCAGAAAGAATAACACCAGTAATCCCTCCTA TTACTGTAGGAGGGATTACTGGTG GGAATAACCGTTCACGCAAG GTACACACCGCCCGTCACC AGAACTCATCAAATCACCCATCC ATTTGGTGATGTAGCGTTGTTT GCCTCCGTATCAACGACCAA
4.0
Partial cytb-nad4L-nad4-Q-M-F-atp6-nad2-V-A-D-partial nad1
2.5
Partial nad1-N-P-I-K-nad3-S1-W-partial cox1
2.5
Partial cox1-T-rrnL-C-rrnS-partial cox2
2.5
Partial cox2-nad6-Y-L1-S2-L2-R partial nad5
4.5
Partial nad5-G-NCR-E-NCL-cox3-H-partial cytb
For D. dendriticum DD1F DD1R DD2F DD2R DD3F DD3R DD4F DD4R DD5F DD5R DD6F DD6R
GGTTACCTCGTATGAATGCTTTGAG AAATCACCCATCAACGAATCATAG CTTTGTGCGTTTTGCTTTGC AGAACTCATCAAATCACCCATCC CAGATTAGATGGGTTGGTTTTAAGC GATACTCCGGATGACATGAACCC TGGTTGTTTGATATTGGCATTTTGT CATAAAGGAGTTCCAGAAGGC AGAATTGGATACTAAGCGTTGGT GCACATAACCAAGCATCTTACGC GTTGTTTGAGGTATTTCTACATTTTTGA GGCGGATAAAAAGTTCAACCAAC
3.5
Partial cox1-T-rrnL-C-rrnS-partial cox2
3.0
Partial cox2-nad6-Y-L1-S2-L2-R partial nad5
5.0
Partial nad5-G-NCR-E-NCL-cox3-H-partial cytb
3.0
Partial cytb-nad4L-nad4-Q-M-F-partial atp6
2.5
Partial atp6-nad2-V-A-D-partial nad1
3.0
Partial nad1-N-P-I-K-nad3-S1-W-partial cox1
Japan (GenBank accession number AB367790) and of D. dendriticum in Iran (GenBank accession number JQ966973), respectively. The complete mt genome sequences of D. chinensis and D. dendriticum (GenBank accession numbers KF318786 and KF318787, respectively) are a typical circular DNA molecular of 14,917 bp and 14,884 bp in size, respectively (Fig. 1). Each of the two mt genomes contains 36 genes, including 12 protein-coding genes (cox1–3, nad1–6, nad4L, atp6 and cytb), 22 tRNA genes, two rRNA genes (rrnL and rrnS), but lacks an atp8 gene (Table 2). All genes are transcribed in the same direction. The gene order of the mt genomes of the two lancet flukes is identical to those of C. sinensis, F. hepatica, O. felineus and P. westermani (Le et al., 2001; Shekhovtsov et al., 2010; Cai et al., 2012), but differs markedly from some members of Schistosoma (Wang et al., 2011; Webster et al., 2007; Le et al., 2000; Zhao et al., 2012b; Littlewood et al., 2006). The nucleotide composition of the entire mt genomes of two lancet flukes is biased toward A and T with an overall A + T content of 62.11% for D. chinensis and 62.18% for D. dendriticum, respectively. 3.2. Annotation In the D. chinensis and D. dendriticum mt genomes, 12 proteincoding genes had ATG or GTG or TTG or ATA as their initiation codons (Table 2). All reading-frames of the two lancet flukes ended with TAG or TAA or T as termination codons (Table 2). In the mt genomes of D. chinensis and D. dendriticum, the 22 tRNA genes ranged from 56 to 68 bp in size. The secondary structures predicted for the tRNA genes were similar to the corresponding genes from P. westermani and F. hepatica (Le et al., 2001). In the two mt genomes, the rrnL was located between tRNA-Thr and tRNA-Cys, and rrnS was between tRNA-Cys and cox2 (Table 2). The lengths of the rrnL gene are 968 bp and 969 bp for D. chinensis and D. dendriticum, respectively. The length of the rrnS gene is 707 bp and 708 bp for D. chinensis and D. dendriticum, respectively. For these mt genomes, the long non-coding regions (designated NCL) and short noncoding regions (designated NCR) were located between the tRNA-Glu and tRNA-Gly, and tRNA-Gly and cox3, respectively (Table 2). The NCR exhibits no noteworthy features. However, the NCL contains some tandem repeats. D. chinensis has two sets
Fig. 1. Organization of the mitochondrial genomes of Dicrocoelium chinensis and D. dendriticum. Scale is approximate. All genes have standard nomenclature except for the 22 tRNA genes, which are designated by the one-letter code for the corresponding amino acid, with numerals differentiating each of the two leucineand serine-specifying tRNAs (L1 and L2 for codon families CUN and UUR, respectively; S1 and S2 for codon families UCN and AGN, respectively). All genes are transcribed in the clockwise direction. ‘‘NCL’’ refers to a large non-coding region. ‘‘NCR’’ refers to a small non-coding region.
of tandem repeats (122 bp), which are located at positions 7491–7612 and 7613–7734. D. dendriticum also contains two sets of tandem repeats (120 bp), which are found at positions 7484–7604 and 7605–7724, but eight bases differ between these repeats. 3.3. Comparative analyses between D. chinensis and D. dendriticum A comparison of the nucleotide sequences of each mt gene and non-coding regions, as well as of the amino acid sequences, conceptually translated from all protein genes, is given in Table 3.
328
G.-H. Liu et al. / Molecular Phylogenetics and Evolution 79 (2014) 325–331
Table 2 The organization of the mitochondrial genomes of Dicrocoelium chinensis and D. dendriticum. Gene/region
Positions
Size (bp)
Ini/Ter codons
DC
DD
DC
DD
DC
DD
cox1 tRNA-Thr (T) rrnL tRNA-Cys (C) rrnS cox2 nad6 tRNA-Tyr (Y) tRNA-LeuCUN (L1) tRNA-SerUCN (S2) tRNA-LeuUUR (L2) tRNA-Arg (R) nad5 tRNA-Gly (G) Non-coding region (NCR) tRNA-Glu (E) Non-coding region (NCL) cox3 tRNA-His (H) cytb nad4L nad4 tRNA-Gln (Q) tRNA-Phe (F) tRNA-Met (M) atp6 nad2 tRNA-Val (V) tRNA-Ala (A) tRNA-Asp (D) nad1 tRNA-Asn (N) tRNA-Pro (P) tRNA-Ile (I) tRNA-Lys (K) nad3 tRNA-SerAGN (S1) tRNA-Trp (W)
1–1536 1550–1613 1616–2583 2584–2647 2648–3354 3355–3978 3996–4454 4459–4521 4522–4584 4603–4664 4665–4725 4737–4797 4809–6365 6376–6440 6441–6972 6973–7036 7037–8048 8049–8699 8721–8785 8786–9898 9898–10161 10170–11369 11399–11460 11464–11525 11526–11587 11588–12100 12106–12978 12986–13048 13050–13112 13117–13184 13189–14088 14093–14158 14179–14240 14244–14306 14323–14383 14384–14732 14733–14788 14816–14880
1–1536 1553–1616 1619–2587 2588–2651 2652–3359 3360–3983 3997–4455 4460–4522 4523–4584 4603–4663 4668–4730 4742–4801 4813–6369 6380–6443 6444–6969 6970–7031 7032–8024 8025–8675 8689–8753 8754–9866 9866–10129 10138–11337 11367–11428 11432–11492 11493–11553 11554–12066 12067–12939 12949–13011 13013–13075 13080–13143 13154–14053 14058–14123 14147–14208 14212–14274 14291–14351 14352–14700 14701–14756 14783–14847
1536 64 968 64 707 624 459 63 63 62 65 61 1557 65 532 64 1012 651 65 1113 264 1200 62 62 62 513 873 63 63 68 900 66 62 63 61 349 56 65
1536 64 969 64 708 624 459 63 62 61 63 60 1557 64 526 62 993 651 65 1113 264 1200 62 61 61 513 873 63 63 64 900 66 62 63 61 349 56 65
ATG/TAG
ATG/TAG
ATG/TAA ATG/TAG
ATG/TAA ATG/TAG
TTG/TAA
TTG/TAG
ATG/TAG
ATG/TAG
TTG/TAG GTG/TAA ATA/TAG
TTG/TAG GTG/TAA ATA/TAG
GTG/TAG ATG/TAG
GTG/TAG ATG/TAG
GTG/TAA
GTG/TAA
GTG/T
ATG/T
DC: Dicrocoelium chinensis; DD: Dicrocoelium dendriticum.
The magnitude of sequence variation across the entire mt genome between the two lancet flukes was 11.81% (a total of 1762 nucleotide substitutions). For the12 protein genes, this comparison revealed sequence differences at both the nucleotide (11.70%, a total of 1175 nucleotide substitutions) and amino acid (11.36%, a total of 379 amino acid substitutions) levels. The nucleotide and amino acid sequences inferred from individual mt protein-coding genes of D. chinensis and D. dendriticum were also compared. The nucleotide sequence differences ranged from 8.87% to 18.08%, with nad5 being the most conserved protein-coding gene and nad6 the least conserved. The amino acid sequence differences ranged from 3.45% to 21.05%, with nad4L being the most conserved proteincoding gene and nad6 the least conserved. Nucleotide differences were also detected in the two ribosomal RNA genes [rrnL (8.67%) and rrnS (8.33%)], 22 tRNA genes (12.20%) and non-coding regions (13.54%) (Table 3). The phylogenetic analyses of amino acid sequence datasets using G. derjavinoides as the outgroup reflected the clear genetic distinctiveness between D. chinensis and D. dendriticum and also the grouping of these two members of Dicrocoelium with other members of families Paramphistomidae, Fasciolidae, Paragonimidae, Heterophyidae and Opisthorchiidae, with maximum support (posterior probability = 1.00), to the exclusion of members of the Schistosomatidae (Fig. 2). The differences between the two Dicrocoelium spp. are about the same (looking at branch lengths) as between the two Fasciola spp. and similar to differences among opisthorchiids (Cai et al., 2012; Liu et al., 2014).
The rDNA region including ITS-1, ITS-2 and intervening 5.8 rRNA gene sequenced from individual lancet fluke samples (coded: DC1–DC11 and DD1–DD10) was approximately 960 bp in length. Individual spacers were 560 bp (ITS-1) and 238 bp (ITS-2), and the 5.8S rRNA gene was 160 bp long. The sequence variation was 7.5–9.3% (ITS-1) and 3.8–6.3% (ITS-2) between the D. chinensis and D. dendriticum. However, intra-species sequence variation was 0–3.7% (ITS-1) and 0–2.9 (ITS-2) within D. chinensis, and 0–0.5% (ITS-1) and 0–0.4% (ITS-2) within D. dendriticum. Comparison of the mt genomes of D. chinensis and D. dendriticum showed that the mt rrnS was the most conserved gene (Table 3). Sequence variation in sections of the mt rrnS gene was assessed among 21 individuals of D. chinensis (DC1–DC11) and D. dendriticum (DD1–DC10). Nucleotide variation among the 11 D. chinensis individuals was detected at 8 sites (1.13%). Nucleotide variation among the 10 D. dendriticum individuals also occurred at 12 sites (1.70%). The alignment of the full mt rrnS gene sequences revealed that all individuals of D. chinensis differed at 70 (9.89%) nucleotide positions when compared with all individuals of D. dendriticum. Phylogenetic analyses of the mt rrnS sequence data revealed strong support for the separation of D. chinensis and D. dendriticum individuals into two distinct clades (Fig. 3). 4. Discussion Currently, identification and differentiation of lancet fluke species have been traditionally based on the microscopic features of
329
G.-H. Liu et al. / Molecular Phylogenetics and Evolution 79 (2014) 325–331 Table 3 Differences in mitochondrial nucleotides and predicted amino acids sequences between Dicrocoelium chinensis (DC) and D. dendriticum (DD). Gene/region
atp6 nad1 nad2 nad3 nad4 nad4L nad5 nad6 cox1 cox2 cox3 cytb rnnL rrnS 22 tRNA Non-coding
Nucleotide size
Nucleotide difference (%)
Number of aa
aa Difference (%)
DC
DD
DC/DD
DC
DD
DC/DD
513 900 873 360 1200 264 1557 459 1536 624 651 1116 968 707 1385 1544
513 900 873 360 1200 264 1557 459 1536 624 651 1116 969 708 1375 1518
13.26 11.67 13.52 8.89 14.08 12.88 8.87 18.08 9.11 16.03 14.9 10.93 8.67 8.33 12.20 13.54
170 299 290 119 399 87 529 152 511 207 216 371 – – – –
170 299 290 119 399 87 528 152 511 207 216 371 – – – –
14.71 9.36 13.45 5.04 17.04 3.45 10.04 21.05 4.70 16.43 17.59 8.09 – – – –
Fig. 2. Relationship of Dicrocoelium chinensis and D. dendriticum with other selected digenea trematodes based on mitochondrial sequence data. The concatenated amino acid sequences of 12 protein-coding genes were subjected to analysis by Bayesian inference (BI) using Gyrodactylus derjavinoides as an outgroup. Posterior probability (pp) values are indicated. Branch lengths were estimated by BI.
the adult worms (Tang and Tang, 1978). However, these criteria are often insufficient for specific identification and differentiation (Arbabi et al., 2012), particularly at the larval and/or egg stages. The mt genome is a useful genetic marker in examining taxonomic status of parasites (Le et al., 2002), particularly when concatenated protein-coding genes are used as markers in comparative analyses (Wang et al., 2011; Jia et al., 2012; Liu et al., 2012, 2013; Burger et al., 2012, 2014). For these reasons, we employed here a molecular genetic approach, logically extending previous studies (Otranto et al., 2007; Wang et al., 2013; Zhao et al., 2013), so that comparative genetic analyses could be conducted. A substantial level of nucleotide variation (11.81%) was detected in the complete mt genomes between an individual of D. chinensis and D. dendriticum. Variation in the nucleotide sequences of the nuclear ITS rDNA from D. chinensis and D. dendriticum (3.8–9.3%) were consistent with previous findings (Otranto et al., 2007). In addition, genetic variation between D. chinensis and D. dendriticum was also detected in the two mt ribosomal RNA gene subunits (rrnL and rrnS), 22 tRNA genes, and
non-coding regions. These mt rrnL and rrnS genes are usually more conserved in sequence than the mt protein-coding genes (Hu et al., 2004), which is also supported by the results from the present study. The two lancet flukes displayed a lower sequence variation in mt rrnL and rrnS (8.67% and 8.33%) when compared with the 12 protein-coding genes (8.87–18.08%), 22 tRNA genes (12.20%), and the non-coding regions (13.54%) (Table 3). Complete mt rrnS gene (i.e., 707 bp for D. chinensis and 708 bp for D. dendriticum) was used to examine the level of genetic variation between D. chinensis and D. dendriticum. Comparison of the complete mt rrnS sequences from 21 Dicrocoelium individuals revealed 70 (9.89%) variable positions between D. chinensis and D. dendriticum. However, there was very limited sequence variation (1.13–1.70%) within each of the two lancet fluke species, which is consistent with recent studies (Wang et al., 2013; Zhao et al., 2013). Phylogenetic analysis of the concatenated amino acid and multiple mt rrnS sequences also provided further support that D. chinensis and D. dendriticum represent close but distinct taxa (Figs. 2 and 3).
330
G.-H. Liu et al. / Molecular Phylogenetics and Evolution 79 (2014) 325–331
Fig. 3. Inferred phylogenetic relationship among representative Dicrocoelium samples using Bayesian inference (BI) of mitochondrial rrnS sequence data, using Paragonimus westermani as the outgroup. Posterior probability (pp) values are indicated. Branch lengths were estimated by BI.
Although our results provide molecular evidence that D. chinensis and D. dendriticum represent distinct lancet flukes, there are a number of areas that require further attention: (i) exploring, in detail, nucleotide variation in rDNA and mtDNA within and among lancet fluke populations from different hosts and countries, (ii) employing other more variable molecular markers and a larger number of samples to confirm the phylogenetic relationships among lancet fluke taxa, (iii) undertaking detailed morphological studies, by scanning electron microscopy and field emission scanning electron microscopy, of lancet flukes from a range of hosts, and (iv) characterizing and comparing the complete mt genomes and rDNA of other lancet flukes. In conclusion, the present study determined and compared the complete mt genome sequences and ITS rDNA sequences of D. chinensis and D. dendriticum, supporting that they are distinct lancet fluke species. In addition, these are the first mt genomes of any members of the superfamily Plagiorchioidea. These novel mt genome sequences should provide new and useful genetic markers for further studies of the taxonomy, identification, systematics and epidemiology of trematodes of humans and animals. Acknowledgments This work was supported in part by the International Science & Technology Cooperation Program of China (Grant No. 2013DFA31840), the ‘‘Special Fund for Agro-scientific Research in the Public Interest’’ (Grant No. 201303037) and the Science Fund for Creative Research Groups of Gansu Province (Grant No. 1210RJIA006). References Al-Kandari, W.Y., Al-Bustan, S.A., Isaac, A.M., George, B.A., Chandy, B.S., 2012. Molecular identification of Austrobilharzia species parasitizing Cerithidea cingulata (Gastropoda: Potamididae) from Kuwait Bay. J. Helminthol. 86, 470– 478. Arbabi, M., Dalimi, A., Ghaffarifar, F., Foorozandeh-Moghadam, M., 2012. Morphological and molecular characterization of Dicrocoelium isolated from sheep in the north and center of Iran. Feyz J. Kashan Univ. Med. Sci. 16, 135– 145. Bártíková, H., Vokrˇál, I., Forstová-Krˇízˇová, V., Skálová, L., Lamka, J., Szotáková, B., 1988. Treatment of Dicrocoelium dendriticum with a combination of thiophanate and brotianide. Vet. Rec. 123, 650–651.
Bártíková, H., Vokrˇál, I., Forstová-Krˇízˇová, V., Skálová, L., Lamka, J., Szotáková, B., 2011. The transport of albendazole and albendazole sulphoxide in the lancet fluke (Dicrocoelium dendriticum). Vet. Parasitol. 176, 27–33. Burger, T.D., Shao, R., Beati, L., Miller, H., Barker, S.C., 2012. Phylogenetic analysis of ticks (Acari: Ixodida) using mitochondrial genomes and nuclear rRNA genes indicates that the genus Amblyomma is polyphyletic. Mol. Phylogenet. Evol. 64, 45–55. Burger, T.D., Shao, R., Barker, S.C., 2014. Phylogenetic analysis of mitochondrial genome sequences indicates that the cattle tick, Rhipicephalus (Boophilus) microplus, contains a cryptic species. Mol. Phylogenet. Evol. 76, 241–253. Cai, X.Q., Liu, G.H., Song, H.Q., Wu, C.Y., Zou, F.C., Yan, H.K., Yuan, Z.G., Lin, R.Q., Zhu, X.Q., 2012. Sequences and gene organization of the mitochondrial genomes of the liver flukes Opisthorchis viverrini and Clonorchis sinensis (Trematoda). Parasitol. Res. 110, 235–243. Cvilink, V., Szotáková, B., Krízová, V., Lamka, J., Skálová, L., 2009. Phase I biotransformation of albendazole in lancet fluke (Dicrocoelium dendriticum). Res. Vet. Sci. 86, 49–55. Gasser, R.B., Hu, M., Chilton, N.B., Campbell, B.E., Jex, A.J., Otranto, D., Cafarchia, C., Beveridge, I., Zhu, X., 2006. Single-strand conformation polymorphism (SSCP) for the analysis of genetic variation. Nat. Protoc. 1, 3121–3128. Georgieva, S., Soldánová, M., Pérez-Del-Olmo, A., Dangel, D.R., Sitko, J., Sures, B., Kostadinova, A., 2013. Molecular prospecting for European Diplostomum (Digenea: Diplostomidae) reveals cryptic diversity. Int. J. Parasitol. 43, 57–72. Hu, M., Chilton, N.B., Gasser, R.B., 2002a. Long PCR-based amplification of the entire mitochondrial genome from single parasitic nematodes. Mol. Cell. Probes 16, 261–267. Hu, M., Chilton, N.B., Gasser, R.B., 2002b. The mitochondrial genomes of the human hookworms, Ancylostoma duodenale and Necator americanus (Nematoda: Secernentea). Int. J. Parasitol. 32, 145–158. Hu, M., Chilton, N.B., Gasser, R.B., 2004. The mitochondrial genomics of parasitic nematodes of socio-economic importance: recent progress, and implications for population genetics and systematics. Adv. Parasitol. 56, 133–212. Hu, M., Jex, A.R., Campbell, B.E., Gasser, R.B., 2007. Long PCR amplification of the entire mitochondrial genome from individual helminths for direct sequencing. Nat. Protoc. 2, 2339–2344. Huyse, T., Buchmann, K., Littlewood, D.T., 2008. The mitochondrial genome of Gyrodactylus derjavinoides (Platyhelminthes: Monogenea) – a mitogenomic approach for Gyrodactylus species and strain identification. Gene 417, 27–34. Jex, A.R., Hu, M., Littlewood, D.T., Waeschenbach, A., Gasser, R.B., 2008. Using 454 technology for long-PCR based sequencing of the complete mitochondrial genome from single Haemonchus contortus (Nematoda). BMC Genomics 9, 11. Jia, W., Yan, H., Lou, Z., Ni, X., Dyachenko, V., Li, H., Littlewood, D.T., 2012. Mitochondrial genes and genomes support a cryptic species of tapeworm within Taenia taeniaeformis. Acta Trop. 123, 154–163. Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol. 30, 772– 780. Le Bailly, M., Bouchet, F., 2010. Ancient dicrocoeliosis: occurrence, distribution and migration. Acta Trop. 115, 175–180. Le, T.H., Blair, D., Agatsuma, T., Humair, P.F., Campbell, N.J., Iwagami, M., Littlewood, D.T., Peacock, B., Johnston, D.A., Bartley, J., Rollinson, D., Herniou, E.A., Zarlenga, D.S., McManus, D.P., 2000. Phylogenies inferred from mitochondrial gene orders – a cautionary tale from the parasitic flatworms. Mol. Biol. Evol. 17, 1123–1125. Le, T.H., Blair, D., McManus, D.P., 2001. Complete DNA sequence and gene organization of the mitochondrial genome of the liver fluke, Fasciola hepatica L. (Platyhelminthes; Trematoda). Parasitology 123, 609–621. Le, T.H., Blair, D., McManus, D.P., 2002. Mitochondrial genomes of parasitic flatworms. Trends Parasitol. 18, 206–213. Lee, D., Choe, S., Park, H., Jeon, H.K., Chai, J.Y., Sohn, W.M., Yong, T.S., Min, D.Y., Rim, H.J., Eom, K.S., 2013. Complete mitochondrial genome of Haplorchis taichui and comparative analysis with other trematodes. Korean J. Parasitol. 51, 719–726. Li, L.F., 2012. Prevalence of trematodes in cattle and sheep in Qinghai province, China. Qinghai J. Anim. Vet. Sci. 42, 28–29 (in Chinese). Littlewood, D.T., Lockyer, A.E., Webster, B.L., Johnston, D.A., Le, T.H., 2006. The complete mitochondrial genomes of Schistosoma haematobium and Schistosoma spindale and the evolutionary history of mitochondrial genome changes among parasitic flatworms. Mol. Phylogenet. Evol. 39, 452–467. Liu, G.H., Gasser, R.B., Su, A., Nejsum, P., Peng, L., Lin, R.Q., Li, M.W., Xu, M.J., Zhu, X.Q., 2012. Clear genetic distinctiveness between human- and pig-derived Trichuris based on analyses of mitochondrial datasets. PLoS Negl. Trop. Dis. 6, e1539. Liu, G.H., Chen, F., Chen, Y.Z., Song, H.Q., Lin, R.Q., Zhou, D.H., Zhu, X.Q., 2013. Complete mitochondrial genome sequence data provides genetic evidence that the brown dog tick Rhipicephalus sanguineus (Acari: Ixodidae) represents a species complex. Int. J. Biol. Sci. 9, 361–369. Liu, G.H., Gasser, R.B., Young, N.D., Song, H.Q., Ai, L., Zhu, X.Q., 2014. Complete mitochondrial genomes of the ‘intermediate form’ of Fasciola and Fasciola gigantica, and their comparison with F. hepatica. Parasit. Vec. 7, 150. Lowe, T.M., Eddy, S.R., 1997. TRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 25, 955–964. Manga-González, M.Y., González-Lanza, C., Cabanas, E., Campo, R., 2001. Contributions to and review of dicrocoeliosis, with special reference to the intermediate hosts of Dicrocoelium dendriticum. Parasitology 123, S91–114. Morgan, J.A., Blair, D., 1995. Nuclear rDNA ITS sequence variation in the trematode genus Echinostoma: an aid to establishing relationships within the 37-collarspine group. Parasitology 111, 609–615.
G.-H. Liu et al. / Molecular Phylogenetics and Evolution 79 (2014) 325–331 Otranto, D., Traversa, D.A., 2002. Review of dicrocoeliosis of ruminants including recent advances in the diagnosis and treatment. Vet. Parasitol. 107, 317–335. Otranto, D., Traversa, D., 2003. Dicrocoeliosis of ruminants: a little known fluke disease. Trends Parasitol. 19, 12–15. Otranto, D., Rehbein, S., Weigl, S., Cantacessi, C., Parisi, A., Lia, R.P., Olson, P.D., 2007. Morphological and molecular differentiation between Dicrocoelium dendriticum (Rudolphi, 1819) and Dicrocoelium chinensis (Sudarikov and Ryjikov, 1951) Tang and Tang, 1978 (Platyhelminthes: Digenea). Acta Trop. 104, 91–98. Page, R.D., 1996. TREEVIEW: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12, 357–358. Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Shekhovtsov, S.V., Katokhin, A.V., Kolchanov, N.A., Mordvinov, V.A., 2010. The complete mitochondrial genomes of the liver flukes Opisthorchis felineus and Clonorchis sinensis (Trematoda). Parasitol. Int. 59, 100–103. Taira, K., Shirasaka, S., Taira, N., Ando, Y., Adachi, Y., 2006. Morphometry on lancet flukes found in Japanese sika deer (Cervus nippon centralis) captured in Iwate Prefecture, Japan. J. Vet. Med. Sci. 68, 375–377. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tang, Z., Tang, Z., 1978. Investigations on trematodes belonging to the family Dicrocoeliidae Odhner, 1911. J. Xiamen Univ. Nat. Sci. 17, 64–80 (in Chinese). Tantrawatpan, C., Saijuntha, W., Sithithaworn, P., Andrews, R.H., Petney, T.N., 2013. Genetic differentiation of Artyfechinostomum malayanum and A. sufrartyfex (Trematoda: Echinostomatidae) based on internal transcribed spacer sequences. Parasitol. Res. 112, 437–441. Urabe, M., Nishimura, T., Shimazu, T., 2012. Taxonomic revision of three species of the genus Genarchopsis (Digenea: Hemiuroidea: Derogenidae) in Japan by molecular phylogenetic analyses. Parasitol. Int. 61, 554–560.
331
Wang, Y., Wang, C.R., Zhao, G.H., Gao, J.F., Li, M.W., Zhu, X.Q., 2011. The complete mitochondrial genome of Orientobilharzia turkestanicum supports its affinity with African Schistosoma spp. Infect. Genet. Evol. 11, 1964–1970. Wang, X.Y., Zhao, G.H., Liu, G.H., Li, J.Y., Zhou, D.H., Xu, M.J., Lin, Q., Zhu, X.Q., 2013. Characterization of Dicrocoelium chinensis from domestic yaks in Gansu and Sichuan provinces, China, using genetic markers in two mitochondrial genes. Mitochondr. DNA 24, 263–266. Webster, B.L., Rudolfová, J., Horák, P., Littlewood, D.T., 2007. The complete mitochondrial genome of the bird schistosome Trichobilharzia regenti (Platyhelminthes: Digenea), causative agent of cercarial dermatitis. J. Parasitol. 93, 553–561. Yan, H.B., Wang, X.Y., Lou, Z.Z., Li, L., Blair, D., Yin, H., Cai, J.Z., Dai, X.L., Lei, M.T., Zhu, X.Q., Cai, X.P., Jia, W.Z., 2013. The mitochondrial genome of Paramphistomum cervi (Digenea), the first representative for the family Paramphistomidae. PLoS ONE 8, e71300. Zhao, G.H., Li, J., Mo, X.H., Li, X.Y., Lin, R.Q., Zou, F.C., Weng, Y.B., Song, H.Q., Zhu, X.Q., 2012a. The second transcribed spacer rDNA sequence: an effective genetic marker for inter-species phylogenetic analysis of trematodes in the order Strigeata. Parasitol. Res. 111, 1467–1472. Zhao, G.H., Li, J., Song, H.Q., Li, X.Y., Chen, F., Lin, R.Q., Yuan, Z.G., Weng, Y.B., Hu, M., Zou, F.C., Zhu, X.Q., 2012b. A specific PCR assay for the identification and differentiation of Schistosoma japonicum geographical isolates in mainland China based on analysis of mitochondrial genome sequences. Infect. Genet. Evol. 12, 1027–1036. Zhao, G.H., Bian, Q.Q., Ren, W.X., Jia, Y.Q., Cheng, W.Y., Fang, Y.Q., Song, J.K., Lin, Q., 2013. Genetic variability among Dicrocoelium dendriticum isolates from different regions in Shaanxi Province, China revealed by sequences of three mitochondrial genes. Mitochondr. DNA 24, 683–688.
Contents lists available at ScienceDirect
Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev
Dicrocoelium chinensis and Dicrocoelium dendriticum (Trematoda: Digenea) are distinct lancet fluke species based on mitochondrial and nuclear ribosomal DNA sequences Guo-Hua Liu a,1, Hong-Bin Yan a,1, Domenico Otranto b, Xing-Ye Wang a,c, Guang-Hui Zhao c, Wan-Zhong Jia a,⇑, Xing-Quan Zhu a,⇑ a State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu Province 730046, PR China b Dipartimento di Sanità Pubblica e Zootecnia, Università degli Studi di Bari, 70010 Valenzano, Bari, Italy c College of Veterinary Medicine, Northwest A&F University, Yangling, Shaanxi Province 712100, PR China
a r t i c l e
i n f o
Article history: Received 4 March 2014 Revised 30 June 2014 Accepted 2 July 2014 Available online 10 July 2014 Keywords: Dicrocoelium chinensis Dicrocoelium dendriticum Mitochondrial DNA Nuclear ribosomal DNA Phylogeny Evolution
a b s t r a c t Lancet flukes parasitize the bile ducts and gall bladder of a range of mammals, including humans, causing dicrocoeliosis. In the present study, we sequenced and characterized the complete mitochondrial (mt) genomes as well as the first and second internal transcribed spacers (ITS-1 and ITS-2 = ITS) of nuclear ribosomal DNA (rDNA) of two lancet flukes, Dicrocoelium chinensis and D. dendriticum. Sequence comparison of a conserved mt gene and nuclear rDNA sequences among multiple individual lancet flukes revealed substantial nucleotide differences between the species but limited sequence variation within each of them. Phylogenetic analysis of the concatenated amino acid and multiple mt rrnS sequences using Bayesian inference supported the separation of D. chinensis and D. dendriticum into two distinct species-specific clades. Results of the present study support the proposal that D. dendriticum and D. chinensis represent two distinct lancet flukes. While providing the first mt genomes from members of the superfamily Plagiorchioidea, the novel mt markers described herein will be useful for further studies of the diagnosis, epidemiology and systematics of the lancet flukes and other trematodes of human and animal health significance. Ó 2014 Elsevier Inc. All rights reserved.
1. Introduction Dicrocoelium spp. (Trematoda: Digenea), known as the ‘lancet fluke’ or ‘small liver fluke’, is the etiological agent of dicrocoeliosis of ruminants, although it may also infest pigs, dogs, horses and humans (Le Bailly and Bouchet, 2010; Otranto and Traversa, 2002, 2003). Dicrocoeliosis causes mild clinical symptoms (e.g., anemia and emaciation) and may exert a significant economic impact on infected animals due to weight loss and reduced meat and milk production (Otranto and Traversa, 2002, 2003). The most important species of this genus are D. chinensis Tang and Tang, 1978 (Tang and Tang provided a new name for D. orientalis Sudarikov and Ryjikov, 1951, a junior homonym of D. orientalis Narain and Das, 1929), D. dendriticum Rudolphi, 1819, D. hospes Looss, 1907 and D. orientalis Narain and Das, 1929 (syn. D. moschiferi Oschmarin, 1952). Furthermore, D. suppereri Hinaiday, 1983 is ⇑ Corresponding authors. E-mail addresses: [email protected] (W.-Z. Jia), [email protected] (X.-Q. Zhu). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.ympev.2014.07.002 1055-7903/Ó 2014 Elsevier Inc. All rights reserved.
morphologically identical to D. chinensis and is considered to be a junior synonym of D. chinensis. Although lancet fluke infections are considered neglected parasites, they are widely distributed in many regions of the world (e.g., D. chinensis in Asia, D. dendriticum in America, Asia, North Africa, and Europe, D. hospes in Africa, and D. orientalis in the former Soviet Union and Austria) (Manga-González et al., 2001). So far, no practical vaccine is available against dicrocoeliosis. However, this disease can be treated effectively via the administration of anthelminthics, such as albendazole, albendazole sulphoxide, and a combination of thiophanate and brotianide (Bártíková et al., 1988, 2011; Cvilink et al., 2009). D. chinensis and D. dendriticum are the most common lancet flukes in many Asian countries, particularly in China (Li, 2012). In spite of the economic and public health significance of dicrocoeliosis, its diagnosis, epidemiology, genetics, and biology remain poorly understood. Lancet fluke species are currently identified based on morphological characteristics of the adult trematodes (e.g., testes orientation, overall size, and body width) (Tang and Tang, 1978). Although previous studies have shown that D. chinensis and D. dendriticum are morphologically distinct species (Otranto et al., 2007), the unequivocal delineation of both species may be
326
G.-H. Liu et al. / Molecular Phylogenetics and Evolution 79 (2014) 325–331
troublesome due to the occurrence of morphological variations in specimens from different hosts or geographical origin (Arbabi et al., 2012). In addition, D. chinensis and D. dendriticum may simultaneously infest the same hosts (Li, 2012), thus requiring accurate identification and differentiation. Molecular tools, using genetic markers in mitochondrial (mt) DNA and in the internal transcribed spacer (ITS) regions of nuclear ribosomal DNA (rDNA), have been used effectively to identify trematode species (Al-Kandari et al., 2012; Urabe et al., 2012; Zhao et al., 2012a; Georgieva et al., 2013; Tantrawatpan et al., 2013). For lancet flukes, mtDNA has proved to be a useful molecular marker for accurate identification and differentiation of Dicrocoelium specimens (Wang et al., 2013; Zhao et al., 2013). Although a previous investigation has shown that D. chinensis and D. dendriticum are distinct species (Otranto et al., 2007), there is still a paucity of information from different species of animals and countries around the world. Advances in long-range PCR-coupled sequencing and bioinformatic methods (Hu et al., 2002a, 2007; Jex et al., 2008) are providing unique opportunities to explore the biology of these parasites. Therefore, in the present study, we sequenced, analyzed and compared the mt genomes as well as ITS rDNA of D. chinensis and D. dendriticum, and tested the hypothesis that D. chinensis and D. dendriticum are genetically distinct via phylogenetic analyses of both nucleotide and amino acid sequence data sets. 2. Methods 2.1. Parasites and total genomic DNA isolation Adult specimens of D. chinensis (n = 11) and D. dendriticum (n = 10) were collected, post-mortem, from the gall bladders of naturally infected yaks and goats, respectively, in Maqu (Gansu Province, China) and, for D. dendriticum, also from naturally infected goats in Minxian (Gansu Province, China). Specimens were washed in physiological saline, identified morphologically to species (Taira et al., 2006; Otranto et al., 2007), fixed in ethanol and then stored at 20 °C until use. Total genomic DNA was isolated separately from mid-body sections of each fluke by small-scale sodium dodecyl-sulfate (SDS)/proteinase K digestion (Gasser et al., 2006) and mini-column purification (WizardÒ SV Genomic DNA Purification System, Promega). Single samples were identified as D. chinensis and D. dendriticum based on PCR-based sequencing of regions in the ITS-2 using an established method (Otranto et al., 2007). 2.2. Long-PCR and sequencing Using primers (Table 1) designed to relatively conserved regions of mtDNA nucleotide sequences from these lancet flukes (Wang et al., 2013) and other closely-related taxa, the complete mt genomes of D. chinensis and D. dendriticum were amplified by long-PCR as five or six overlapping amplicons from the genomic DNA from a single specimen from each species. PCR was conducted in 25 ll using 2 mM MgCl2, 0.2 mM each of dNTPs, 2.5 ll 10 Taq buffer, 2.5 lM of each primer and 0.5 ll LA Taq DNA polymerase (5 U/ll, Takara) in a thermocycler (BioRad) under the following conditions: 92 °C for 2 min (initial denaturation), then 92 °C for 10 s (denaturation), 52–58 °C for 30 s (annealing), and 60 °C for 10 min (extension) for 10 cycles, followed by 92 °C for 10 s, 52–58 °C for 30 s (annealing), and 60 °C for 10 min for 20 cycles, with a cycle elongation of 10 s for each cycle and a final extension at 60 °C for 10 min. Genomic DNA (2 ll) was added to PCR. A no-DNA control was included in each amplification run. Each amplicon (5 ll) was examined by agarose (1%) gel electrophoresis, stained with ethidium bromide and photographed using a gel documentation system (UVItec). PCR products were sent to Sangon
Company (Shanghai, China) for sequencing from both directions using a primer walking strategy (Hu et al., 2007). 2.3. Annotation and bioinformatic analysis Sequences were assembled manually and aligned against the mt genome sequences of Paragonimus westermani (GenBank accession number NC_002354) using MAFFT 7.122 (Katoh and Standley, 2013) to identify gene boundaries. Each protein-coding gene was translated into amino acid sequences using the trematode mt genetic code in MEGA 5 (Tamura et al., 2011). The tRNA genes were identified using the program tRNAscan-SE (Lowe and Eddy, 1997) or by visual inspection (Hu et al., 2002b) and rRNA genes were predicted by comparison with those of P. westermani. The amino acid sequences conceptually translated from individual genes of the mt genomes of the two lancet fluke were concatenated. For comparative purposes, amino acid sequences predicted from published mt genomes from selected Digenea, including the family Opisthorchiidae [Clonorchis sinensis, FJ381664 (Shekhovtsov et al., 2010), Opisthorchis felineus, EU921260 (Shekhovtsov et al., 2010), and O. viverrini, JF739555 (Cai et al., 2012)], Fasciolidae [(Fasciola hepatica, NC_002546 (Le et al., 2001); F. gigantica, KF543342 (Liu et al., 2014)], Heterophyidae (Haplorchis taichui, KF214770) (Lee et al., 2013), Paramphistomidae (Paramphistomum cervi, KF475773) (Yan et al., 2013), Paragonimidae (Paragonimus westermani, NC_002354), and Schistosomatidae [(Trichobilharzia regenti, NC_009680 (Webster et al., 2007), Schistosoma turkestanicum, HQ283100 (Wang et al., 2011), Schistosoma mansoni, NC_002545 (Le et al., 2000), S. japonicum, HM120846 (Zhao et al., 2012b), S. mekongi, NC_002529 (Le et al., 2000), S. spindale, DQ157223 (Littlewood et al., 2006), S. haematobium, DQ157222 (Littlewood et al., 2006)], were also included in the analyses. A sequence from a Gyrodactylus species (Gyrodactylus derjavinoides, GenBank accession number NC_010976) was included as an outgroup (Huyse et al., 2008). All amino acid sequences were aligned using MAFFT 7.122 and subjected to phylogenetic analysis using Bayesian inference (BI) as described previously (Ronquist and Huelsenbeck, 2003). Phylograms were viewed using the Tree View program v.1.65 (Page, 1996). 2.4. Sequencing of ITS rDNA and mt rrnS The complete ITS rDNA region including primer flanking 18S and 28S rDNA sequences was PCR-amplified from individual DNA samples using universal primers BD1 (forward; 50 -GTCGTAAC AAGGTTTCCGTA-30 ) and BD2 (reverse; 50 -TATGCTTAAATTCAGC GGGT-30 ) described previously (Morgan and Blair, 1995). Two primers, rrnSF (50 -CGACCTGTGTTTCCTATGAGTTGAG-30 ) and rrnSR (50 -CGAACTAAATCCAGATACAAATAAC-30 ), were employed for PCR amplification (750 bp) and subsequent sequencing of the complete mt rrnS from multiple individuals of D. chinensis (coded DC1–DC11) and D. dendriticum (coded DD1–DD10). A mt rrnS sequence from P. westermani (accession number NC_002354) was used as an outgroup in the phylogenetic analyses. All mt rrnS sequences were aligned using MAFFT, and the alignment was adjusted manually, and then subjected to phylogenetic analysis using the same methods as described above. 3. Results 3.1. Identity of the two lancet flukes, and genome content and organization The ITS-2 sequences of D. chinensis (coded DC11) and of D. dendriticum (coded DD10) shared 98% and 99% identity with previously published sequences of D. chinensis from sika deer in
G.-H. Liu et al. / Molecular Phylogenetics and Evolution 79 (2014) 325–331
327
Table 1 Sequences of primers used to long-PCR amplify regions of the mt genomes of Dicrocoelium chinensis and D. dendriticum. Primer designation
Sequence (50 –30 )
Size (kb)
Amplified region (c.f. Fig. 1)
For D. chinensis DC1F DC1R DC2F DC2R DC3F DC3R DC4F DC4R DC5F DC5R
CTCCTGTGACGATAAAGCCTGAGTGAT AAGACAACCAATCCCGAAACTGAGAAACC GGTCTTTGACTTTTGAAGCGTGTTTTTTATGT CGCAGAAAGAATAACACCAGTAATCCCTCCTA TTACTGTAGGAGGGATTACTGGTG GGAATAACCGTTCACGCAAG GTACACACCGCCCGTCACC AGAACTCATCAAATCACCCATCC ATTTGGTGATGTAGCGTTGTTT GCCTCCGTATCAACGACCAA
4.0
Partial cytb-nad4L-nad4-Q-M-F-atp6-nad2-V-A-D-partial nad1
2.5
Partial nad1-N-P-I-K-nad3-S1-W-partial cox1
2.5
Partial cox1-T-rrnL-C-rrnS-partial cox2
2.5
Partial cox2-nad6-Y-L1-S2-L2-R partial nad5
4.5
Partial nad5-G-NCR-E-NCL-cox3-H-partial cytb
For D. dendriticum DD1F DD1R DD2F DD2R DD3F DD3R DD4F DD4R DD5F DD5R DD6F DD6R
GGTTACCTCGTATGAATGCTTTGAG AAATCACCCATCAACGAATCATAG CTTTGTGCGTTTTGCTTTGC AGAACTCATCAAATCACCCATCC CAGATTAGATGGGTTGGTTTTAAGC GATACTCCGGATGACATGAACCC TGGTTGTTTGATATTGGCATTTTGT CATAAAGGAGTTCCAGAAGGC AGAATTGGATACTAAGCGTTGGT GCACATAACCAAGCATCTTACGC GTTGTTTGAGGTATTTCTACATTTTTGA GGCGGATAAAAAGTTCAACCAAC
3.5
Partial cox1-T-rrnL-C-rrnS-partial cox2
3.0
Partial cox2-nad6-Y-L1-S2-L2-R partial nad5
5.0
Partial nad5-G-NCR-E-NCL-cox3-H-partial cytb
3.0
Partial cytb-nad4L-nad4-Q-M-F-partial atp6
2.5
Partial atp6-nad2-V-A-D-partial nad1
3.0
Partial nad1-N-P-I-K-nad3-S1-W-partial cox1
Japan (GenBank accession number AB367790) and of D. dendriticum in Iran (GenBank accession number JQ966973), respectively. The complete mt genome sequences of D. chinensis and D. dendriticum (GenBank accession numbers KF318786 and KF318787, respectively) are a typical circular DNA molecular of 14,917 bp and 14,884 bp in size, respectively (Fig. 1). Each of the two mt genomes contains 36 genes, including 12 protein-coding genes (cox1–3, nad1–6, nad4L, atp6 and cytb), 22 tRNA genes, two rRNA genes (rrnL and rrnS), but lacks an atp8 gene (Table 2). All genes are transcribed in the same direction. The gene order of the mt genomes of the two lancet flukes is identical to those of C. sinensis, F. hepatica, O. felineus and P. westermani (Le et al., 2001; Shekhovtsov et al., 2010; Cai et al., 2012), but differs markedly from some members of Schistosoma (Wang et al., 2011; Webster et al., 2007; Le et al., 2000; Zhao et al., 2012b; Littlewood et al., 2006). The nucleotide composition of the entire mt genomes of two lancet flukes is biased toward A and T with an overall A + T content of 62.11% for D. chinensis and 62.18% for D. dendriticum, respectively. 3.2. Annotation In the D. chinensis and D. dendriticum mt genomes, 12 proteincoding genes had ATG or GTG or TTG or ATA as their initiation codons (Table 2). All reading-frames of the two lancet flukes ended with TAG or TAA or T as termination codons (Table 2). In the mt genomes of D. chinensis and D. dendriticum, the 22 tRNA genes ranged from 56 to 68 bp in size. The secondary structures predicted for the tRNA genes were similar to the corresponding genes from P. westermani and F. hepatica (Le et al., 2001). In the two mt genomes, the rrnL was located between tRNA-Thr and tRNA-Cys, and rrnS was between tRNA-Cys and cox2 (Table 2). The lengths of the rrnL gene are 968 bp and 969 bp for D. chinensis and D. dendriticum, respectively. The length of the rrnS gene is 707 bp and 708 bp for D. chinensis and D. dendriticum, respectively. For these mt genomes, the long non-coding regions (designated NCL) and short noncoding regions (designated NCR) were located between the tRNA-Glu and tRNA-Gly, and tRNA-Gly and cox3, respectively (Table 2). The NCR exhibits no noteworthy features. However, the NCL contains some tandem repeats. D. chinensis has two sets
Fig. 1. Organization of the mitochondrial genomes of Dicrocoelium chinensis and D. dendriticum. Scale is approximate. All genes have standard nomenclature except for the 22 tRNA genes, which are designated by the one-letter code for the corresponding amino acid, with numerals differentiating each of the two leucineand serine-specifying tRNAs (L1 and L2 for codon families CUN and UUR, respectively; S1 and S2 for codon families UCN and AGN, respectively). All genes are transcribed in the clockwise direction. ‘‘NCL’’ refers to a large non-coding region. ‘‘NCR’’ refers to a small non-coding region.
of tandem repeats (122 bp), which are located at positions 7491–7612 and 7613–7734. D. dendriticum also contains two sets of tandem repeats (120 bp), which are found at positions 7484–7604 and 7605–7724, but eight bases differ between these repeats. 3.3. Comparative analyses between D. chinensis and D. dendriticum A comparison of the nucleotide sequences of each mt gene and non-coding regions, as well as of the amino acid sequences, conceptually translated from all protein genes, is given in Table 3.
328
G.-H. Liu et al. / Molecular Phylogenetics and Evolution 79 (2014) 325–331
Table 2 The organization of the mitochondrial genomes of Dicrocoelium chinensis and D. dendriticum. Gene/region
Positions
Size (bp)
Ini/Ter codons
DC
DD
DC
DD
DC
DD
cox1 tRNA-Thr (T) rrnL tRNA-Cys (C) rrnS cox2 nad6 tRNA-Tyr (Y) tRNA-LeuCUN (L1) tRNA-SerUCN (S2) tRNA-LeuUUR (L2) tRNA-Arg (R) nad5 tRNA-Gly (G) Non-coding region (NCR) tRNA-Glu (E) Non-coding region (NCL) cox3 tRNA-His (H) cytb nad4L nad4 tRNA-Gln (Q) tRNA-Phe (F) tRNA-Met (M) atp6 nad2 tRNA-Val (V) tRNA-Ala (A) tRNA-Asp (D) nad1 tRNA-Asn (N) tRNA-Pro (P) tRNA-Ile (I) tRNA-Lys (K) nad3 tRNA-SerAGN (S1) tRNA-Trp (W)
1–1536 1550–1613 1616–2583 2584–2647 2648–3354 3355–3978 3996–4454 4459–4521 4522–4584 4603–4664 4665–4725 4737–4797 4809–6365 6376–6440 6441–6972 6973–7036 7037–8048 8049–8699 8721–8785 8786–9898 9898–10161 10170–11369 11399–11460 11464–11525 11526–11587 11588–12100 12106–12978 12986–13048 13050–13112 13117–13184 13189–14088 14093–14158 14179–14240 14244–14306 14323–14383 14384–14732 14733–14788 14816–14880
1–1536 1553–1616 1619–2587 2588–2651 2652–3359 3360–3983 3997–4455 4460–4522 4523–4584 4603–4663 4668–4730 4742–4801 4813–6369 6380–6443 6444–6969 6970–7031 7032–8024 8025–8675 8689–8753 8754–9866 9866–10129 10138–11337 11367–11428 11432–11492 11493–11553 11554–12066 12067–12939 12949–13011 13013–13075 13080–13143 13154–14053 14058–14123 14147–14208 14212–14274 14291–14351 14352–14700 14701–14756 14783–14847
1536 64 968 64 707 624 459 63 63 62 65 61 1557 65 532 64 1012 651 65 1113 264 1200 62 62 62 513 873 63 63 68 900 66 62 63 61 349 56 65
1536 64 969 64 708 624 459 63 62 61 63 60 1557 64 526 62 993 651 65 1113 264 1200 62 61 61 513 873 63 63 64 900 66 62 63 61 349 56 65
ATG/TAG
ATG/TAG
ATG/TAA ATG/TAG
ATG/TAA ATG/TAG
TTG/TAA
TTG/TAG
ATG/TAG
ATG/TAG
TTG/TAG GTG/TAA ATA/TAG
TTG/TAG GTG/TAA ATA/TAG
GTG/TAG ATG/TAG
GTG/TAG ATG/TAG
GTG/TAA
GTG/TAA
GTG/T
ATG/T
DC: Dicrocoelium chinensis; DD: Dicrocoelium dendriticum.
The magnitude of sequence variation across the entire mt genome between the two lancet flukes was 11.81% (a total of 1762 nucleotide substitutions). For the12 protein genes, this comparison revealed sequence differences at both the nucleotide (11.70%, a total of 1175 nucleotide substitutions) and amino acid (11.36%, a total of 379 amino acid substitutions) levels. The nucleotide and amino acid sequences inferred from individual mt protein-coding genes of D. chinensis and D. dendriticum were also compared. The nucleotide sequence differences ranged from 8.87% to 18.08%, with nad5 being the most conserved protein-coding gene and nad6 the least conserved. The amino acid sequence differences ranged from 3.45% to 21.05%, with nad4L being the most conserved proteincoding gene and nad6 the least conserved. Nucleotide differences were also detected in the two ribosomal RNA genes [rrnL (8.67%) and rrnS (8.33%)], 22 tRNA genes (12.20%) and non-coding regions (13.54%) (Table 3). The phylogenetic analyses of amino acid sequence datasets using G. derjavinoides as the outgroup reflected the clear genetic distinctiveness between D. chinensis and D. dendriticum and also the grouping of these two members of Dicrocoelium with other members of families Paramphistomidae, Fasciolidae, Paragonimidae, Heterophyidae and Opisthorchiidae, with maximum support (posterior probability = 1.00), to the exclusion of members of the Schistosomatidae (Fig. 2). The differences between the two Dicrocoelium spp. are about the same (looking at branch lengths) as between the two Fasciola spp. and similar to differences among opisthorchiids (Cai et al., 2012; Liu et al., 2014).
The rDNA region including ITS-1, ITS-2 and intervening 5.8 rRNA gene sequenced from individual lancet fluke samples (coded: DC1–DC11 and DD1–DD10) was approximately 960 bp in length. Individual spacers were 560 bp (ITS-1) and 238 bp (ITS-2), and the 5.8S rRNA gene was 160 bp long. The sequence variation was 7.5–9.3% (ITS-1) and 3.8–6.3% (ITS-2) between the D. chinensis and D. dendriticum. However, intra-species sequence variation was 0–3.7% (ITS-1) and 0–2.9 (ITS-2) within D. chinensis, and 0–0.5% (ITS-1) and 0–0.4% (ITS-2) within D. dendriticum. Comparison of the mt genomes of D. chinensis and D. dendriticum showed that the mt rrnS was the most conserved gene (Table 3). Sequence variation in sections of the mt rrnS gene was assessed among 21 individuals of D. chinensis (DC1–DC11) and D. dendriticum (DD1–DC10). Nucleotide variation among the 11 D. chinensis individuals was detected at 8 sites (1.13%). Nucleotide variation among the 10 D. dendriticum individuals also occurred at 12 sites (1.70%). The alignment of the full mt rrnS gene sequences revealed that all individuals of D. chinensis differed at 70 (9.89%) nucleotide positions when compared with all individuals of D. dendriticum. Phylogenetic analyses of the mt rrnS sequence data revealed strong support for the separation of D. chinensis and D. dendriticum individuals into two distinct clades (Fig. 3). 4. Discussion Currently, identification and differentiation of lancet fluke species have been traditionally based on the microscopic features of
329
G.-H. Liu et al. / Molecular Phylogenetics and Evolution 79 (2014) 325–331 Table 3 Differences in mitochondrial nucleotides and predicted amino acids sequences between Dicrocoelium chinensis (DC) and D. dendriticum (DD). Gene/region
atp6 nad1 nad2 nad3 nad4 nad4L nad5 nad6 cox1 cox2 cox3 cytb rnnL rrnS 22 tRNA Non-coding
Nucleotide size
Nucleotide difference (%)
Number of aa
aa Difference (%)
DC
DD
DC/DD
DC
DD
DC/DD
513 900 873 360 1200 264 1557 459 1536 624 651 1116 968 707 1385 1544
513 900 873 360 1200 264 1557 459 1536 624 651 1116 969 708 1375 1518
13.26 11.67 13.52 8.89 14.08 12.88 8.87 18.08 9.11 16.03 14.9 10.93 8.67 8.33 12.20 13.54
170 299 290 119 399 87 529 152 511 207 216 371 – – – –
170 299 290 119 399 87 528 152 511 207 216 371 – – – –
14.71 9.36 13.45 5.04 17.04 3.45 10.04 21.05 4.70 16.43 17.59 8.09 – – – –
Fig. 2. Relationship of Dicrocoelium chinensis and D. dendriticum with other selected digenea trematodes based on mitochondrial sequence data. The concatenated amino acid sequences of 12 protein-coding genes were subjected to analysis by Bayesian inference (BI) using Gyrodactylus derjavinoides as an outgroup. Posterior probability (pp) values are indicated. Branch lengths were estimated by BI.
the adult worms (Tang and Tang, 1978). However, these criteria are often insufficient for specific identification and differentiation (Arbabi et al., 2012), particularly at the larval and/or egg stages. The mt genome is a useful genetic marker in examining taxonomic status of parasites (Le et al., 2002), particularly when concatenated protein-coding genes are used as markers in comparative analyses (Wang et al., 2011; Jia et al., 2012; Liu et al., 2012, 2013; Burger et al., 2012, 2014). For these reasons, we employed here a molecular genetic approach, logically extending previous studies (Otranto et al., 2007; Wang et al., 2013; Zhao et al., 2013), so that comparative genetic analyses could be conducted. A substantial level of nucleotide variation (11.81%) was detected in the complete mt genomes between an individual of D. chinensis and D. dendriticum. Variation in the nucleotide sequences of the nuclear ITS rDNA from D. chinensis and D. dendriticum (3.8–9.3%) were consistent with previous findings (Otranto et al., 2007). In addition, genetic variation between D. chinensis and D. dendriticum was also detected in the two mt ribosomal RNA gene subunits (rrnL and rrnS), 22 tRNA genes, and
non-coding regions. These mt rrnL and rrnS genes are usually more conserved in sequence than the mt protein-coding genes (Hu et al., 2004), which is also supported by the results from the present study. The two lancet flukes displayed a lower sequence variation in mt rrnL and rrnS (8.67% and 8.33%) when compared with the 12 protein-coding genes (8.87–18.08%), 22 tRNA genes (12.20%), and the non-coding regions (13.54%) (Table 3). Complete mt rrnS gene (i.e., 707 bp for D. chinensis and 708 bp for D. dendriticum) was used to examine the level of genetic variation between D. chinensis and D. dendriticum. Comparison of the complete mt rrnS sequences from 21 Dicrocoelium individuals revealed 70 (9.89%) variable positions between D. chinensis and D. dendriticum. However, there was very limited sequence variation (1.13–1.70%) within each of the two lancet fluke species, which is consistent with recent studies (Wang et al., 2013; Zhao et al., 2013). Phylogenetic analysis of the concatenated amino acid and multiple mt rrnS sequences also provided further support that D. chinensis and D. dendriticum represent close but distinct taxa (Figs. 2 and 3).
330
G.-H. Liu et al. / Molecular Phylogenetics and Evolution 79 (2014) 325–331
Fig. 3. Inferred phylogenetic relationship among representative Dicrocoelium samples using Bayesian inference (BI) of mitochondrial rrnS sequence data, using Paragonimus westermani as the outgroup. Posterior probability (pp) values are indicated. Branch lengths were estimated by BI.
Although our results provide molecular evidence that D. chinensis and D. dendriticum represent distinct lancet flukes, there are a number of areas that require further attention: (i) exploring, in detail, nucleotide variation in rDNA and mtDNA within and among lancet fluke populations from different hosts and countries, (ii) employing other more variable molecular markers and a larger number of samples to confirm the phylogenetic relationships among lancet fluke taxa, (iii) undertaking detailed morphological studies, by scanning electron microscopy and field emission scanning electron microscopy, of lancet flukes from a range of hosts, and (iv) characterizing and comparing the complete mt genomes and rDNA of other lancet flukes. In conclusion, the present study determined and compared the complete mt genome sequences and ITS rDNA sequences of D. chinensis and D. dendriticum, supporting that they are distinct lancet fluke species. In addition, these are the first mt genomes of any members of the superfamily Plagiorchioidea. These novel mt genome sequences should provide new and useful genetic markers for further studies of the taxonomy, identification, systematics and epidemiology of trematodes of humans and animals. Acknowledgments This work was supported in part by the International Science & Technology Cooperation Program of China (Grant No. 2013DFA31840), the ‘‘Special Fund for Agro-scientific Research in the Public Interest’’ (Grant No. 201303037) and the Science Fund for Creative Research Groups of Gansu Province (Grant No. 1210RJIA006). References Al-Kandari, W.Y., Al-Bustan, S.A., Isaac, A.M., George, B.A., Chandy, B.S., 2012. Molecular identification of Austrobilharzia species parasitizing Cerithidea cingulata (Gastropoda: Potamididae) from Kuwait Bay. J. Helminthol. 86, 470– 478. Arbabi, M., Dalimi, A., Ghaffarifar, F., Foorozandeh-Moghadam, M., 2012. Morphological and molecular characterization of Dicrocoelium isolated from sheep in the north and center of Iran. Feyz J. Kashan Univ. Med. Sci. 16, 135– 145. Bártíková, H., Vokrˇál, I., Forstová-Krˇízˇová, V., Skálová, L., Lamka, J., Szotáková, B., 1988. Treatment of Dicrocoelium dendriticum with a combination of thiophanate and brotianide. Vet. Rec. 123, 650–651.
Bártíková, H., Vokrˇál, I., Forstová-Krˇízˇová, V., Skálová, L., Lamka, J., Szotáková, B., 2011. The transport of albendazole and albendazole sulphoxide in the lancet fluke (Dicrocoelium dendriticum). Vet. Parasitol. 176, 27–33. Burger, T.D., Shao, R., Beati, L., Miller, H., Barker, S.C., 2012. Phylogenetic analysis of ticks (Acari: Ixodida) using mitochondrial genomes and nuclear rRNA genes indicates that the genus Amblyomma is polyphyletic. Mol. Phylogenet. Evol. 64, 45–55. Burger, T.D., Shao, R., Barker, S.C., 2014. Phylogenetic analysis of mitochondrial genome sequences indicates that the cattle tick, Rhipicephalus (Boophilus) microplus, contains a cryptic species. Mol. Phylogenet. Evol. 76, 241–253. Cai, X.Q., Liu, G.H., Song, H.Q., Wu, C.Y., Zou, F.C., Yan, H.K., Yuan, Z.G., Lin, R.Q., Zhu, X.Q., 2012. Sequences and gene organization of the mitochondrial genomes of the liver flukes Opisthorchis viverrini and Clonorchis sinensis (Trematoda). Parasitol. Res. 110, 235–243. Cvilink, V., Szotáková, B., Krízová, V., Lamka, J., Skálová, L., 2009. Phase I biotransformation of albendazole in lancet fluke (Dicrocoelium dendriticum). Res. Vet. Sci. 86, 49–55. Gasser, R.B., Hu, M., Chilton, N.B., Campbell, B.E., Jex, A.J., Otranto, D., Cafarchia, C., Beveridge, I., Zhu, X., 2006. Single-strand conformation polymorphism (SSCP) for the analysis of genetic variation. Nat. Protoc. 1, 3121–3128. Georgieva, S., Soldánová, M., Pérez-Del-Olmo, A., Dangel, D.R., Sitko, J., Sures, B., Kostadinova, A., 2013. Molecular prospecting for European Diplostomum (Digenea: Diplostomidae) reveals cryptic diversity. Int. J. Parasitol. 43, 57–72. Hu, M., Chilton, N.B., Gasser, R.B., 2002a. Long PCR-based amplification of the entire mitochondrial genome from single parasitic nematodes. Mol. Cell. Probes 16, 261–267. Hu, M., Chilton, N.B., Gasser, R.B., 2002b. The mitochondrial genomes of the human hookworms, Ancylostoma duodenale and Necator americanus (Nematoda: Secernentea). Int. J. Parasitol. 32, 145–158. Hu, M., Chilton, N.B., Gasser, R.B., 2004. The mitochondrial genomics of parasitic nematodes of socio-economic importance: recent progress, and implications for population genetics and systematics. Adv. Parasitol. 56, 133–212. Hu, M., Jex, A.R., Campbell, B.E., Gasser, R.B., 2007. Long PCR amplification of the entire mitochondrial genome from individual helminths for direct sequencing. Nat. Protoc. 2, 2339–2344. Huyse, T., Buchmann, K., Littlewood, D.T., 2008. The mitochondrial genome of Gyrodactylus derjavinoides (Platyhelminthes: Monogenea) – a mitogenomic approach for Gyrodactylus species and strain identification. Gene 417, 27–34. Jex, A.R., Hu, M., Littlewood, D.T., Waeschenbach, A., Gasser, R.B., 2008. Using 454 technology for long-PCR based sequencing of the complete mitochondrial genome from single Haemonchus contortus (Nematoda). BMC Genomics 9, 11. Jia, W., Yan, H., Lou, Z., Ni, X., Dyachenko, V., Li, H., Littlewood, D.T., 2012. Mitochondrial genes and genomes support a cryptic species of tapeworm within Taenia taeniaeformis. Acta Trop. 123, 154–163. Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol. 30, 772– 780. Le Bailly, M., Bouchet, F., 2010. Ancient dicrocoeliosis: occurrence, distribution and migration. Acta Trop. 115, 175–180. Le, T.H., Blair, D., Agatsuma, T., Humair, P.F., Campbell, N.J., Iwagami, M., Littlewood, D.T., Peacock, B., Johnston, D.A., Bartley, J., Rollinson, D., Herniou, E.A., Zarlenga, D.S., McManus, D.P., 2000. Phylogenies inferred from mitochondrial gene orders – a cautionary tale from the parasitic flatworms. Mol. Biol. Evol. 17, 1123–1125. Le, T.H., Blair, D., McManus, D.P., 2001. Complete DNA sequence and gene organization of the mitochondrial genome of the liver fluke, Fasciola hepatica L. (Platyhelminthes; Trematoda). Parasitology 123, 609–621. Le, T.H., Blair, D., McManus, D.P., 2002. Mitochondrial genomes of parasitic flatworms. Trends Parasitol. 18, 206–213. Lee, D., Choe, S., Park, H., Jeon, H.K., Chai, J.Y., Sohn, W.M., Yong, T.S., Min, D.Y., Rim, H.J., Eom, K.S., 2013. Complete mitochondrial genome of Haplorchis taichui and comparative analysis with other trematodes. Korean J. Parasitol. 51, 719–726. Li, L.F., 2012. Prevalence of trematodes in cattle and sheep in Qinghai province, China. Qinghai J. Anim. Vet. Sci. 42, 28–29 (in Chinese). Littlewood, D.T., Lockyer, A.E., Webster, B.L., Johnston, D.A., Le, T.H., 2006. The complete mitochondrial genomes of Schistosoma haematobium and Schistosoma spindale and the evolutionary history of mitochondrial genome changes among parasitic flatworms. Mol. Phylogenet. Evol. 39, 452–467. Liu, G.H., Gasser, R.B., Su, A., Nejsum, P., Peng, L., Lin, R.Q., Li, M.W., Xu, M.J., Zhu, X.Q., 2012. Clear genetic distinctiveness between human- and pig-derived Trichuris based on analyses of mitochondrial datasets. PLoS Negl. Trop. Dis. 6, e1539. Liu, G.H., Chen, F., Chen, Y.Z., Song, H.Q., Lin, R.Q., Zhou, D.H., Zhu, X.Q., 2013. Complete mitochondrial genome sequence data provides genetic evidence that the brown dog tick Rhipicephalus sanguineus (Acari: Ixodidae) represents a species complex. Int. J. Biol. Sci. 9, 361–369. Liu, G.H., Gasser, R.B., Young, N.D., Song, H.Q., Ai, L., Zhu, X.Q., 2014. Complete mitochondrial genomes of the ‘intermediate form’ of Fasciola and Fasciola gigantica, and their comparison with F. hepatica. Parasit. Vec. 7, 150. Lowe, T.M., Eddy, S.R., 1997. TRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 25, 955–964. Manga-González, M.Y., González-Lanza, C., Cabanas, E., Campo, R., 2001. Contributions to and review of dicrocoeliosis, with special reference to the intermediate hosts of Dicrocoelium dendriticum. Parasitology 123, S91–114. Morgan, J.A., Blair, D., 1995. Nuclear rDNA ITS sequence variation in the trematode genus Echinostoma: an aid to establishing relationships within the 37-collarspine group. Parasitology 111, 609–615.
G.-H. Liu et al. / Molecular Phylogenetics and Evolution 79 (2014) 325–331 Otranto, D., Traversa, D.A., 2002. Review of dicrocoeliosis of ruminants including recent advances in the diagnosis and treatment. Vet. Parasitol. 107, 317–335. Otranto, D., Traversa, D., 2003. Dicrocoeliosis of ruminants: a little known fluke disease. Trends Parasitol. 19, 12–15. Otranto, D., Rehbein, S., Weigl, S., Cantacessi, C., Parisi, A., Lia, R.P., Olson, P.D., 2007. Morphological and molecular differentiation between Dicrocoelium dendriticum (Rudolphi, 1819) and Dicrocoelium chinensis (Sudarikov and Ryjikov, 1951) Tang and Tang, 1978 (Platyhelminthes: Digenea). Acta Trop. 104, 91–98. Page, R.D., 1996. TREEVIEW: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12, 357–358. Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Shekhovtsov, S.V., Katokhin, A.V., Kolchanov, N.A., Mordvinov, V.A., 2010. The complete mitochondrial genomes of the liver flukes Opisthorchis felineus and Clonorchis sinensis (Trematoda). Parasitol. Int. 59, 100–103. Taira, K., Shirasaka, S., Taira, N., Ando, Y., Adachi, Y., 2006. Morphometry on lancet flukes found in Japanese sika deer (Cervus nippon centralis) captured in Iwate Prefecture, Japan. J. Vet. Med. Sci. 68, 375–377. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tang, Z., Tang, Z., 1978. Investigations on trematodes belonging to the family Dicrocoeliidae Odhner, 1911. J. Xiamen Univ. Nat. Sci. 17, 64–80 (in Chinese). Tantrawatpan, C., Saijuntha, W., Sithithaworn, P., Andrews, R.H., Petney, T.N., 2013. Genetic differentiation of Artyfechinostomum malayanum and A. sufrartyfex (Trematoda: Echinostomatidae) based on internal transcribed spacer sequences. Parasitol. Res. 112, 437–441. Urabe, M., Nishimura, T., Shimazu, T., 2012. Taxonomic revision of three species of the genus Genarchopsis (Digenea: Hemiuroidea: Derogenidae) in Japan by molecular phylogenetic analyses. Parasitol. Int. 61, 554–560.
331
Wang, Y., Wang, C.R., Zhao, G.H., Gao, J.F., Li, M.W., Zhu, X.Q., 2011. The complete mitochondrial genome of Orientobilharzia turkestanicum supports its affinity with African Schistosoma spp. Infect. Genet. Evol. 11, 1964–1970. Wang, X.Y., Zhao, G.H., Liu, G.H., Li, J.Y., Zhou, D.H., Xu, M.J., Lin, Q., Zhu, X.Q., 2013. Characterization of Dicrocoelium chinensis from domestic yaks in Gansu and Sichuan provinces, China, using genetic markers in two mitochondrial genes. Mitochondr. DNA 24, 263–266. Webster, B.L., Rudolfová, J., Horák, P., Littlewood, D.T., 2007. The complete mitochondrial genome of the bird schistosome Trichobilharzia regenti (Platyhelminthes: Digenea), causative agent of cercarial dermatitis. J. Parasitol. 93, 553–561. Yan, H.B., Wang, X.Y., Lou, Z.Z., Li, L., Blair, D., Yin, H., Cai, J.Z., Dai, X.L., Lei, M.T., Zhu, X.Q., Cai, X.P., Jia, W.Z., 2013. The mitochondrial genome of Paramphistomum cervi (Digenea), the first representative for the family Paramphistomidae. PLoS ONE 8, e71300. Zhao, G.H., Li, J., Mo, X.H., Li, X.Y., Lin, R.Q., Zou, F.C., Weng, Y.B., Song, H.Q., Zhu, X.Q., 2012a. The second transcribed spacer rDNA sequence: an effective genetic marker for inter-species phylogenetic analysis of trematodes in the order Strigeata. Parasitol. Res. 111, 1467–1472. Zhao, G.H., Li, J., Song, H.Q., Li, X.Y., Chen, F., Lin, R.Q., Yuan, Z.G., Weng, Y.B., Hu, M., Zou, F.C., Zhu, X.Q., 2012b. A specific PCR assay for the identification and differentiation of Schistosoma japonicum geographical isolates in mainland China based on analysis of mitochondrial genome sequences. Infect. Genet. Evol. 12, 1027–1036. Zhao, G.H., Bian, Q.Q., Ren, W.X., Jia, Y.Q., Cheng, W.Y., Fang, Y.Q., Song, J.K., Lin, Q., 2013. Genetic variability among Dicrocoelium dendriticum isolates from different regions in Shaanxi Province, China revealed by sequences of three mitochondrial genes. Mitochondr. DNA 24, 683–688.