Dietary aluminosilicate supplement enhances immune activity in mice and reinforces clearance of porcine circovirus type 2 in experimentally infected pigs

Veterinary Microbiology 143 (2010) 117–125

Contents lists available at ScienceDirect

Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic

Dietary aluminosilicate supplement enhances immune activity in mice and reinforces clearance of porcine circovirus type 2 in experimentally infected pigs Bock-Gie Jung a, Nguyen Tat Toan a, Sun-Ju Cho a, Jae-hyung Ko a, Yeon-Kwon Jung b, Bong-Joo Lee a,* a b

College of Veterinary Medicine, Chonnam National University, 300 Yongbong-dong, Buk-gu, Gwangju 500-757, Republic of Korea Seobong BioBestech Co., Ltd., Hyechon Building #401, 831 Yeoksam-dong, Kangnam-gu, Seoul, Republic of Korea

A R T I C L E I N F O

A B S T R A C T

Article history: Received 30 May 2009 Received in revised form 2 November 2009 Accepted 10 November 2009

Aluminosilicate is the major component of clay minerals such as zeolite, bentonite and clinoptilolite. The minerals possess a number of beneficial activities, especially in regulating the immune system. The aims of the present study were to evaluate immune enhancing effects of dietary aluminosilicate supplement (DAS) in mice, and to demonstrate clearance effects of DAS against porcine circovirus type 2 (PCV2) in experimentally infected pigs as an initial step towards the development of an antibiotic substitute for use in pigs. Relative messenger RNA expression levels of interferon-gamma, interleukin-4 and tumor necrosis factor-alpha, phagocytic activities of polymorphonuclear leucocytes, serum antibody production level and spleen B cell ratio were significantly increased in the DAS groups of mice compared with the control group (each feeding group had three replications with 5 mice each). The results indicated that general immune activity including cellular and humoral immunity could be enhanced by DAS in mice. In experimentally PCV2-infected pigs, the load of viral genome in nasal swab, serum and lung of the DAS group of pigs was significantly decreased compared with the control group at 28 days post-infection (each group three pigs). Corresponding histopathological analyses demonstrated that pigs in the DAS group displayed mild and less severe abnormal changes compared with the control group, indicating that DAS reinforces clearance of PCV2 in experimentally infected pigs. This may relate to general immune enhancing effects of DAS in mice. Therefore DAS will help the health of animal, especially in swine. ß 2009 Elsevier B.V. All rights reserved.

Keywords: Aluminosilicate Immune enhancement Porcine Circovirus type 2

1. Introduction Antibiotics have been used as feed supplements to improve physical performance and to help suppress subclinical disease challenge in industrial animals (Cromwell, 2002). However, concerns about development of antimicrobial resistance and transference of antibiotic

* Corresponding author. Tel.: +82 62 530 2850; fax: +82 62 530 2857. E-mail address: [email protected] (B.-J. Lee). 0378-1135/$ – see front matter ß 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.vetmic.2009.11.009

resistance genes from animal to human microbiota led to the rescinded approval for antibiotics as animal feed supplements in the European Economic Union beginning January 1, 2006 (Kamphues, 1999). This ban of antibiotic feed supplements has focused increasing attention on the development of alternative feed supplements. Aluminosilicates (Al2SiO5) are a major component of clay minerals such as zeolite, bentonite and clinoptilolite (Pavelic´ et al., 2001). A series of Al2SiO5, especially zeolite, have been extensively used in various kinds of area, based on their capacities as catalysts, ion exchangers, and

118

B.-G. Jung et al. / Veterinary Microbiology 143 (2010) 117–125

adsorbents (Chan and Radom, 2008; Hui and Chao, 2008; Chutia et al., 2009). It is also well-known that such minerals possess a number of beneficial biological activities, in particular the reduction of intestinal disease-related diarrhoea in swine, calves and rats (Rodriguez-Fuentes et al., 1997). In addition, Al2SiO5 improve nutrient digestibility in growing-finishing pigs (Chen et al., 2005). Of particular relevance to the present study, Al2SiO5 have an important role in regulating the immune system. Previous studies have reported that Al2SiO5 act as nonspecific immunostimulators similar to superantigens (Ueki et al., 1994; Aikoh et al., 1998). Superantigens are class of extremely potent T cell mitogens (Tomai et al., 1990), and have high affinity to regions of major histocompatibility complex class II molecules (Mollick et al., 1989). Indeed, proinflammatory macrophages, which belong to MHC class II antigen presenting cells, are activated by fibrogenic silicate (SiO2) particulates (Holian et al., 1997). Martin et al. (1997) have also reported that silicate mineral particles engulfed by phagocytosis stimulate production of reactive oxygen species. Other immune enhancing effects of clay mineral particles include activation of mitogen-activated protein kinases (MAPK), protein kinase C and stress-activated protein kinases in affected cells have been reported (Lim et al., 1997), and they also enhance the expression of proinflammatory cytokines such as interleukin (IL)-1a, IL-6 and tumor necrosis factor (TNF)-a (Simeonova et al., 1997). These collective observations suggest that Al2SiO5 have potential as a new alternative feed supplements for the promotion of immune activity and prevention of diseases, especially subclinical and immunosuppressive diseases. Porcine circovirus type 2 (PCV2), member of the Circoviridae family, is non-enveloped virus with a singlestranded circular DNA genome (Tischer et al., 1982). PCV2 infection is widespread and may occur subclinically (Rodriguez-Arrioja et al., 2000). Particularly, infection with PCV2 has been associated with postweaning multisystemic wasting syndrome (PMWS) in young weaned pigs (Allan et al., 1999; Rosell et al., 1999). PMWS affected pigs show progressive weight loss, fever and enlarged lymph nodes (Allan and Ellis, 2000), and are more prone to develop concomitant infectious diseases (Segale´s et al., 2004). Therefore, PCV2-associated diseases, especially PMWS, may be an immunosuppressive disease (Ellis et al., 2004; Segale´s et al., 2005; Kekarainen et al., 2008). The aims of the present study were to evaluate the immune enhancing effects of dietary Al2SiO5 supplement (DAS) in mice, and to demonstrate the clearance effects of DAS against PCV2 in experimentally infected pigs as an initial step towards the development of an feed supplements for the promotion of immune activity and prevention of diseases, especially in pigs. To these aims, the present study evaluated several immunological criteria including relative mRNA expression level of cytokines in mice splenocytes, phagocytic activity of peritoneal polymorphonuclear leucocytes (PMNs) in mice and antibody production level in mouse serum. In addition, quantification of PCV2 genomes was also performed in nasal swabs, serum and tissues of experimentally infected pigs.

2. Materials and methods 2.1. Source and composition of feed supplements DAS marketed under the name of Sol to Bio was provided by Seobong Biobestech (Seoul, Korea). The feed supplement is comprised mainly of SiO2 (61.90%), Al2O3 (23.19%), Fe2O3 (3.97%) and Na2O (3.36%). 2.2. Animals and diets Specific pathogen-free female 6-week-old BALB/c mice (DBL, Chungbuk, Korea) were used to evaluate immune enhancing effects of DAS. The mice were randomized into three groups. The control group received a commercial, nutritionally complete, extruded dry rodent feed (Superfeed, Gangwon, Korea). The experiment groups received the same rodent feed supplemented with either 0.1% DAS (w/w; 0.1% DAS feeding group) or 0.3% (w/w; 0.3% DAS feeding group). Each feeding group had three replications with 5 mice each for individual studies described in Sections 2.3–2.6. Conventional 6-week-old pigs (Daehan Livestock & Feed, Seoul, Korea) were used to demonstrate clearance effects of DAS against experimental PCV2 infection. Prior to purchase, sera of the littermates were tested and confirmed to be negative for the presence of antibodies to PCV2 by enzyme-linked immunosorbent assay (ELISA) (Nawagitgul et al., 2002) and negative for the presence of viremia by real-time polymerase chain reaction (PCR) (Olvera et al., 2004). They were randomized into two groups of three pigs each. The control group received a commercial, nutritionally complete, swine feed (Daehan Livestock & Feed). The experiment group received the same swine feed supplemented with 0.3% DAS (w/w; 0.3% DAS feeding group). All animals were housed in an air-controlled separate room, and allowed free access to diet and tap water. All animal procedures were conducted in accordance with the guidelines of the local ethical committee (Chonnam National University). 2.3. Evaluation of relative mRNA expression level of IFN-g, IL4 and TNF-a in mice splenocytes stimulated by phytohemagglutinin All mice were fed with each particular diet for 4 weeks and then were sacrificed for collection of the spleen. Splenocytes were isolated under sterile conditions as previously described (Cho et al., 2000). The cells were resuspended to 5  106 cells/ml in RPMI-1640 (Lonza, Basel, Switzerland) and incubated at 37 8C in an atmosphere of 5% CO2 for 4 h with 1 mg/ml phytohemagglutinin (PHA) (Invitrogen, Carlsbad, CA, USA). Total RNA was extracted using an RNeasy Mini Kit (Qiagen, Valencia, CA, USA) and target RNA was reverse transcribed using superscript II reverse transcriptase enzyme (Invitrogen) according to the manufacturer’s instructions. To minimize variations in reverse transcriptase efficiency, all samples were transcribed simultaneously. Primers and probes for murine interferon (IFN)-g, IL-4, TNF-a and beta (b)-actin

B.-G. Jung et al. / Veterinary Microbiology 143 (2010) 117–125

119

Table 1 Primer and probe sequences for murine cytokines and PCV2 real-time PCR. Length (bp)a

Sequence (50 –30 )

Accessionb

IFN-g

FW RV TP

TCAAGTGGCATAGATGTGGAAGAA TGGCTCTGCAGGATTTTCATG TCACCATCCTTTTGCCAGTTCCTCCAG

92

IL-4

FW RV TP

ACAGGAGAAGGGACGCCAT GAAGCCCTACAGACGAGCTCA TCCTCACAGCAACGAAGAACACCACA

95

M25892 X05253

TNF-a

FW RV TP

CATCTTCTCAAAATTCGAGTGACAA TGGGAGTAGACAAGGTACAACCC CACGTCGTAGCAAACCACCAAGTGGA

175

M13049 Y00467

b-Actin

FW RV TP

AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT CACTGCCGCATCCTCTTCCTCCC

148

FW RV TP

CCAGGAGGGCGTTGTGACT CGCTACCGTTGGAGAAGGAA AATGGCATCTTCAACACCCGCCTCT

PCV2

K00083 M74466 M28381

V01217 J00691 99

AF465211

FW, forward primer; RV, reverse primer; TP, TaqMan probe dual-labeled with 50 FAM (report dye) and 30 TAMRA (quencher dye); IFN-g, interferon-gamma; IL-4, interleukin-4; TNF-a, tumor necrosis factor-alpha; b-actin, beta-actin; PCV2, porcine circovirus type 2. a Amplicon length in base pairs. b Genbank accession number of cDNA and corresponding gene available online at http://www.ncbi.nlm.nih.gov/.

were designed as previously described (Overbergh et al., 1999); their sequences are shown in Table 1. The probes were dual-labelled with the reporter dye 6-carboxyfluorescein (FAM) at the 50 end and the quencher dye 6carboxytetramethyrhodamine (TAMRA) at the 30 end. IFNg, IL-4 and TNF-a mRNA levels were determined by a realtime PCR assay using a Rotor-gene 6000 (Corbett Research, Sydney, Australia) with 0.5 mg of cDNA. The threshold cycle (Ct; the cycle number at which the amount of amplified gene of interest reaches a fixed threshold) was determined subsequently. Relative quantitation of IFN-g, IL-4 and TNF-a mRNA expression was calculated by a comparative Ct method as previously described (Livak and Schmittgen, 2001). The relative quantitation value of target (IFN-g, IL-4 or TNF-a) was normalized to an endogenous control b-actin gene and relative to a calibrator. It was DD expressed as 2 Ct (fold), where DCt = Ct of target gene  Ct of endogenous control gene and DDCt = DCt of samples for target gene  DCt of the calibrator for the target gene. 2.4. Evaluation of phagocytic activity of mice peritoneal PMNs by luminol-dependent chemiluminescence All mice were fed with their particular diet for 4 weeks. PMNs were harvested by lavage with phosphate buffered saline (PBS) from the mice 2 days after the intraperitoneal injection of 1 mg of chicken egg white albumin (Sigma– Aldrich, St. Louis, MO, USA). The cells were washed with Hank’s balanced salt solution (HBSS). Chemiluminescence was measured with a 96-well Orion microplate luminometer (Berthold Detection Systems, Pforzheim, Germany) as previous described (Kubo et al., 1987) with some modification. Briefly, samples for chemiluminescence were obtained by the addition of 2  106 PMN with phorbol-12-myristate-13-acetate (PMA; 1 mg/ml) to a polystyrene LumiNunc 96-well Plate (Nunc, Roskilde,

Denmark) containing luminol (5-amino-2,3-dihydro-1,4phthalazinedione; 6  105 M) and 110 ml HBSS. The plate was placed in the luminometer and chemiluminescence was measured as relative light units (RLU) in the dark for 20 min in 2 min intervals. 2.5. Measurement of antibody production level in mice serum after antigen inoculation regimen All mice were acclimatized to the particular diet for a week before the first inoculation with formalin-killed Pasteurella multocida type A (The National Veterinary Research & Quarantine Service, Gyeonggi, Korea). Each mouse received two intraperitoneal injections (0.3 ml each time) with a 2-week interval between injections. The first inoculation was given with Freund’s complete adjuvant (Sigma–Aldrich) on day 7 and the second with Freund’s incomplete adjuvant (Sigma–Aldrich) on day 21. Blood samples were individually collected in microcentrifuge tubes from the retro-orbital plexus on day 28. Serum was obtained by centrifugation and separated serum was inactivated at 56 8C for 30 min. In addition, spleens were also collected for determination of lymphocyte subpopulation. Antibody production level was measured by ELISA. Briefly, 96-well plates (Iwaki, Tokyo, Japan) were coated with 100 ml of a solution containing 20 mg whole formalinkilled P. multocida type A (used as antigen) in 1 ml of 0.1 M carbonate–bicarbonate buffer (pH 9.6) and left overnight at 4 8C. After three washes with PBS containing 0.05% Tween 20 (PBS-T), the wells were saturated with 200 ml of 5% skim milk (Becton Dickinson, Sparks, MD, USA). After incubation for 2 h at room temperature, wells were washed three times with PBS-T. Inactivated serum samples were diluted 1:160 with PBS-T. The diluted serum samples were added to the each well and incubated at room temperature for 1 h. After three washes with PBS-T, 100 ml of a solution of a 1:5000 dilution of horseradish peroxidase-conjugated

120

B.-G. Jung et al. / Veterinary Microbiology 143 (2010) 117–125

goat anti-mouse IgG (Sigma–Aldrich) was added to each well. After incubation at room temperature for 1 h, the plates were washed and 100 ml of substrate consisting of 0.05 M citrate buffer (pH 4.0), 2-20 -azino-bis(3-ethyl benzthiazoline-6-sulfonic acid) (ABTS; Bio basic, Markham, ON, Canada) and 30% hydrogen peroxide was added to the each wells. After incubation for 10 min at room temperature in the dark, the reaction was stopped with 5% sodium dodecyl sulfate (Applichem, Darmstadt, Germany). Reactions were read at an absorbance of 405 nm using an ELISA plate reader (Thermo Labsystems, Helsinki, Finland). Each sample was tested in duplicate. 2.6. Determination of lymphocyte subpopulation in spleen after antigen inoculation regimen Spleen was obtained and splenocytes were isolated under sterile condition as previously described (Cho et al., 2000). Isolated cells were analyzed to determine T cell (CD3+/CD19) and B cell (CD3/CD19+) component ratio. Briefly, the cells were stained with both phycoerythrin (PE)-conjugated anti-mouse CD3 (BD Biosciences, Franklin Lakes, NJ, USA) and fluorescein isothiocyanate (FITC)conjugated anti-mouse CD19 (BD Biosciences). After incubation at room temperature for 15 min in the dark, the cells were washed twice with PBS and the lymphocyte subpopulation analyzed using a FACSort flow cytometer (BD Biosciences). For data acquisition, 10,000 events were collected in list mode for each sample tube. After setting a lymphocyte gate on the forward/side scatter (FSC/SSC) dot plot, 5000 lymphocyte events were acquired. Paint-a-Gate software (BD Biosciences) was used to analyze immunophenotypic subpopulations in this FSC/SSC lymphocyte gate and statistics were obtained by software analysis for CD3+/CD19 and CD3/CD19+ subpopulations. Results for each lymphocyte subpopulation were expressed as percentages of events in the FSC/SSC lymphocyte gate. 2.7. Quantification of PCV2 genomes in experimentally infected pigs using quantitative real-time PCR All pigs were acclimatized to the particular diet for 2 weeks before experimental virus infection. The PCV2 used in the present study was originally isolated from a pig with naturally occurring PMWS (The National Veterinary Research & Quarantine Service). PCV2 viral challenge utilized PK-15 cells. Five milliliters of the viral culture (1  107 copy numbers/ml, dose optimized previously) was inoculated intranasally in each nostril of each pig. Blood samples and nasal swabs were collected at 9, 14, 21 and 28 days post-infection (DPI). Lymphoid tissues (bronchial lymph node, superficial inguinal lymph node, tonsil, thymus, mesenteric lymph node and spleen) and lung were also collected at post-mortem examination. DNA extraction from collected samples was performed using the Accuprep genomic DNA extraction kit (Bioneer, Seoul, Korea) according to the manufacturer’s instructions. DNA extracts were used for quantification of PCV2 genomes by optimized realtime PCR as previously described (Olvera et al., 2004). Prior to quantification of PCV2 genomes in collected samples, PCV2 real-time PCR standard was setup. Briefly, a PCV2

genome was cloned in the pGEM-T Easy vector (Promega, Madison, WI, USA) after PCR amplification with following primers: forward, 50 -AGC AGG GCC AGA ATT CAA CC-30 and reverse, 50 -CGT TAC CGC AGA AGA AGA CA-30 (Genebank accession number: AF465211), and was transformed in Escherichia coli JM109 competent cells (Invitrogen). The plasmid was purified using a Qiaprep Spin Miniprep Kit (Qiagen) and quantified with a model ND-1000 apparatus (Nanodrop Technologies, Wilmington, DE, USA). PCV2 plasmid was mixed with swine DNA extracted from a PCV2 PCR-negative blood sample. Ten-fold dilutions of this mixture (from 109 to 104 PCV2 copy numbers/ml) were used as standard for PCV2 quantitation of diagnostic samples. Based on the above quantitation standard, real-time PCR for quantitation of PCV2 genomes was performed using a Rotorgene 6000 (Corbett Research). Briefly, primers and probes sequences are shown in Table 1. The probes were duallabelled with the FAM reporter dye at the 50 end and the TAMRA quencher dye 6-carboxytetramethyrhodamine at the 30 end. Amplification was carried out under universal cycling conditions (10 min at 95 8C, 2 min at 50 8C and 40 cycles of 15 s at 95 8C, 1 min at 60 8C). 2.8. Histopathologic analysis in tissues of experimentally PCV2-infected pigs Tissue samples of lymphoid tissues (bronchial lymph node, superficial inguinal lymph node, tonsil, thymus, mesenteric lymph node and spleen) and lung from all of pigs collected at each necropsy were fixed in 10% neutralbuffered formalin, embedded in paraffin, sectioned (5 mm thickness), and stained with hematoxylin and eosin (H&E) for histopathological examination. Microscopic lesions were evaluated using a previously described scoring system (Opriessnig et al., 2004) as follows. Sections of lymphoid tissues were evaluated for the presence of lymphoid depletion ranging from 0 to 3 (0, normal; 1, mild lymphoid depletion with loss of overall cellularity; 2, moderated lymphoid depletion; 3, severe lymphoid depletion with loss of lymphoid follicle structure) and presence of inflammation ranging from 0 to 3 (0, normal; 1, mild histiocytic-togranulomatous inflammation; 2, moderate histiocytic-togranulomatous inflammation; 3, severe histiocytic-togranulomatous inflammation with replacement of follicles). Microscopic lesion severity score in sections of lymphoid tissues was defined as the sum of the individual scores of both parameters. Sections of lung were scored for presence and severity of type 2 pneumocyte hypertrophy and hyperplasia, alveolar septal infiltration with inflammatory cells, peribronchial lymphoid hyperplasia, amount of alveolar exudate, and amount of inflammation in the lamina propria of bronchi and bronchioles ranging from 0 to 6 (0, normal; 1, mild multifocal; 2, mild diffuse; 3, moderate multifocal; 4, moderate diffuse; 5, severe multifocal; 6, severe diffuse). All histological evaluations were performed in a blinded fashion. 2.9. Statistical analysis The data were expressed as mean  standard deviation (SD). A paired Student’s t-test was performed for statistical

B.-G. Jung et al. / Veterinary Microbiology 143 (2010) 117–125

analysis of the data. Particularly, a Mann–Whitney U-test (nonparametric test) was used to statistical analysis of microscopic lesion score (ordinal data) in tissues of experimentally infected pigs with PCV2. All statistical analysis of data performed using SPSS version 17.0 software (SPSS, Chicago, IL, USA). P < 0.05 was considered as the level of significance. 3. Results 3.1. Relative mRNA expression level of IFN-g, IL-4 and TNF-a in PHA-stimulated mice splenocytes Relative mRNA expression levels of IFN-g, IL-4 and TNFa in mouse splenocytes were measured after stimulation by PHA for 4 h. The relative mRNA expression levels of IFNg significantly increased in the 0.1% and 0.3% DAS feeding groups compared with the control group (P < 0.001 and P < 0.01, respectively), although no significant difference was observed between the 0.1% DAS feeding group and the 0.3% DAS feeding group. The relative mRNA expression levels of IL-4 significantly increased in the DAS feeding groups compared with in the control group in a dosedependent manner (P < 0.01, control vs. 0.1% DAS feeding group; P < 0.01, control vs. 0.3% DAS feeding group; P < 0.01, 0.1% DAS feeding group vs. 0.3% DAS feeding group). The relative mRNA expression levels of TNF-a also significantly increased in the DAS feeding groups compared with in the control group in a dose-dependent manner (P < 0.05, control vs. 0.1% DAS feeding group; P < 0.05, control vs. 0.3% DAS feeding group; P < 0.05, 0.1% DAS feeding group vs. 0.3% DAS feeding group) (Fig. 1).

Fig. 1. Relative mRNA expression levels of IFN-g, IL-4 and TNF-a in splenocytes after stimulation with PHA. The relative mRNA expression levels of IFN-g significantly increased in the 0.1% and 0.3% DAS feeding groups compared with in the control group (***P < 0.001 and **P < 0.01, respectively), although no significant difference was observed between the 0.1% DAS feeding group and the 0.3% DAS feeding group. The relative mRNA expression levels of IL-4 significantly increased in the DAS feeding groups compared with in the control group in a dose-dependent manner (**P < 0.01, control vs. 0.1% DAS feeding group; **P < 0.01, control vs. 0.3% DAS feeding group; ##P < 0.01, 0.1% DAS feeding group vs. 0.3% DAS feeding group). The relative mRNA expression levels of TNF-a also significantly increased in the DAS feeding groups compared with in the control group in a dose-dependent manner (*P < 0.05, control vs. 0.1% DAS feeding group; *P < 0.05, control vs. 0.3% DAS feeding group; #P < 0.05, 0.1% DAS feeding group vs. 0.3% DAS feeding group). For each group, data represents the mean  SD (n = 5).

121

3.2. Phagocytic activity of mice peritoneal PMNs When peritoneal PMNs of all groups were exposed to PMA, light emission immediately increased to a maximal peak at 2 min, and then gradually decreased to the basal level (under the beginning RLU level) by 10 min. However, negative control (no PMN) displayed RLU under the basal level during the whole detection period (data not shown). The RLU significantly increased in the DAS feeding groups compared with the control group in a dose-dependent manner at maximal peak time (P < 0.05, control vs. 0.1% DAS feeding group; P < 0.01, control vs. 0.3% DAS feeding group; P < 0.01, 0.1% DAS feeding group vs. 0.3% DAS feeding group) (Fig. 2). 3.3. Antibody production level in mice serum and spleen lymphocyte subpopulation following antigen administration Antibody production level (OD value) (Fig. 3a) and B cell ratio (Fig. 3b) of the 0.3% DAS feeding group were significantly increased compared to those of the control group (P < 0.05), although no significant difference was observed between the control group and the 0.1% DAS feeding group. 3.4. Viral clearance in experimentally PCV2-infected pigs The load of viral genome in nasal swabs of the 0.3% DAS feeding group was 9.39% and 16.57% lower at 14 and 21 DPI, respectively, than those of the control group (Fig. 4a). This reduction in the viral genome load reached statistical significance at 28 DPI (P < 0.05) (Fig. 4a). A similar result was obtained in serum samples (Fig. 4b). The viral genome load in lungs of the 0.3% DAS feeding group was significantly decreased compared with those of the control group at post-mortem examination (P < 0.05) (Fig. 5). Moreover, the viral genome load in almost all

Fig. 2. Effects of DAS on phagocytic activity of peritoneal PMNs. Mouse PMNs stimulated with PMA (1 mg/ml), and phagocytic activity were measured as RLU using luminol-dependent chemiluminescence. RLU significantly increased in the DAS feeding groups compared with in the control group in a dose-dependent manner at maximal peak time (at 2 min) (*P < 0.05, control vs. 0.1% DAS feeding group; **P < 0.01, control vs. 0.3% DAS feeding group; ##P <0.01, 0.1% DAS feeding group vs. 0.3% DAS feeding group). For each group, data represents the mean  SD (n = 5).

122

B.-G. Jung et al. / Veterinary Microbiology 143 (2010) 117–125

Fig. 3. Effects of DAS on antibody production level in mouse serum (a) and lymphocyte subpopulation ratio in mouse spleen (b) after the antigen administration regimen. Mice received two intraperitoneal injections of formalin-killed P. multocida type A. ELISA serum antibody titer were determined at 405 nm and ratio of lymphocyte subpopulation was analyzed by flow cytometry. Serum antibody titer and B cell (CD19+) ratio in the 0.3% DAS feeding group significantly increased than in the control group (P < 0.05), although no significant difference was observed between the control group and the 0.1% DAS feeding group. For each group, data represents the mean  SD (n = 5).

tested lymphoid tissues of the 0.3% DAS feeding group showed a tendency to decrease compared with the control group at post-mortem examination, although the difference was not significant (bronchial lymph node, P = 0.08; superficial inguinal lymph node, P = 0.07; tonsil, P = 0.14; thymus, P = 0.09; mesenteric lymph node, P = 0.44; spleen, P = 0.08) (Fig. 5). 3.5. Histopathologic analysis in tissues of experimentally PCV2-infected pigs Experimentally PCV2-infected pigs showed interstitial pneumonia characterized by type 2 pneumocyte hypertrophy and hyperplasia, and alveolar wall thickening by macrophages and lymphocytes. These lesions in the 0.3% DAS feeding group were milder (Fig. 5b) compared with in the control group (Fig. 5a). Additionally, the 0.3% DAS feeding group showed less severe lymphoid depletion and more clear separation between cortex and medulla in thymus (Fig. 5d) compared with the control group (Fig. 5c). The microscopic lesion scores in the collected tissue samples are shown in Fig. 5e. Pigs in the 0.3% DAS feeding

Fig. 4. Viral clearance effects of DAS against PCV2 in experimentally infected pigs. To quantify PCV2 genomes, nasal swab (a) and serum (b) were collected at 9, 14, 21 and 28 DPI, and lymphoid tissues samples (c) (bronchial lymph node (BLN), superficial inguinal lymph node (ILN), tonsil (TON), thymus (THY), mesenteric lymph node (MLN), spleen (SPL) and lung (LUN) were also collected at post-mortem examination. The load of PCV2 genomes in nasal swabs and serum samples gradually decreased in the 0.3% DAS feeding group compared with in the control group from 14 to 21 DPI. This reduction in the viral genome load reached statistical significance at 28 DPI (*P < 0.05). The viral genome load in lung of the 0.3% DAS feeding group significantly decreased compared with in those of the control group at post-mortem examination (*P < 0.05). In figure (a) and (b), values are expressed as mean logarithm of PCV2 genomes (copies/ml) SD of three pigs in each group. In figure (c), each point represents individual logarithm of PCV2 genomes (copies/g), and each line represents the mean value of three pigs in each group.

group showed a significant decrease in lung microscopic lesion scores compared with the control group (P < 0.05). Moreover, microscopic lesion score in thymus of pigs in the 0.3% DAS feeding group also showed a tendency to

B.-G. Jung et al. / Veterinary Microbiology 143 (2010) 117–125

123

Fig. 5. Histopathological features of lung and thymus, and microscopic lesion scores of tissue samples in experimental PCV2-infected pigs. Mild interstitial pneumonia was evident in lungs of pigs in the 0.3% DAS feeding group (b) compared with in those of the control group (a). Additionally, the 0.3% DAS feeding group shown less severe lymphoid depletion and more clear separation between cortex (C: yellow letter) and medulla (M: yellow letter) in thymus (d) compared with the control group (c). The 0.3% DAS feeding group showed a significant decrease in lung microscopic lesion scores compared with the control group (P < 0.05) (e). Each point represents individual logarithm of PCV2 genomes (copies/g), and each line represents the mean value of three pigs in each group.

decrease compared with the control group, although in this instance the difference was not significant (P = 0.068). 4. Discussion In the present study, relative mRNA expression levels of IFN-g, IL-4 and TNF-a produced mainly by T cell and macrophages were significantly increased in splenocytes of mice in the DAS feeding groups compared with in those of control group after stimulation by PHA. These results imply that continuous ingestion of DAS markedly reinforces mitogenicity and immune activity of T cells and macrophages. This may relate to previous studies that reported that Al2SiO5 act as nonspecific immunostimulators (Ueki et al., 1994; Aikoh et al., 1998). In addition, Martin et al. (1997) have reported that silicate mineral

particles engulfed by phagocytic cells such as macrophages in airway epithelium and these macrophages release large amounts of TNF-a. These findings also relate to the present study. Therefore, DAS particles also might be engulfed by phagocytic cells in intestinal membrane and these cells may be circulated or localized in lymphoid tissues. Phagocytic cells emit light while ingesting microorganisms and other particles (Allen et al., 1972). Chemiluminescence can, therefore, be used to assay for phagocytic cellular function (Stjernholm et al., 1973). The present study conducted luminol-dependent chemiluminescence analysis to examine whether DAS could increase phagocytic activity of PMNs. The dose-dependent significantly increased RLU in the DAS feeding groups compared with in the control group indicates that the phagocytic activity of PMNs is enhanced by ingestion of DAS. This is consistent

124

B.-G. Jung et al. / Veterinary Microbiology 143 (2010) 117–125

with the results of in vitro and ex vivo studies that showed the immune enhancing effects on direct interaction between Al2SiO5 mineral particles and MHC class II antigen presenting cells such as macrophages (Holian et al., 1997; Martin et al., 1997). Antibody titer is the indicator reflecting the state of humoral immunity (Yang et al., 2008). Hence, to evaluate effects of DAS on humoral immunity in mice, the present study measured antibody production level in serum of mice after an antigen administration regimen. Antibody production level significantly increased in the 0.3% DAS feeding group compared with the control group, although no significant difference was observed between the control group and the 0.1% DAS feeding group. This indicates that humoral immunity is enhanced by ingestion of DAS in mice. Moreover, B cell (CD19+) ratio in spleen also significantly increased in the 0.3% DAS feeding group compared with in the control group after two times antigen administration regimen. This result implies that enhanced humoral immunity related to B cell stimuli by ingestion of DAS in mice. The above beneficial effects of DAS on immune activity in mice led us to test clearance effects of DAS against PCV2, which leads to subclinical and immunosuppressive diseases (Rodriguez-Arrioja et al., 2000; Ellis et al., 2004; Segale´s et al., 2005; Kekarainen et al., 2008), in experimentally infected pigs. The PCV2 genome load in nasal swabs and serum samples gradually decreased in the 0.3% DAS feeding group compared with the control group from 14 to 21 DPI. This reduction in viral genome load reached statistical significance at 28 DPI. Moreover, these phenomenons were identified in almost all tested lymphoid tissues and lung at post-mortem examination, although in lymphoid tissues the difference was not significant. Additionally, histopathological analysis revealed that the 0.3% DAS feeding groups showed mild and less severe abnormal changes compared with the control group. These results indicate that ingestion of DAS reinforces clearance of PCV2 in experimentally infected pigs. This may relate to general immune enhancing effects of DAS in mice. Taken together, these findings suggest that DAS enhances immune activity in mice and reinforces clearance of PCV2 in experimentally infected pigs. Hence, DAS may be good candidate for new alternative feed supplements, especially in pigs. However, the present study did not investigate the efficacy of DAS on immune responses in the swine model. Additionally, the exact mechanisms of DAS on virus clearance were not determined. Therefore, precise knowledge of efficacy and mechanisms of DAS on immune responses and virus clearances is required in the swine model. In addition, confirmation of the PCV2 clearance effects of DAS is required in pigs with naturally occurring PCV2-associated diseases including PMWS. Acknowledgements The authors acknowledge a graduate fellowship from the Korean Ministry of Education and Human Resources Development through the Brain Korea 21 project. This study was supported by Technology Development Program for Agriculture and Forestry, Ministry for Agriculture,

Forestry and Fisheries, Republic of Korea and the CNU Specialization Grant funded by Chonnam National University. References Aikoh, T., Tomokuni, A., Matsukii, T., Hyodoh, F., Ueki, H., Otsuki, T., Ueki, A., 1998. Activation-induced cell death in human peripheral blood lymphocytes after stimulation with silicate in vitro. Int. J. Oncol. 12, 1355–1359. Allan, G.M., Ellis, J.A., 2000. Porcine circoviruses: a review. J. Vet. Diagn. Invest. 12, 3–14. Allan, G.M., McNeilly, F., Meehan, B.M., Kennedy, S., Mackie, D.P., Ellis, J.A., Clark, E.G., Espuna, E., Saubi, N., Riera, P., Botner, A., Charreyre, C.E., 1999. Isolation and characterisation of circoviruses from pigs with wasting syndromes in Spain, Denmark and Northern Ireland. Vet. Microbiol. 66, 115–123. Allen, R.C., Stjernholm, R.L., Steele, R.H., 1972. Evidence for the generation of an electronic excitation state(s) in human polymorphonuclear leukocytes and its participation in bactericidal activity. Biochem. Biophys. Res. Commun. 47, 679–684. Chan, B., Radom, L., 2008. Zeolite-catalyzed hydrogenation of carbon dioxide and ethene. J. Am. Chem. Soc. 130, 9790–9799. Chen, Y.J., Kwon, O.S., Min, B.J., Shon, K.S., Cho, J.H., Kim, I.H., 2005. The effects of dietary Biotite V supplementation of growth performance, nutrients digestibility and fecal noxious gas content in finishing pigs. Asian-Aust. J. Anim. Sci. 18, 1147–1152. Cho, J.Y., Baik, K.U., Jung, J.H., Park, M.H., 2000. In vitro anti-inflammatory effects of cynaropicrin, a sesquiterpene lactone, from Saussurea lappa. Eur. J. Pharmacol. 398, 399–407. Chutia, P., Kato, S., Kojima, T., Satokawa, S., 2009. Adsorption of As(V) on surfactant-modified natural zeolites. J. Hazard. Mater. 162, 204–211. Cromwell, G.L., 2002. Why and how antibiotics are used in swine production. Anim. Biotechnol. 13, 7–27. Ellis, J., Clark, E., Haines, D., West, K., Krakowka, S., Kennedy, S., Allan, G.M., 2004. Porcine circovirus-2 and concurrent infections in the field. Vet. Microbiol. 98, 159–163. Holian, A., Uthman, M.O., Goltsova, T., Brown, S.D., Hamilton, R.F., 1997. Asbestos and silica-induced changes in human alveolar macrophage phenotype. Environ. Health Perspect. 105, 1139–1142. Hui, K.S., Chao, C.Y., 2008. Methane emissions abatement by multi-ionexchanged zeolite A prepared from both commercial-grade zeolite and coal fly ash. Environ. Sci. Technol. 42, 7392–7397. Kamphues, J., 1999. Antibiotic growth promoters for the view of animal nutrition. Berl. Munch. Tierarztl. Wochenschr. 112, 370–379. Kekarainen, T., Montoya, M., Mateu, E., Segale´s, J., 2008. Porcine circovirus type 2-induced interleukin-10 modulates recall antigen responses. J. Gen. Virol. 89, 760–765. Kubo, A., Sasada, M., Nishimura, T., Moriguchi, T., Kakita, T., Yamamoto, K., Uchino, H., 1987. Oxygen radical generation by polymorphonuclear leucocytes of beige mice. Clin. Exp. Immunol. 70, 658–663. Lim, Y., Kim, S.H., Kim, K.A., Oh, M.W., Lee, K.H., 1997. Involvement of protein kinase C, phospholipase C, and protein tyrosine kinase pathways in oxygen radical generation by asbestos-stimulated alveolar macrophages. Environ. Health Perspect. 105, 1325–1327. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(Delta Delta C(T)) method. Methods 25, 402–408. Martin, L.D., Krunkosky, T.M., Dye, J.A., Fischer, B.M., Jiang, N.F., Rochelle, L.G., Akley, N.J., Dreher, K.L., Adler, K.B., 1997. The role of reactive oxygen and nitrogen species in the response of airway epithelium to particulates. Environ. Health Perspect. 105, 1301–1307. Mollick, J.A., Cook, R.G., Rich, K.R., 1989. Class II MHC molecules are specific receptors for Staphylococcus enterotoxin A. Science 224, 817–820. Nawagitgul, P., Harms, P.A., Morozov, I., Thacker, B.J., Sorden, S.D., Lekcharoensuk, C., Paul, P.S., 2002. Modified indirect porcine circovirus (PCV) type 2-based and recombinant capsid protein (ORF2)-based enzyme-linked immunosorbent assays for detection of antibodies to PCV. Clin. Diagn. Lab. Immun. 9, 33–40. Olvera, A., Sibila, M., Calsamiglia, M., Segale´s, J., Domingo, M., 2004. Comparison of porcine circovirus type 2 load in serum quantified by a real time PCR in postweaning multisystemic wasting syndrome and porcine dermatitis and nephropathy syndrome naturally affected pigs. J. Virol. Methods 117, 75–80. Overbergh, L., Valckx, D., Waer, M., Mathieu, C., 1999. Quantification of murine cytokine mRNAs using real time quantitative reverse transcriptase PCR. Cytokine 11, 305–312.

B.-G. Jung et al. / Veterinary Microbiology 143 (2010) 117–125 Opriessnig, T., Thacker, E.L., Yu, S., Fenaux, M., Meng, X.J., Halbur, P.G., 2004. Experimental reproduction of postweaning multisystemic wasting syndrome in pigs by dual infection with Mycoplasma hyopneumoniae and porcine circovirus type 2. Vet. Pathol. 41, 624–640. Pavelic´, K., Hadzija, M., Bedrica, L., Pavelic´, J., Dikic´, I., Katic´, M., Kralj, M., Bosnar, M.H., Kapitanovic´, S., Poljak-Blazi, M., Krizanac, S., Stojkovic´, R., Jurin, M., Subotic´, B., Colic´, M., 2001. Natural zeolite clinoptilolite: new adjuvant in anticancer therapy. J. Mol. Med. 78, 708–720. Rodriguez-Arrioja, G.M., Segale´s, J., Balasch, M., Rosell, C., Quintana, J., Folch, J.M., Plana-Duran, J., Manakerttz, A., Domingo, M., 2000. Serum antibodies to porcine circovirus type 1 (PCV1) and type 2 (PCV2) in pigs with and without postweaning multisystemic wasting syndrome (PMWS). Vet. Rec. 146, 762–764. Rodriguez-Fuentes, G., Barrios, M.A., Iraizoz, A., Perdomo, I., Cedre, B., 1997. Enterex: anti-diarrheic drug based on purified natural clinoptilolite. Zeolites 19, 441–448. Rosell, C., Segale´s, J., Plana-Duran, J., Balasch, M., Rodriguez-Arrioja, G.M., Kennedy, S., Allan, G.M., McNeilly, F., Latimer, K.S., Domingo, M., 1999. Pathological, immunohistochemical, and in-situ hybridization studies of natural cases of postweaning multisystemic wasting syndrome (PMWS) in pigs. J. Comp. Pathol. 120, 59–78.

125

Segale´s, J., Allan, G.M., Domingo, M., 2005. Porcine circovirus diseases. Anim. Health Res. Rev. 6, 119–142. Segale´s, J., Domingo, M., Chianini, F., Majo´, N., Domı´nguez, J., Darwich, L., Mateu, E., 2004. Immunosuppression in postweaning multisystemic wasting syndrome affected pigs. Vet. Microbiol. 98, 151–158. Simeonova, P., Torium, W., Kommineni, C., Erkan, M., Muson, A.E., Rom, W.N., Luster, M.I., 1997. Molecular regulation of IL-6 activation by asbestos in lung epithelial cells-role of reactive oxygen species. J. Immunol. 159, 3921–3928. Stjernholm, R.L., Allen, R.C., Steele, R.H., Waring, W.W., Harris, J.A., 1973. Impaired chemiluminescence during phagocytosis of opsonized bacteria. Infect. Immun. 7, 313–314. Tischer, I., Gelderblom, H., Vettermann, W., Koch, M.A., 1982. A very small porcine virus with circular single-stranded DNA. Nature 295, 64–66. Tomai, M., Kotb, M., Majumdar, G., Beachey, E.H., 1990. Superantigenicity of streptococcal M protein. J. Exp. Med. 172, 359–362. Ueki, A., Yamaguchi, M., Ueki, H., Watanabe, Y., Ohsawa, G., Kinugawa, K., Kawakami, Y., Hyodoh, F., 1994. Polyclonal human T-cell activation by silicate in vitro. Immunology 82, 332–335. Yang, L., Hu, Y., Xue, J., Wang, F., Wang, D., Kong, X., Li, P., Xu, W., 2008. Compound Chinese herbal medicinal ingredients can enhance immune response and efficacy of RHD vaccine in rabbit. Vaccine 26, 4451–4455.