Dietary macronutrient content affects inflammatory and fibrotic factors in normal and obstructed bladders

Life Sciences 210 (2018) 192–200

Contents lists available at ScienceDirect

Life Sciences journal homepage: www.elsevier.com/locate/lifescie

Dietary macronutrient content affects inflammatory and fibrotic factors in normal and obstructed bladders

T

⁎

Temitope Gabriel Adedejia,c, , Emiola Oluwabunmi Olapade-Olaopab,c a

Department of Physiology, School of Health and Health Technology, Federal University of Technology, Akure, Nigeria Urology Division, Department of Surgery, College of Medicine, University of Ibadan, Nigeria c PIUTA Ibadan Centre, Department of Surgery, University of Ibadan, University College Hospital, Ibadan, Nigeria b

A R T I C LE I N FO

A B S T R A C T

Keywords: Diet C-reactive protein CXCL12 NGF CTGF HIF-1α TGF-β Collagen

Aims: To investigate the effects of diets on factors and markers of inflammation and fibrosis in unobstructed and obstructed bladders of male Wistar rats. Materials and methods: Partial BOO was surgically induced in twelve-week old rats after feeding on different diets for eight (8) weeks. Feeding continued for 4 weeks after surgery. Rats were divided into sham-operated and BOO groups as follow: control, high-carbohydrate (HCD), high-fat (HFD) and high-protein (HPD). After the feeding period, bladder weight, CRP, nerve growth factor (NGF), tissue growth factor-β (TGF-β), connective tissue growth factor (CTGF), hypoxia inducible factor-1α (HIF-1 α), platelet-derived growth factor-A (PDGF-A) and CXCL12 were all determined. Key findings: In both unobstructed and obstructed bladders, CRP was increased in animals fed on the HFD (P < 0.05). NGF was increased in animals fed on HFD and HPD but decreased only in HCD-BOO. CXCL12 was increased in animals fed on HFD and HPD (P < 0.05) and decreased in HCD. The HCD-BOO group exhibited a decrease in CXCL12, while CXCL12 increased in HFD-BOO. TGF-β was elevated in HFD and all the dietary-BOO groups, but animals with obstructed bladders fed on the HPD and HCD had significant reduction in TGF-β expression. CTGF was increased in HFD- and HPD-fed animals. HIF-1α, PDGF-A and collagen were increased in both HFD dietary groups and HPD-BOO. Significance: Feeding on a high fat diet results in increased activity of factors and mediators of inflammation and fibrosis in both unobstructed and obstructed rat bladders. This might increase predisposition to or further worsen symptoms in BOO.

1. Introduction Diet affects human health, and nutritionally-poor diets play a crucial role in the mechanisms involved in many diseases [1]. Obesity and metabolic syndrome result from consumption of high-calorie diets. Diets high in fats and carbohydrates, which are commonly consumed because of their palatability, directly result in these conditions with high intake [1]. Metabolic syndrome is a major factor in the aetiology of lower urinary tract symptoms (LUTS) in the bladder, increasing the incidence and also aggressiveness of the symptoms [2]. Documented evidence show that diet and nutr*ition could have an effect on the aetiology of LUTS, even though there is a dearth of literature on this [3,4]. Also, the composition and amount of macronutrients consumed in diet have been described as factors in lower urinary tract functions [5,6].

⁎

A common cause of LUTS is bladder outlet obstruction (BOO), a major cause of morbidity in urology, especially in adult males [7]. In spite of its high morbidity and negative impact on the quality of life (QoL) of affected individuals, the pathophysiological mechanisms involved in this condition are still poorly understood [8]. However, it has been shown that progression of this condition to an end-stage bladder is a complex biochemical pathway involving inflammation and fibrosis [9]. Inflammation has been implicated in various disease conditions, [10,11,12], and there are many mediators of inflammation in the bladder, but of particular note are chemokines and growth factor activity [13,14]. Serum levels of C-reactive protein increase when chronic inflammation occurs in the body, and show a correlation with LUTS [15]. Chemokines, such as CXCL12, are mediators of immune responses and inflammatory processes. The influence these chemokines exert on

Corresponding author at: Department of Physiology, Federal University of Technology, Akure, Nigeria. E-mail address: [email protected] (T.G. Adedeji).

https://doi.org/10.1016/j.lfs.2018.08.069 Received 21 June 2018; Received in revised form 23 August 2018; Accepted 30 August 2018 Available online 04 September 2018 0024-3205/ © 2018 Elsevier Inc. All rights reserved.

Life Sciences 210 (2018) 192–200

T.G. Adedeji, E.O. Olapade-Olaopa

– Group 5: Sham-operated rats fed on a High Fat diet (HFD) (22% protein, 13.5% carbohydrates, 60% fat, and 4.5% crude fibre) – Group 6: BOO animals fed on a High Fat diet (HFD) (22% protein, 13.5% carbohydrates, 60% fat, and 4.5% crude fibre) – Group 7: Sham-operated rats fed on a High Protein diet (HPD) (55% protein, 25.5% carbohydrates, 15% fat, and 4.5% crude fibre) – Group 8: BOO animals fed on a High Protein diet (HPD) (55% protein, 25.5% carbohydrates, 15% fat, and 4.5% crude fibre)

inflammation in the bladder has been reported [13,15]. When administered exogenously, chemokines induce thermal hyperalgesia and mechanical allodynia [16,17]. Another mediator of inflammation, Nerve Growth Factor (NGF), is responsible for proper growth and maintenance of sensory neurons. Increased levels of this factor have been reported in patients with idiopathic detrusor overactivity, neurogenic bladder and chronic bladder inflammation [18]. It is believed to play a major role in neuro-immune interactions, tissue inflammation, and also in neuroplasticity. Increased levels in the bladder usually result in increased bladder sensation and hyperactivity [19]. In obstructed bladders, increased pressure leads to various pathophysiological changes, including hyperplasia and hypertrophy of smooth muscle, increase in extracellular matrix storage, degradation of the collagen structure, increased activity of different growth factors etc. [20,21]. In murine models of BOO, transforming growth factor-beta (TGF-β) and connective tissue growth factor (CTGF) have been reported to be increased [22]. These changes eventually cause detrusor hypertrophy, elevated voiding pressure and detrusor instability, resulting in a pathologically decompensated detrusor [22]. Bladder outlet obstruction has also been reported to cause ischaemic and hypoxic changes in the bladder, which increase concentrations of Hypoxia Inducible Factor-1α and Platelet-Derived Growth Factor-A (PDGF-A) [23]. We hypothesized that diet could have an effect on the progression of inflammation and fibrosis by altering concentrations of growth factors and other mediators in both the obstructed and unobstructed bladder. We therefore assessed different factors associated with bladder inflammation and fibrosis in animals fed on diets of different macronutrient compositions.

The animals were fed for a period of 8 weeks, after which partial bladder outlet obstruction was induced in them surgically. Subsequently, they were fed for 4 weeks after induction. 2.3. Induction of bladder outlet obstruction Twelve (12) hours prior to surgery, animals were fasted but allowed free access to drinking water. Anaesthesia was induced using ketamine (75 mg/kg ip) and xylazine (15 mg/kg ip). The bladder was approached through a lower midline incision which was used to expose the proximal urethra. A 3-0 Novafil (monofilament polybutester; Davis & Geck, Wayne, NJ) ligature was placed around the urethra and tied while a steel rod was placed in the lumen to create partial obstruction of the outlet. After the knot was tied, the steel rod was removed, the bladder repositioned, and the abdominal wall was closed. Sham-operated rats underwent the same procedure, however, no suture was placed around the urethra. 2.4. Preparation of tissue samples for ELISA

2. Materials and methods

Rats were sacrificed with isoflurane (4%), after which a thoracotomy was performed to remove the bladder, which was weighed and then solubilized in tissue protein extraction reagent (1 g tissue/20 ml; Pierce Biotechnology, Woburn, MA) after which it was treated with protease inhibitor cocktail tablets (Roche, Indianapolis, IN). The tissue was then homogenized and then centrifuged at 10,000 rpm for 10 min. The resulting supernatant was subsequently used for CXCL12 protein quantification. Total protein was determined using the Pierce™ Coomassie Plus (Bradford) Assay Kit (ThermoFisher Scientific, UK). CXCL12 was quantified using standard 96-well ELISA plates (R&D Systems, Minneapolis, MN) according to the manufacturer's recommendations.

2.1. Animals A total of eighty (80) twelve-week old male albino rats of the Wistar strain were used in this study. The animals were obtained from the Animal House of the College of Medicine, University of Ibadan, Nigeria. All studies were approved by the University of Ibadan Animal Ethics Committee. The animals were divided into eight (8) dietary and BOO groups of ten animals each and were housed in well-aerated experimental animal cages, maintained under standard lighting conditions. They were acclimatised for 7 days prior to commencement of the grouping. During this period, they were fed on standard rat chow (Ladokun feeds, Nigeria Limited) and had access to clean drinking water.

2.5. Estimation of plasma C - reactive protein, bladder tissue NGF and CXCL12 concentrations Serum was separated from blood collected from rats and assayed for serum C-reactive protein (CRP). Urinary bladder was removed under anaesthesia blotted dry weighed and then homogenized for 1 min and centrifuged at 33,000 rpm for 1 h. Bradford assay was performed to determine the total protein in each sample, then the homogenate was concentrated using a protein concentrator (Millipore, Billerica, MA). Commercially-available rat CRP, NGF and CXCL12 ELISA kits (Merck KGaA, Darmstadt, Germany) were procured and used in accordance with manufacturer's protocols and instructions.

2.2. Experimental design Animal feeds were mixed from individual feed constituents in particular compositions for each of the dietary groups. The mixes were then pelletised to ensure even distribution of components and consumption by animals. The control diet was derived from standard rats' feeds commercially-propounded and sold by Ladokun feeds. Each of the experimental diets was formulated by altering the proportion of components supplying each macronutrient in the original standard feed. Adequate nutritional requirements were ascertained and essential amino acids were added to the feeds to prevent under-nutrition. These were then fed to the animals as follows:

2.6. RT-PCR for TGF-β, CTGF, HIF-1α and PDGF-A Total RNA was extracted from bladder samples and DNAse digestion performed for 60 min to remove any contamination by genomic DNA. First strand cDNA synthesis was carried out using a cDNA synthesis kit (Merck KGaA, Darmstadt, Germany) at 42 °C using 500 ng total RNA extract. Real-time RT-PCR was conducted using Power SYBR® Green PCR Master Mix (ABI, Foster, CA, USA) in a 25-μL tube with a total reaction volume of 25 μL containing 1 μL of a 1:2 dilution of first-strand reaction product, 0.2 μM gene-specific upstream and downstream primers (Table 1). Amplification and analysis of cDNA fragments was

– Group 1: Sham-operated rats fed on normal rats' chow (26.5% protein, 40% carbohydrates, 29% fat, and 4.5% crude fibre) – Group 2: BOO animals fed on normal rats' chow – Group 3: Sham-operated rats fed on a High Carbohydrate Diet (HCD) (20% protein, 58.5% carbohydrates, 17% fat, and 4.5% crude fibre) – Group 4: BOO rats fed on a High Carbohydrate Diet (HCD) (20% protein, 58.5% carbohydrates, 17% fat, and 4.5% crude fibre) 193

Life Sciences 210 (2018) 192–200

T.G. Adedeji, E.O. Olapade-Olaopa

Table 1 PCR primer sequences. Factor

Forward

Reverse

TGFβ1 CTGF HIF-1α PDGF-A

CCGCAACAACGCAATCTA TGACCTGGAGGAAAACATTAAGA GTTTACTAAAGGACAAGTCACC CACACCTCCTCGCTGTAGTATTTA

TGAGGAGCAGGAAGGGTC AGCCCTGTATGTCTTCACACTG TTCTGTTTGTTGAAGGGAG GTTATCGGTGTAAATGTCATCCAA

HPD with obstruction, all showed significant gain in weight (P < 0.05). Both HCD and HPD-fed animals with obstructed bladders had reductions in bladder weight when compared individually with the positive (BOO) control.

carried out using a 7300 real-time PCR system (ABI). Cycling conditions were initial denaturation at 95 °C for 3 min, followed by 40 cycles consisting of a 15-s denaturation interval at 95 °C and a 30 s interval for annealing and primer extension at 60 °C. Amplification of the housekeeping gene β-actin mRNA was used to normalize the results. The mRNA levels were measured as cycle threshold levels and normalized with the individual β -actin control cycle threshold values. Altered mRNA levels in pBOO bladder are expressed as fold changes.

3.2. C-reactive protein In animals without obstruction fed the HFD, serum concentrations of C-reactive protein were significantly increased (P < 0.05) within 4 weeks when compared with the control. The HFD also reflected an increase in obstruction in comparison with the control (Fig. 2).

2.7. Bladder collagen content Bladder collagen content was determined by liquid chromatography/mass spectrometry of 4-hydroxyproline from the frozen samples. An internal standard (N-methyl-L-proline) and 6 M HCl solution were added to pre-weighed bladder tissue and each sample was then hydrolysed overnight at 115 °C. The O-butyl ester derivatives were prepared with 10% BF2-butanol for 30 min at 120 °C after drying the hydrolysate. Liquid chromatography (column: Eclipse XDB-C18)/mass spectrometry analysis was performed on a Hewlett-Packard (series 1100, Atlanta, GA) mass selective detector monitoring the ions at m/z 186 and 188. Results are expressed as μg hydroxyproline per mg of dry sample weight.

3.3. Nerve growth factor Animals with obstruction fed the standard rats' chow showed a significant increase (P < 0.05) in bladder tissue nerve growth factor in comparison with control animals without obstruction (Fig. 3). High fat diet (HFD)-feeding in rats resulted in increased nerve growth factor concentrations, in both unobstructed and obstructed bladders. High protein (HPD) diets also increased bladder tissue nerve growth level even without obstruction, and also in obstructed bladders. 3.4. CXCL12

2.8. Data analysis The concentration of CXCL12 in the bladder was significantly increased (P < 0.05) in BOO by the 4th week when compared with the control group. This was also significantly increased in HFD-fed animals, even without obstruction. HFD rats with BOO had a significant increase in CXCL12, way beyond the increase observed in the obstruction control. The HPD-fed rats with BOO also exhibited an increase in CXCL12 level in comparison to the unobstructed control by the 4th week (Fig. 4). The HCD reflected a decrease in concentration of CXCL12 in both unobstructed and obstructed bladders.

Data obtained were expressed as mean ± standard error of mean (mean ± SEM). The significance of the results was evaluated using analysis of variance (ANOVA) and the means were compared using Tukey-Kramer Multiple comparison Test. P < 0.05 was regarded as statistically significant. 3. Results 3.1. Bladder weight

3.5. TGF-β1 Bladder weight was measured and results are shown in Fig. 1. In individual comparisons with the control animals, the bladders of the obstructed control animals, unobstructed and obstructed HFD rats, and 600

Tissue growth factor-β activity was elevated in the obstructed bladder in comparison with the control. This was also observed in all *

*

Bladder Weight (mg)

500 400

*#

300

*# *

200 100 0 CONTROL CONTROL +BOO

HCD

HCD + BOO

HFD

HFD+BOO

HPD

HPD+BOO

Fig. 1. Diet-induced changes in bladder weight in unobstructed and obstructed rats' bladders. Values are mean ± SEM for 10 animals per dietary group. P < 0.05.* = significant in comparison to control. # = significant in comparison to BOO (positive) control. 194

Life Sciences 210 (2018) 192–200

T.G. Adedeji, E.O. Olapade-Olaopa

*

*

Fig. 2. Diet-induced changes in plasma C-reactive protein concentration in unobstructed and obstructed rats' bladders. Values are mean ± SEM for 10 animals per dietary group. P < 0.05.* = significant in comparison to control.

3.8. PDGF-A

the dietary-BOO groups, however, there was a significant elevation in expression of this factor in unobstructed HFD-fed rats (Fig. 5). Animals with obstructed bladders fed on the HPD and HCD had significant reduction in TGF-β expression on individual comparison with the obstructed (positive) control.

Platelet-derived growth factor-A was significantly increased in the obstructed bladder control, and both HFD dietary groups (unobstructed and obstructed bladders) in individual comparison with the control (Fig. 8). The HCD and HPD individually had decreases in PDGF-A when compared with the positive (BOO) control.

3.6. CTGF 3.9. Collagen content Connective tissue growth factor (CTGF) mRNA expression was increased in the obstruction control, and also in HFD- and HPD-fed animals (both unobstructed and obstructed bladder groups) in individual comparison with the control. There was however significant elevation in HFD-fed rats (both unobstructed and obstructed bladder groups) when compared individually with the obstructed control (Fig. 6).

Collagen content was significantly increased in bladders of obstructed (positive) control rats when compared with the control (Fig. 9). A similar increase was observed with high-fat feeding in both the obstructed and the unobstructed bladder. Only the obstructed bladder group showed an increase in HPD-fed animals. However, on individual comparison with the obstructed bladder control, the bladders of the HFD-BOO animals had higher collagen content, while HCD-BOO showed a reduction.

3.7. HIF-1α The BOO-control rats showed an increase in HIF-1α expression in comparison with the control. This elevation was also reflected in both HFD dietary groups (obstructed and unobstructed bladder), however only the HFD-BOO animals had a significant increase when compared with the obstructed bladder control (Fig. 7). The HCD and HPD both had a decrease in HIF-1α expression when individually compared with the positive (BOO) control.

4. Discussion Bladder outlet obstruction is characterised by progressive tissue remodelling of the bladder which results in functional impairments, progressing through three consecutive stages, namely: hypertrophy, compensation and decompensation [24]. This condition triggers inflammation in the bladder, which is responsible for the eventual

Fig. 3. Diet-induced changes in nerve growth factor concentration in unobstructed and obstructed rats' bladders. Values are mean ± SEM for 10 animals per dietary group. P < 0.05. * = significant in comparison to control. 195

Life Sciences 210 (2018) 192–200

T.G. Adedeji, E.O. Olapade-Olaopa

*#

*#

Fig. 4. Diet-induced changes in CXCL12 concentration in unobstructed and obstructed rats' bladders. Values are mean ± SEM for 10 animals per dietary group. P < 0.05. * = significant in comparison to control. # = significant in comparison to BOO (positive) control.

Fig. 5. Diet-induced changes in TGF-β mRNA expression in unobstructed and obstructed rats' bladders. Values are mean ± SEM for 10 animals per dietary group. P < 0.05. * = significant in comparison to control. # = significant in comparison to BOO (positive) control.

High serum CRP levels are associated with storage LUTS, and suggest the presence of chronic inflammation in men with this condition in BOO [26]. Baer and coworkers [27] have provided evidence that dietary fatty acids can modulate markers of inflammation in healthy

decompensation of the bladder in the chronic state, due to activation of fibrosis [25]. The observed increase in bladder weight in positive control animals in which BOO was induced attests to the efficacy of the method, and shows that partial BOO was properly induced.

Fig. 6. Diet-induced changes in CTGF mRNA expression in unobstructed and obstructed rats' bladders. Values are mean ± SEM for 10 animals per dietary group. P < 0.05. * = significant in comparison to control. # = significant in comparison to BOO (positive) control. 196

Life Sciences 210 (2018) 192–200

T.G. Adedeji, E.O. Olapade-Olaopa

Fig. 7. Diet-induced changes in HIF-1α concentration in unobstructed and obstructed rats' bladders. Values are mean ± SEM for 10 animals per dietary group. P < 0.05. * = significant in comparison to control. # = significant in comparison to BOO (positive) control.

Fig. 8. Diet-induced changes in PDGF-A mRNA expression in unobstructed and obstructed rats' bladders. Values are mean ± SEM for 10 animals per dietary group. P < 0.05. * = significant in comparison to control. # = significant in comparison to BOO (positive) control.

feeding resulted in elevations of NGF concentrations in both unobstructed and obstructed animals. It is worthy to note that the elevation in the HFD-fed animals were significantly greater in the obstructed groups in individual comparison with the unobstructed bladder. The observed inflammation in the bladder with these diets would result in altered NGF concentrations in the bladder and morphological changes in both sensory and motor neurons that innervate the bladder [32]. NGF and trophic factors may then participate in other changes associated with bladder hypertrophy, especially by sensitising afferent nerves thereby causing bladder hyperactivity [33]. Afferent neurons supplying the bladder demonstrate significant plasticity in response to obstruction [34]. Neurons innervating the bladder acquire increased neurotrophins and they respond with growth. The neural growth is postulated to affect reflex function, perhaps contributing to lower reflex thresholds and altered visceromotor function [35]. All of these would result in overactivity of the bladder which would further worsen the effects of the LUTS arising due to the obstruction. The observation in the HFD and HPD-fed rats suggest that these diets could cause these even in normal bladders, while HFD further worsens the hyperactivity

humans fed controlled diets. A positive correlation between consumption of saturated fats and plasma biomarkers of inflammation has also been reported [28]. Our study showed CRP was significantly increased by the HFD in both unobstructed and obstructed animals. The results obtained from this study suggest that HFD consumption results in chronic inflammation in animals with obstructed bladders, but even in those with obstructed bladders. This implies that in obstructed bladders, LUTS could be caused by a fatty diet, typically escalating the effects of the obstruction. Dynamic interactions occur between a tissue and its nerve supply, which have been attributed to the action of molecular messengers such as nerve growth factor (NGF) [29], a factor found in the bladder. Nerve growth factor induces differentiation and survival of neurons and is produced from the bladder via protein kinase C- and protein kinase Adependent intracellular pathways which have both physiological and pathophysiological roles in the lower urinary tract [30]. This growth factor is linked to mechanical stretch and reflex activity in the bladder [31]. In this study, bladder tissue NGF concentrations were increased in obstructed bladders fed only the control diet, however, HFD and HPD 197

Life Sciences 210 (2018) 192–200

T.G. Adedeji, E.O. Olapade-Olaopa

Fig. 9. Diet-induced changes in collagen content of bladder in unobstructed and obstructed rats' bladders. Values are mean ± SEM for 10 animals per dietary group. P < 0.05. * = significant in comparison to control. # = significant in comparison to BOO (positive) control.

cause the deposition of matrix by stimulating cells to increase the synthesis of matrix proteins, decreasing the production of proteases that degrade the matrix, increasing production of protease inhibitors, and also modulating the expression of integrins thereby increasing cellular adhesion to matrix [46]. In the pathophysiology of BOO and impaired bladder response to obstruction, TGF-β1 have long been shown to play a critical role [47], however, we report that observable decreases occurred in obstructed bladders of animals fed with the HCD and HPD. Conversely, bladders of HFD-fed animals reflected high TGF-β1 values seen in obstruction. Similarly, CTGF is another factor whose levels have been reported to be increased at the early stages of the bladder's response to stretch in BOO [48] and also affects development of fibrosis in the bladder [49], by increasing collagen and extracellular matrix deposition [50]. Levels of this factor were also high in obstructed bladders across diets, with the exception of the HCD. As with TGF, the HFD again resulted in high CTGF level, consistent with inflammation and fibrosis in the bladder. In its progression, BOO also induces hypoxia in the bladder [51], which elevates concentrations of HIF-1α and PDGF-A [52]. Our study reports high levels of these factors with HFD-feeding, even without obstruction. Mechanical stretch, which occurs in BOO, and is a factor in hypertrophy, has been reported to up-regulate PDGF [53], and increases in PDGF have been shown to have a direct relationship with hypertrophy [54], however, results from this study reveal that fatty diets could also induce production of this factor in the bladder. PDGF is a potent mitogen released in high concentrations during tissue repair and inflammatory processes [55]. Studies have shown that there is a relationship between HIF-1α and CTGF, as it was reported that HIF-1α deficient mice were unable to produce CTGF after hypoxia [52]. This would account for the high CTGF values reported earlier in animals fed with the HFD. Increased collagen deposition in obstructed bladders is a result of all the different activities described in preceding paragraphs. Consistent with these findings, increased collagen deposition, as observed in obstructed bladders of animals fed both the HFD and HPD, would cause increased fibrosis and pathological remodelling of the bladder. Again, the HFD seems to be able to induce these changes even in the unobstructed bladder. Interestingly, the HCD maintained the integrity of the bladder in spite of obstruction. The observed increases in hydroxyproline in these dietary groups is probably due to decompensation,

in obstructed bladders. The ingestion of a HFD similar to dietary obesity could also induce inflammation in both the peripheral and the central nervous system through an increase in the production of small proteins called the chemokines [36,37]. Chemokine CXCL12, has diverse effects on the function of different neuronal cell types in the brain. This chemokine exerts its function by binding to CXCR4 receptor, although another receptor, CXCR7 is now also considered a receptor for CXCL12 binding [38]. It is increasingly clear that the CXCL12/CXCR4 axis is an emerging neuromodulator in pathological pain [39,40]. A study reported an increase in CXCL12 in bladder-associated DRG neurons that were isolated from animals that had undergone experimentally-induced sciatic nerve injury which resulted in increased frequency of micturition and visceral pain hypersensitivity [41]. The results of this study reveal a relationship between the CXCL12 system and diet. CXCL12 in the PVN, acting through CXCR4, mimics the molecular and behavioral effects of HFD [42]. Thus, increases in CXCL12 expression with BOO would result in a vicious cycle resulting in obesity-induced inflammation and increased pain during voiding. In this study, obstruction induced an increase in CXCL12 activity, however the HFD and HPD groups showed an increase in even normal bladders. Greater increases were observed in obstructed bladders, which could be adduced to the effects of the obstruction. However, the concentration of CXCL12 was elevated in the bladders of HFD-fed animals with obstructed bladders beyond that observed in those with obstructed bladders fed on the control diet. This implies an increase in inflammation due to diet, which could worsen LUTS further in obstructed bladders and also reduce the pain threshold during micturition. Apart from NGF, other growth factors have been implicated in the pathogenesis of BOO for a long time [43]. Transforming growth factorβ is a key cytokine involved in initiation and termination of tissue repair, a factor whose continued production is a major factor in development of tissue fibrosis [44]. It is a multifunctional cytokine from platelets with three isoforms, TGF-β1, 2, and 3. The TGF-β1 gene is upregulated in response to tissue injury, and TGF-β1 is the isoform most implicated in fibrosis [45]. TGF-β elevation observed in this study was constant in all obstructed dietary groups, which would be consistent with the development of inflammation and fibrosis in the animals' bladders. Accumulation of extracellular matrix in tissues is the main feature of fibrotic diseases, and TGF-β1 elevation in these groups would 198

Life Sciences 210 (2018) 192–200

T.G. Adedeji, E.O. Olapade-Olaopa

which results in an increase in the relative proportion of collagen in bladder tissue [9]. As the bladder progresses in this decompensation phase, the hydroxyproline content increases progressively, resulting in a pathological deposition of collagen [9]. The implication of this is that the bladder loses most of its normal architecture, with the muscle being replaced by fibrosis, and therefore loses its special characteristics by which it can store large volumes without a corresponding increase in pressure, a critical factor in the bladder's storage and voiding activities [9]. It is important to note that consumption of a high carbohydrate-rich diet seems to have a beneficial effect on the obstructed bladder. When compared individually with the obstructed control animals, animals with obstructed bladders consistently had a reduction in bladder weight, NGF, CXCL12, TGF-β, CTGF, HIF-1α, PDGF-A, and collagen content. This would suggest an improvement of bladder status at the point of progression into decompensation. Further studies would be required to determine the mechanisms responsible for this observed effect of carbohydrates on weight, inflammation and hypoxia in the bladder.

[17] S.B. Oh, P.B. Tran, S.E. Gillard, R.W. Hurley, D.L. Hammond, R.J. Miller, Chemokines and glycoprotein120 produce pain hypersensitivity by directly exciting primary nociceptive neurons, J. Neurosci. 21 (2001) 5027–5035. [18] E.M. Lowe, P. Anand, G. Terenghi, R.E. Williams-Chestnut, D.V. Sinicropi, J.L. Osborne, Increased nerve growth factor levels in the urinary bladder of women with idiopathic sensory urgency and interstitial cystitis, Br. J. Urol. 79 (1997) 572–577. [19] W.D. Steers, Pathophysiology of overactive bladder and urge urinary incontinence, Rev. Urol. 4 (2002) S7–18. [20] G. Capolicchio, K.J. Aitken, J.X. Gu, P. Reddy, D.J. Bägli, Extracellular matrix gene responses in a novel ex vivo model of bladder stretch injury, J. Urol. 165 (6 Pt 2) (2001) 2235–2240. [21] C.A. Peters, M.R. Freeman, C.A. Fernandez, J. Shepard, D.G. Wiederschain, M.A. Moses, Dysregulated proteolytic balance as the basis of excess extracellular matrix in fibrotic disease, Am. J. Phys. 272 (6 Pt 2) (1997) R1960–R1965. [22] S. Mittra, S. Malhotra, K.S. Naruganahalli, A. Chugh, Role of peripheral 5-HT1A receptors in detrusor over activity associated with partial bladder outlet obstruction in female rats, Eur. J. Pharmacol. 561 (2007) 189–193. [23] K.-E. Andersson, D.B. Boedtkjer, A. Forman, The link between vascular dysfunction, bladder ischemia, and aging bladder dysfunction, Ther. Adv. Urol. 9 (1) (2017) 11–27. [24] F. Fusco, M. Creta, C. De Nunzio, et al., Progressive bladder remodeling due to bladder outlet obstruction: a systematic review of morphological and molecular evidences in humans, BMC Urol. 18 (2018) 15. [25] F.M. Hughes Jr., S.J. Sexton, H. Jin, V. Govada, J.T. Purves, Bladder fibrosis during outlet obstruction is triggered through the NLRP3 inflammasome and the production of IL-1β, Am. J. Physiol. Ren. Physiol. 313 (3) (2017 Sep 1) F603–F610. [26] S.-F. Hung, S.-D. Chung, H.-C. Kuo, Increased serum C-reactive protein level is associated with increased storage lower urinary tract symptoms in men with benign prostatic hyperplasia, PLoS One 9 (2014) e85588. [27] D.J. Baer, J.T. Judd, B.A. Clevidence, R.P. Tracy, Dietary fatty acids affect plasma markers of inflammation in healthy men fed controlled diets: a randomized crossover study, Am. J. Clin. Nutr. 79 (2004) 969–973. [28] T.T. Fung, E.B. Rimm, D. Spiegelman, N. Rifai, G.H. Tofler, W.C. Willett, et al., Association between dietary patterns and plasma biomarkers of obesity and cardiovascular disease risk, Am. J. Clin. Nutr. 73 (2001) 61–67. [29] E.M. Johnson, I.A. Ferguson, Nerve growth factor, in: R.A. Rush (Ed.), Nerve Growth Factors, John Wiley & Sons, New York, 1989, pp. 213–240. [30] R. Tanner, P. Chambers, M.H. Khadra, J.I. Gillespie, The production of nerve growth factor by human bladder smooth muscle cells in vivo and in vitro, BJU Int. 85 (2000) 1115–1119. [31] D.B. Clemow, W.D. Steers, J.B. Tuttle, Stretch-activated signalling of nerve growth factor secretion in bladder and vascular smooth muscle cells from hypertensive and hyperactive rats, J. Cell. Physiol. 183 (2000) 289–300. [32] M.C. Dupont, J.M. Spitsberegen, K.B. Kim, J.B. Tuttle, W.D. Steers, Histological and neurotrophic changes triggered by varying models of bladder inflammation, J. Urol. 166 (2000) 1111–1118. [33] M.A. Vizzard, Changes in urinary bladder neurotrophic factor mRNA and NGF protein following urinary bladder dysfunction, Exp. Neurol. 161 (2000) 273–284. [34] W.D. de Groat, M. Kawatani, T. Hisamitsu, C.-L. Chenc, C.-P. Ma, K. Thor, et al., Mechanisms underlying the recovery of urinary bladder function following spinal cord injury, J. Auton. Nerv. Syst. 30 (1990) 571–578. [35] W.D. Steers, S. Kolbeck, D. Creedon, J.B. Tuttle, Nerve growth factor in the urinary bladder of the adult regulates neuronal form and function, J. Clin. Invest. 88 (1991) 1709–1715. [36] N. Barbarroja, R. Lopez-Pedrera, M.D. Mayas, E. Garcia-Fuentes, L. GarridoSanchez, M. Macias-Gonzalez, et al., The obese healthy paradox: is inflammation the answer? Biochem. J. 430 (2010) 141–149. [37] M.F. Gregor, G.S. Hotamisligil, Inflammatory mechanisms in obesity, Annu. Rev. Immunol. 29 (2011) 415–445. [38] A. Levoye, K. Balabanian, F. Baleux, F. Bachelerie, B. Lagane, CXCR7 heterodimerizes with CXCR4 and regulates CXCL12-mediated G protein signaling, Blood 113 (2009) 6085–6093. [39] X. Luo, W.L. Tai, L. Sun, Q. Qiu, Z. Xia, S.K. Chung, et al., Central administration of C-X-C chemokine receptor type 4 antagonist alleviates the development and maintenance of peripheral neuropathic pain in mice, PLoS One 9 (2014) e104860. [40] W. Shen, J. Chen, T. Zhu, L. Chen, W. Zhang, Z. Fang, et al., Intra-articular injection of human meniscus stem/progenitor cells promotes meniscus regeneration and ameliorates osteoarthritis through stromal cell-derived factor-1/CXCR4-mediated homing, Stem Cells Transl. Med. 3 (2014) 387–394. [41] R. Foster, J. Jung, A. Farooq, C. McClung, M.S. Ripsch, M.P. Fitzgerald, et al., Sciatic nerve injury induces functional pro-nociceptive chemokine receptors in bladder-associated primary afferent neurons in the rat, Neuroscience 183 (2011) 230–237. [42] K. Poon, J.R. Barson, H.T. Ho, S.F. Leibowitz, Relationship of the chemokine, CXCL12, to effects of dietary fat on feeding-related behaviors and hypothalamic neuropeptide systems, Front. Behav. Neurosci. 10 (2016) 51. [43] L.S. Baskin, R.S. Sutherland, A.A. Thomson, S.W. Hayward, G.R. Cunha, Growth factors and receptors in bladder development and obstruction, Lab. Investig. 75 (1996) 157–166. [44] W.A. Border, E. Ruoslahti, Transforming growth factor-β in disease: the dark side of tissue repair, J. Clin. Invest. 90 (1992) 1–7. [45] A. Biernacka, M. Dobaczewski, N.G. Frangogiannis, TGF-β signaling in fibrosis, Growth Factors 29 (5) (2011) 196–202 (Chur, Switzerland). [46] A.B. Roberts, M.B. Sporn, The transforming growth factors-β, in: M.B. Sporn, A.B. Roberts (Eds.), Peptide Growth Factors and their Receptors. Vol. 95 of

5. Conclusion Dietary macronutrients influence many growth factors and mediators involved in inflammation and fibrosis in the bladder. High intake of HFD increases the activities of many of these factors resulting in changes in the bladder, especially changes due to fibrosis and abnormal collagen deposition. This is also true with obstruction of the bladder, although the HCD seems to resist these changes in obstructed bladders. Acknowledgements This work was supported by the PAUSA Initiative for Urological Training in Africa (PIUTA). References [1] T.G. Adedeji, A.A. Fasanmade, E.O. Olapade-Olaopa, An association between diet, metabolic syndrome and lower urinary tract symptoms, Afr. J. Urol. 22 (2016) 61–66. [2] H. Ito, O. Yokoyama, Metabolic syndrome and lower urinary tract symptoms, World J. Clin. Urol. 3 (2014) 330–335. [3] H. Araki, H. Watanabe, T. Mishina, M. Nakao, High-risk group for benign prostatic hypertrophy, Prostate 4 (1983) 253–264. [4] P. Lagiou, J. Wuu, A. Trichopoulou, C.C. Hsieh, H.O. Adami, D. Trichopoulos, Diet and benign prostatic hyperplasia: a study in Greece, Urology 54 (1999) 284–289. [5] W.C. Willett, Nutrition Epidemiology, second ed., Oxford University Press, New York, 1998. [6] H. Weisser, M. Krieg, Fatty acid composition of phospholipids in epithelium and stroma of human benign prostatic hyperplasia, Prostate 36 (1998) 235–243. [7] M.J. Speakman, X. Cheng, Management of the complications of BPH/BOO, Indian J. Urol. 30 (2) (2014) 208–213. [8] C.-L. Lee, H.-C. Kuo, Pathophysiology of benign prostate enlargement and lower urinary tract symptoms: current concepts, Tzu-Chi Med. J. 29 (2) (2017) 79–83. [9] P.D. Metcalfe, J. Wang, H. Jiao, Y. Huang, K. Hori, R.B. Moore, E.E. Tredget, Bladder outlet obstruction: progression from inflammation to fibrosis, BJU Int. 106 (11) (2010) 1686–1694. [10] E.H. Choy, G.S. Panayi, Cytokine pathways and joint inflammation in rheumatoid arthritis, N. Engl. J. Med. 344 (2001) 907–916. [11] G.K. Hansson, Inflammation, atherosclerosis, and coronary artery disease, N. Engl. J. Med. 352 (2005) 1685–1695. [12] R. De Caterina, A. Zampolli, From asthma to atherosclerosis—5-lipoxygenase, leukotrienes, and inflammation, N. Engl. J. Med. 350 (2004) 4–7. [13] P.L. Vera, K.A. Iczkowski, X. Wang, K.L. Meyer-Siegler, Cyclophosphamide-induced cystitis increases bladder CXCR4 expression and CXCR4-macrophage migration inhibitory factor association, PLoS One 3 (2008) e3898. [14] P. Zvara, M.A. Vizzard, Exogenous overexpression of nerve growth factor in the urinary bladder produces bladder overactivity and altered micturition circuitry in the lumbosacral spinal cord (Abstract), BMC Physiol. 7 (2007) 9. [15] Y.-C. Chuang, V. Tyagi, R.-T. Liu, M.B. Chancellor, P. Tyagi, Urine and serum Creactive protein levels as potential biomarkers of lower urinary tract symptoms, Urol. Sci. 21 (2010) 132–136. [16] T. Tanaka, M. Minami, T. Nakagawa, M. Satoh, Enhanced production of monocyte chemoattractant protein-1 in the dorsal root ganglia in a rat model of neuropathic pain: possible involvement in the development of neuropathic pain, Neurosci. Res. 48 (2004) 463–469.

199

Life Sciences 210 (2018) 192–200

T.G. Adedeji, E.O. Olapade-Olaopa

[47] [48]

[49]

[50]

[51] R.M. Levin, L.J. O'Connor, R.E. Leggett, C. Whitbeck, P. Chichester, Focal hypoxia of the obstructed rabbit bladder wall correlates with intermediate decompensation, Neurourol. Urodyn. 22 (2003) 156–163. [52] D. Haung, A. Adah, R. Richardson, C. Pierce, A. Whittington, T. Taylor, Defining the role of HIF-1α and CTGF in fibrosis – biomed 2009, Biomed. Sci. Instrum. 45 (2009) 340–345. [53] R.M. Adam, S.H. Eaton, C. Estrada, et al., Mechanical stretch is a highly selective regulator of gene expression in human bladder smooth muscle cells, Physiol. Genomics 20 (2004) 36–44. [54] R.M. Adam, J.A. Roth, H.L. Cheng, et al., Signaling through PI3K/Akt mediates stretch and PDGF-BB-dependent DNA synthesis in bladder smooth muscle cells, J. Urol. 169 (2003) 2388–2393. [55] D.J. Sánchez-González, E. Méndez-Bolaina, N.I. Trejo-Bahena, Platelet-rich plasma peptides: key for regeneration, Int. J. Pept. 2012 (2012) 532519.

Handbook of Experimental Pharmacology, Springer-Verlag, New York, 1990, pp. 419–472. M.W. Chen, R.M. Levin, R. Buttyan, Peptide growth factors in normal and hypertrophied bladder, World J. Urol. 13 (1995) 344–348. R. Yang, J. Amir, H. Liu, B. Chaqour, Mechanical strain activates a program of genes functionally involved in paracrine signaling of angiogenesis, Physiol. Genomics 36 (2008) 1–14. I. Chowdhury, B. Chaqour, Regulation of connective tissue growth factor (CTGF/ CCN2) gene transcription and mRNA stability in smooth muscle cells. Involvement of RhoA GTPase and p38 MAP kinase and sensitivity to actin dynamics, Eur. J. Biochem. 271 (2004) 4436–4450. V. Mezzano, D. Cabrera, C. Vial, E. Branden, Constitutively activated dystrophic muscle fibroblasts show a paradoxical response to TGF-beta and CTGF/CCN2, J. Cell Commun. Signal 1 (2007) 205–217.

200