Dietary mannan oligosaccharide ameliorates cyclic heat stress-induced damages on intestinal oxidative status and barrier integrity of broilers

Dietary mannan oligosaccharide ameliorates cyclic heat stress-induced damages on intestinal oxidative status and barrier integrity of broilers

College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, P. R. China ratio during finisher and entire periods, but decreased (P < 0.05) jejunal malondialdehyde concentration of heat-stressed broilers at 42 D. Heat stress decreased (P < 0.05) jejunal villus height (VH) and claudin-3 gene expression at 21 D, and VH and VH: crypt depth (CD) ratio in jejunum and ileum as well as mRNA abundances of jejunal mucin 2 and occludin, and ileal mucin 2, zonula occludens-1, and occludin, and claudin3 at 42 D, whereas increased (P < 0.05) serum D-lactate acid content at 21 and 42 D, and serum diamine oxidase activity and jejunal CD at 42 D. The MOS supplementation increased (P < 0.05) jejunal VH at 21 D, VH and VH: CD of jejunum and ileum at 42 D, mRNA abundances of jejunal occludin and ileal mucin 2, zonula occludens-1, and occludin at 42 D, whereas reduced (P < 0.05) ileal CD at 42 D. These results suggested that MOS improved growth performance, and oxidative status and barrier integrity in the intestine of broilers under cyclic heat stress.

ABSTRACT This study investigated protective effects of mannan oligosaccharide (MOS) inclusion on growth performance, intestinal oxidative status, and barrier integrity of cyclic heat-stressed broilers. A total of 240 one-day-old chicks were allocated into 3 treatments of 10 replicates each. Control broilers reared at a thermoneutral temperature were fed a basal diet, whereas broilers in heat stress and MOS groups raised at a cyclic high temperature (32 to 33◦ C for 8 h/d) were given the basal diet supplemented with 0 or 250 mg/kg MOS, respectively. Compared with control group, heat stress decreased (P < 0.05) average daily gain and feed conversion ratio during grower, finisher, and entire periods, average daily feed intake during finisher and entire periods, and ileal superoxide dismutase activity at 42 D, whereas increased (P < 0.05) rectal temperature at 21 and 42 D and jejunal malondialdehyde content at 42 D. Dietary MOS increased (P < 0.05) average daily gain, average daily feed intake, and feed conversion

Key words: mannan oligosaccharide, cyclic heat stress, antioxidant capacity, intestinal barrier function, broiler 2019 Poultry Science 0:1–10 http://dx.doi.org/10.3382/ps/pez192

INTRODUCTION

vital role in digestibility and adsorption of nutrients, as well as maintenance of structural barrier integrity of gut (Turner, 2009). Intestinal mucosal barrier consists of a single layer of tightly epithelial cells, largely joined together by junctional complexes including tight junctions (Turner, 2009; Shen et al., 2011). It builds a distinct network, not only regulating small molecule transport and intestinal epithelial cells permeability, but also protecting mucosal cells against harmful substances existing in luminal environment (Steed et al., 2010). However, heat stress could impair this intestinal barrier integrity of broilers as reported previously (Song et al., 2014; Varasteh et al., 2015; Zhang et al., 2017; Wu et al., 2018). There is a dire need of sustained researches that aims to ameliorate the adverse consequences of heat stress on animals, and dietary supplementation with prebiotics including functional oligosaccharides has attracted increasing attention (Sohail et al., 2010, 2012; Song et al., 2013; Varasteh et al., 2015). Mannan oligosaccharide (MOS), one of the functional oligosaccharides, is derived from yeast cell wall outer and considered as an alternative to antibiotics in animal production

Heat stress is one of the most major stressors for livestock and especially for the fast-growing meat-type broilers in tropical and subtropical regions around the world. It could compromise health status and production performance of broilers, leading directly to considerable economic losses for broilers producers (Lu et al., 2007; Wang et al., 2018a). In broilers, numerous studies have already illustrated that heat stress would induce multiple physiological disturbances, such as endocrine disorders (Sohail et al., 2010; Xie et al., 2015; RajaeiSharifabadi et al., 2017), electrolyte imbalance (Sandercock et al., 2001; Ahmad et al., 2008; Attia et al., 2011), immune dysregulation (Chen et al., 2014; Habibian et al., 2014; Wang et al., 2018b), and oxidative stress (Liu et al., 2014; Huang et al., 2015; Ganesan et al., 2017; Zhang et al., 2018). The intestinal mucosa plays a

 C 2019 Poultry Science Association Inc. Received November 16, 2018. Accepted March 17, 2019. 1 Corresponding author: [email protected]

1

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez192/5475738 by University of Melbourne Library user on 21 April 2019

Y. F. Cheng, Y. P. Chen, R. Chen, Y. Su, R. Q. Zhang, Q. F. He, K. Wang, C. Wen, and Y. M. Zhou1

2

CHENG ET AL.

MATERIALS AND METHODS Ethics Statement All procedures involving animals in the present study were approved by Nanjing Agricultural University Animal Care and Use Committee, Nanjing, P. R. China (Certification No.: SYXK (Su) 2011–0036, 11 August 2015).

Birds, Diets, and Experimental Design A total of 240 one-day-old male Arbor Acres plus broiler chicks with similar initial weights were allocated into 1 of 3 treatments of 10 replicates (cages) with 8 birds per cage for 42-D experiment. The 3 groups were as follows: 1) control group: broilers reared at thermoneutral temperature were fed a basal diet; 2) heat stress group: broilers were subjected to heat stress by exposing them to 32 to 33◦ C from 9: 00 am to 5: 00 pm

Table 1. Compositions and nutrient levels of the basal diet (g/kg, as fed basis unless otherwise stated). Items

1 to 21 D

22 to 42 D

Ingredients Corn Soybean meal Corn gluten meal Soybean oil Limestone Dicalcium phosphate L-Lysine DL-Methionine Sodium chloride Premix1

576.1 310 32.9 31.1 12 20 3.4 1.5 3 10

622.7 230 60 40 14 16 3.5 0.8 3 10

Calculated nutrient levels2 Apparent metabolizable energy (MJ/kg) Crude protein Calcium Available phosphorus Lysine Methionine Methionine + cystine

12.56 211 10.00 4.60 12.00 5.00 8.50

13.19 196 9.50 3.90 10.50 4.20 7.60

1 Premix provided per kilogram of diet: vitamin A (transretinyl acetate), 10,000 IU; vitamin D3 (cholecalciferol), 3,000 IU; vitamin E (allrac-α -tocopherol), 30 IU; menadione, 1.3 mg; thiamin, 2.2 mg; riboflavin, 8 mg; nicotinamide, 40 mg; choline chloride, 400 mg; calcium pantothenate, 10 mg; pyridoxine·HCl, 4 mg; biotin, 0.04 mg; folic acid, 1 mg; vitamin B12 (cobalamin), 0.013 mg; Fe (from ferrous sulfate), 80 mg; Cu (from copper sulfate), 8.0 mg; Mn (from manganese sulfate), 110 mg; Zn (from zinc oxide), 60 mg; I (from calcium iodate), 1.1 mg; Se (from sodium selenite), 0.3 mg. 2 Calculated according to tables of feed composition and nutritive values in China (2012).

and at thermoneutral temperature for the remaining 16 h daily and given the basal diet; 3) MOS group: heatstressed broilers fed the basal diet supplemented with 250 mg/kg MOS (Safmannan, Phileo Lesaffre Animal Care, Marcq-en-Baroeul, France, and this dosage was the recommended supplemental level of broilers’ diet provided by product instruction). The temperature was maintained 32 to 33◦ C for the first 3 D for all birds, and it was gradually reduced by 3◦ C per week to a final temperature of 20◦ C in the control group. The period that broilers subjected to cyclic heat stress therefore started from 4 to 42 D. Broilers were reared in a temperaturecontrolled room, and had free access to clean water and feed in the 3-layer-wired cages. The cage was 120-cm length, 60-cm width, and 50-cm height, providing 0.09 m2 for per bird. A light schedule of 23-h light and 1-h darkness in the room was provided, and relative humidity among treatments was controlled in accordance with our recent study (Cheng et al., 2018). The basal diet is formulated according to the recommendation by NRC (1994), and the components and nutrient levels of which are shown in Table 1. The grower and finisher periods are started from 1 to 21 and 22 to 42 D, respectively. At 4, 21, and 42 D, feed consumption and body weight were recorded on cage basis after a 12-h feed deprivation, and average feed intake (ADFI), average body gain (ADG), and feed/gain ratio (F:G) were then calculated. Died broilers during the experimental period were also weighed for the F: G correction. Additionally, at 21 and 42 D, one broiler from each replicate was

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez192/5475738 by University of Melbourne Library user on 21 April 2019

(Halas and Nochta, 2012). Extensive studies have demonstrated that dietary MOS could improve growth performance (Parks et al., 2001; Kim et al., 2011; Zhao et al., 2012), oxidative status (Bozkurt et al., 2012; Attia et al., 2017; Zheng et al., 2018), immunity (Shashidhara and Devegowda, 2003; Attia et al., 2017; Zheng et al., 2018), and intestinal morphology and barrier function of animals under a normal condition (Baurhoo et al., 2007, 2009; Cheled-Shoval et al., 2011; Torrecillas et al., 2013; Hutsko et al., 2016). Moreover, it has also been well documented that MOS supplementation into diets could ameliorate retarded growth performance (Che et al., 2012; Sohail et al., 2012; Jazi et al., 2018), compromised antioxidant capacity (Liu et al., 2013), suppressed immune response (G´omezVerduzco et al., 2009; Sohail et al., 2010; Che et al., 2012), and impaired intestinal morphology and barrier function of animals exposed to various adverse factors (Ashraf et al., 2013; Wang et al., 2016; Jazi et al., 2018). However, there is extremely limited information concerning the effects of dietary MOS on intestinal oxidative status and barrier integrity of broilers reared under heat stress. Interestingly, it has been reported that some other functional oligosaccharides, for example, cello-oligosaccharide and galacto-oligosaccharide, were proven to efficiently alleviate the damages on intestinal barrier function of broilers under heat stress in recent papers (Song et al., 2013; Varasteh et al., 2015). Based on the MOS application effects and similar biological functions among those oligosaccharides in livestock, we thereafter hypothesized that MOS supplementation would exert protective effects on heat-stressed broilers, and this study was therefore conducted to evaluate the effects of dietary MOS supplementation on growth performance and intestinal oxidative status, morphology, and barrier function in broilers subjected to cyclic heat stress.

3

MANNAN OLIGOSACCHARIDE IN CYCLIC HEAT STRESS

selected for rectal temperature measurement right after each 8 h of heat treatment using a digital thermometer. The thermometer is connected to a very fine probe that was inserted for a distance of 3 cm inside the rectum of bird.

At 21 and 42 D of age, one broiler (close to the cage average body weight) from each replicate was selected. Blood sample was obtained from jugular vein and centrifuged at 3,000 × g for 15 min at 4◦ C to separate serum, and it was subsequently frozen at −80◦ C for related parameter measurement. Then, chickens were euthanized by cervical dislocation and necropsied immediately. The whole gastrointestinal tract was rapidly removed, and segments of mid-jejunum and mid-ileum were removed (about 2 cm), flushed gently with icecold phosphate-buffered saline, which thereafter placed in 10% formalin solution for morphology measurement. After that, the remaining jejunum and ileum were opened longitudinally and the contents were flushed with ice-cold phosphate-buffered saline. Mucosa of each sample was collected using a sterile glass microscope slide, rapidly stored in liquid nitrogen, and then frozen at −80◦ C until analysis.

Serum Index Determination The D-lactate acid (D-LA) concentration and diamine oxidase (DAO) activity in the serum were assayed using the available kits (Nanjing Jiancheng Institute of Bioengineering, Nanjing, P. R. China) according to the corresponding procedure provided by the manufacturer.

Intestinal Morphology Examination The segments of formalin-fixed jejunum and ileum were dehydrated, cleared, and embedded in paraffin, which were cut into serial sections at 5-μm depth for subsequent stain with hematoxylin and eosin. Villus height (VH) and crypt depth (CD) were determined using a light microscope equipped with a computer-assisted morphometric system (Nikon Corporation, Tokyo, Japan).

Determination of Intestinal Mucosal Oxidative Status About 0.3 g of each jejunal and ileal mucosa sample was homogenized at a ratio of 1: 9 (weight/volume) with ice-cold 154 mmol/L sterile sodium chloride solution employing a PRO-PK-02200D homogenizer (Pro Scientific, Inc., Monroe, CT). Homogenate was centrifuged at 3,500 × g for 10 min at 4◦ C to acquire supernatant, and it was immediately frozen at −20◦ C for further analysis. Superoxide dismutase (SOD) activity and malon-

Genes1

Gene Bank ID

Primer sequence, sense/antisense

MUC2

XM 001234581.3 AGGAATGGGCTGCAAGAGAC GTGACATCAGGGCACACAGA ZO-1 XM 413773.4 TGTAGCCACAGCAAGAGGTG CTGGAATGGCTCCTTGTGGT OCLN NM 205128.1 CCGTAACCCCGAGTTGGAT ATTGAGGCGGTCGTTGATG CLDN2 NM 001277622.1 CCTGCTCACCCTCATTGGAG GCTGAACTCACTCTTGGGCT CLDN3 NM 204202.1 CCCGTCCCGTTGTTGTTTTG CCCCTTCAACCTTCCCGAAA β -actin NM 205518.1 TTGGTTTGTCAAGCAAGCGG CCCCCACATACTGGCACTTT

Length 77 159 214 145 126 100

1 MUC2, mucin 2; ZO-1, zonula occludens-1; OCLN, occludin; CLDN2, claudin-2; CLDN3, claudin-3.

diadehyde (MDA) accumulation were measured using commercial kits purchased from Nanjing Jiancheng Institute of Bioengineering (Nanjing, P. R. China). Total protein content of each sample was determined by a Coomassie brilliant blue protein assay kit (Nanjing Jiancheng Institute of Bioengineering, Nanjing, P. R. China) using bovine serum albumin as the standard. The results were normalized against total protein concentration in each sample for intersample comparison.

Messenger RNA Quantification The total RNA of each jejunal and ileal mucosa was isolated using Trizol reagent (TaKaRa Biotechnology, Dalian, P. R. China) according to the instructions of manufacturer. The concentration and purity of RNA were quantified with a spectrophotometer (NanoDrop 2000c, Thermo Scientific, MA, USA). The RNA was immediately reverse-transcribed into cDNA using the Prime Script RT Master Mix reagent kit (TaKaRa Biotechnology, Dalian, P. R. China) according to the protocols by manufacturer. The primer sequences for the target and reference genes (mucus 2 (MUC2), zonula occludens-1 (ZO-1), occludin (OCLN), claudin-2 (CLDN2), claudin-3 (CLDN3), and β -actin) were obtained from our recent study (Chen et al., 2018), synthesized by Invitrogen Biotechnology Co., Ltd. (Shanghai, P. R. China), and shown in Table 2. Then, the cDNA samples were amplified with the SYBR Premix Ex TaqII Tli RNaseH Plus kit based on an ABI StepOnePlus Real-Time PCR system (Applied Biosystems, Grand Island, NY). Reaction mixture and cycling parameters of PCR were performed following the descriptions by our published work (Chen et al., 2018). Relative mRNA abundances of target genes were calculated using the 2−ΔΔCT method (Livak and Schmittgen, 2001), and β -actin was used as the reference gene.

Statistical Analysis All data were analyzed by one-way analysis of variance (ANOVA) using SPSS 19.0 for windows. A total

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez192/5475738 by University of Melbourne Library user on 21 April 2019

Sample Preparation

Table 2. Sequences for real-time PCR primers.

4

CHENG ET AL.

Table 3. Effects of dietary MOS supplementation on growth performance of heat-stressed broilers. Control group

Heat stress group

1 to 3 D ADG (g/d) ADFI (g/d) F: G (g/g)

10.3 12.1 1.17

10.4 12.1 1.16

4 to 21 D ADG (g/d) ADFI (g/d) F: G (g/g)

33.6a 47.2 1.40b

31.3b 46.0 1.47a

22 to 42 D ADG (g/d) ADFI (g/d) F: G (g/g)

79.4a 142a 1.79c

4 to 42 D ADG (g/d) ADFI (g/d) F: G (g/g)

58.4a 97.5a 1.67c

MOS group

SEM

P value

10.4 12.0 1.15

0.1 0.1 0.01

0.861 0.741 0.459

32.8a,b 46.4 1.42a.b

0.4 0.5 0.01

0.058 0.618 0.009

67.9c 129b 1.89a

76.2b 141a 1.84b

1.0 1 0.01

< 0.001 < 0.001 < 0.001

51.2b 89.7b 1.75a

56.3a 96.4a 1.71b

0.7 0.9 0.01

< 0.001 < 0.001 < 0.001

1 Control group, broilers raised at a thermoneutral temperature were fed a basal diet; heat stress group and MOS group, broilers housed at 32 to 33◦ C for 8 h and at a thermoneutral temperature for 16 h per day were given a basal diet supplemented with either 0 or 250 mg/kg MOS from 4 to 42 D, respectively. SEM, standard error of means (n = 10). 2 ADG, average daily gain; ADFI, average daily feed intake; F: G, feed/gain ratio. a–c Means within a row with different superscripts are different at P < 0.05.

of 10 replicates were used for per treatment, and replicate was defined as an experimental unit. The significant differences among treatment means were assayed by Tukey’s test, which were considered significant if P < 0.05. Results are presented as means and standard error of means (Tables) or standard errors (Figures).

RESULTS Growth Performance Compared with the control group (Table 3), cyclic heat stress decreased (P < 0.05) ADG by 6.85, 14.5, and 12.3%, respectively, whereas increased (P < 0.05) F: G by 5.00, 5.59, and 4.79%, respectively, during the grower (4 to 21 D), finisher (22 to 42 D), and entire periods (4 to 42 D), and reduced ADFI by 9.15 and 8.00%, respectively, during the finisher and whole periods. Compared with the heat stress group, dietary MOS inclusion increased (P < 0.05) ADG by 12.2 and 9.96%, respectively, and ADFI by 9.30 and 7.47%, respectively, whereas decreased (P < 0.05) F: G by 2.65 and 2.29%, respectively, during the finisher and entire periods.

Rectal Temperature Rectal temperature of broilers at both 21 and 42 D in the heat stress group was higher than that of birds in the control group (Figure 1, P < 0.05). Dietary MOS supplementation numerically decreased rectal temperature of heat-stressed broilers compared with the heat stress group (P > 0.05).

Figure 1. Effects of dietary MOS supplementation on rectal temperature of broilers under cyclic heat stress. Data are shown as means and standard errors (n = 10). Control group, broilers raised at a thermoneutral temperature were fed a basal diet; heat stress group and MOS group, broilers housed at 32 to 33◦ C for 8 h and at a thermoneutral temperature for 16 h per day were given a basal diet supplemented with either 0 or 250 mg/kg MOS from 4 to 42 D, respectively. a, b Different letters indicate significant differences among the treatments (P < 0.05).

Intestinal Antioxidant Status Broilers in the heat stress group exhibited a higher jejunal mucosal MDA accumulation, whereas a lower ileal mucosal SOD activity at 42 D than the control group (Table 4, P < 0.05). The MOS addition reduced jejunal mucosal MDA content of birds at 42 D when compared with the heat stress group (P < 0.05). However, treatments did not affect intestinal mucosal MDA concentration and SOD activity of broilers at 21 D (P > 0.05).

Serum D-LA Content and DAO Activity Compared with the control group (Figure 2), broilers in the heat stress group exhibited increases (P < 0.05) in serum D-LA concentration at 21 and 42 D by 41.45 and 55.67%, respectively, and DAO activity at 42 D by 32.69%. In contrast, the supplementation of dietary MOS numerically reduced serum D-LA level at 21 D by 11.21% and DAO activity at 42 D by 19.00% (P > 0.05).

Intestinal Morphology At 21 D (Table 5), a shorter jejunal VH by 14.9% of broilers in the heat stress group was observed compared with the control group (P < 0.05), which was increased by 11.0% resulting from MOS inclusion (P > 0.05). At 42 D, cyclic heat stress reduced (P < 0.05) VH by 17.2 and 21.5%, respectively, and VH: CD by 21.9 and 23.6%, respectively, in the jejunum and ileum, whereas increased (P < 0.05) jejunal CD by 5.75% of broilers when in comparison with the control group. Dietary MOS alleviated reductions of VH by 6.09 and 19.1%, respectively, and VH: CD by 7.04 and 24.4%, respectively, in the jejunum and ileum of broilers

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez192/5475738 by University of Melbourne Library user on 21 April 2019

Items1,2

5

MANNAN OLIGOSACCHARIDE IN CYCLIC HEAT STRESS Table 4. Effects of dietary MOS supplementation on intestinal oxidative status of broilers under cyclic heat stress. Items1

Control group

Heat stress group

MOS group

SEM

P value

0.62 167

0.65 172

0.66 161

0.04 4

0.919 0.526

Ileum MDA (nmol/mg protein) SOD (U/mg protein)

0.78 100

0.80 95.0

0.77 103

0.04 3.4

0.964 0.595

42 D Jejunum MDA (nmol/mg protein) SOD (U/mg protein)

0.42c 196

0.75a 209

0.58b 190

0.04 7

< 0.001 0.559

0.04 4

0.783 < 0.001

Ileum MDA (nmol/mg protein) SOD (U/mg protein)

0.48 122a

0.55 90.7b

0.51 103b

1 Control group, broilers raised at a thermoneutral temperature were fed a basal diet; heat stress group and MOS group, broilers housed at 32 to 33◦ C for 8 h and at a thermoneutral temperature for 16 h per day were given a basal diet supplemented with either 0 or 250 mg/kg MOS from 4 to 42 D, respectively. SEM, standard error of means (n = 10). 2 MDA, malondialdehyde; SOD, superoxide dismutase. a,b Means within a row with different superscripts are different at P < 0.05.

Figure 2. Effects of dietary MOS supplementation on D-LA content and DAO activity in the serum of broilers under cyclic heat stress (A and B). Data are shown as means and standard errors (n = 10). D-LA, D-lactate acid; DAO, diamine oxidase; control group, broilers raised at a thermoneutral temperature were fed a basal diet; heat stress group and MOS group, broilers housed at 32 to 33◦ C for 8 h and at a thermoneutral temperature for 16 h per day were given a basal diet supplemented with either 0 or 250 mg/kg MOS from 4 to 42 D, respectively. a, b Different letters indicate significant differences among the treatments (P < 0.05).

subjected to cyclic heat stress at 42 D (P < 0.05). Additionally, ileal CD in broilers at 42 D in the MOS group was shorter by 4.70% than the heat stress group (P < 0.05).

birds at 42 D (P < 0.05), with the values of mentioned indexes being similar to the control group (P > 0.05). Additionally, there are numerical increases in jejunal MUC2 and ileal CLDN3 genes expressions in the MOS group compared with the heat stress group (P > 0.05).

Intestinal Mucosal Gene Expressions At 21 D (Table 6), cyclic heat stress downregulated mRNA abundance of jejunal mucosal CLDN3 when compared with the control group (P < 0.05), whereas it did not affect ileal mucosal gene expressions (P > 0.05). At 42 D, broilers in the heat stress group exhibited reductions in mRNA expressions of jejunal mucosal MUC2 and OCLN, and ileal mucosal MUC2, ZO-1, OCLN, and CLDN3 than those in the control group (P < 0.05). In contrast, dietary MOS supplementation increased mRNA abundances of jejunal and ileal OCLN, and ileal MUC2 and ZO-1 of heat-stressed

DISCUSSION Quite a few studies have revealed that heat stress has profound negative effect on growth performance of broilers (Song et al., 2017; Zhang et al., 2017, 2018; He et al., 2018). The retarded growth performance could attribute to the results from published works in which heat-stressed broilers exhibited a poor appetite (Song et al., 2013), less efficiency of nutrients’ adsorption and utilization (Habashy et al., 2017a; Habashy et al., 2017b), and compromised health status such as endocrine disorders, systemic immune dysregulation,

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez192/5475738 by University of Melbourne Library user on 21 April 2019

21 D Jejunum MDA (nmol/mg protein) SOD (U/mg protein)

6

CHENG ET AL.

Table 5. Effects of dietary MOS supplementation on intestinal morphology of broilers under cyclic heat stress. Items1,2

Control group

Heat stress group

MOS group

SEM

Table 6. Effects of dietary MOS supplementation on intestinal gene expressions of broilers under cyclic heat stress. Items1,2

Control group

Heat stress group

21 D Jejunum MUC2 ZO-1 OCLN CLDN2 CLDN3

1.00 1.00 1.00 1.00 1.00a

Ileum MUC2 ZO-1 OCLN CLDN2 CLDN3

21 D Jejunum VH (μ m) CD (μ m) VH: CD

1,519a 211 7.35

1,292b 209 6.37

1,434a,b 208 6.95

37 4 0.22

0.036 0.945 0.204

Ileum VH (μ m) CD (μ m) VH: CD

840 207 4.09

811 210 3.89

824 208 3.99

8 2 0.05

0.383 0.763 0.214

42 D Jejunum VH (μ m) CD (μ m) VH: CD

1,885a 261b 7.27a

1,560c 276a 5.68c

1,655b 273a,b 6.08b

29 2 0.14

< 0.001 0.016 < 0.001

Ileum VH (μ m) CD (μ m) VH: CD

1,216a 227a,b 5.37a

955c 234a 4.10c

1,137b 223b 5.10b

23 1 0.11

< 0.001 0.004 < 0.001

1 VH, villus height; CD, crypt depth; VH: CD, villus height/crypt depth ratio. 2 Control group, broilers raised at a thermoneutral temperature were fed a basal diet; heat stress group and MOS group, broilers housed at 32 to 33◦ C for 8 h and at a thermoneutral temperature for 16 h per day were given a basal diet supplemented with either 0 or 250 mg/kg MOS from 4 to 42 D, respectively. SEM, standard error of means (n = 10). a–c Means within a row with different superscripts are different at P < 0.05.

and oxidative damage (Rajaei-Sharifabadi et al., 2017; Wang et al., 2018b; Zhang et al., 2018). Our latest research showed that heat stress reduced body weight gain, feed intake, and feed conversion ratio (Cheng et al., 2018). Similarly, in the present study, broilers subjected to heat stress exhibited a retarded growth performance, as illustrated by decreased ADG whereas increased F: G during the grower, finisher, and entire periods, and reduced ADFI during the finisher and whole periods. The MOS as one of the functional oligosaccharides has been demonstrated to promote poultry growth performance in previous researches (Sims et al., 2004; Attia et al., 2014). Furthermore, heat-stressed broilers fed MOS exhibited a better growth performance, as proved by increased feed intake and body weight gain (Sohail et al., 2012, 2013). Similarly, dietary MOS inclusion increased ADG and ADFI whereas decreased F: G during the finisher and entire periods in the present study. The improvement on ADG of broilers in the MOS group in this study, on the one hand, attribute to increased feed intake, on the other hand, is due to the promotion of MOS on nutrients’ digestibility, intestinal microbiology and barrier integrity, oxidative status, and immunity of animals (Iji Paul et al., 2001; Torrecillas et al., 2013; Attia et al., 2017; Zheng et al., 2018). It is generally believed that ambient temperature above 30◦ C is sufficient to induce heat stress for poultry, resulting in physiological disturbances including high body temperature. In the current study, heat-stressed broilers had a higher rectal temperature at 21 and 42 D, implying that this

MOS group

SEM

P value

1.25 0.97 1.04 0.92 0.64b

1.21 0.88 1.16 1.02 0.62b

0.07 0.04 0.04 0.08 0.06

0.278 0.450 0.166 0.882 0.004

1.00 1.00 1.00 1.00 1.00

0.92 0.92 1.02 0.90 0.71

0.88 0.94 0.94 0.84 0.74

0.05 0.06 0.05 0.07 0.10

0.661 0.867 0.757 0.614 0.437

42 D Jejunum MUC2 ZO-1 OCLN CLDN2 CLDN3

1.00a 1.00 1.00a 1.00 1.00

0.65b 0.84 0.60b 0.93 0.74

0.84a,b 0.84 1.03a 1.09 0.67

0.05 0.05 0.05 0.07 0.10

0.012 0.251 < 0.001 0.673 0.360

Ileum MUC2 ZO-1 OCLN CLDN2 CLDN3

1.00a 1.00a 1.00a 1.00 1.00a

0.71b 0.61b 0.76b 0.88 0.70b

0.92a 0.86a 1.06a 0.89 0.95a,b

0.05 0.05 0.04 0.07 0.05

0.032 0.001 0.006 0.741 0.043

1 MUC2, mucin 2; ZO-1, zonula occludens-1; OCLN, occludin; CLDN2, claudin-2; CLDN3, claudin-3. 2 Control group, broilers raised at a thermoneutral temperature were fed a basal diet; heat stress group and MOS group, broilers housed at 32 to 33◦ C for 8 h and at a thermoneutral temperature for 16 h per day were given a basal diet supplemented with either 0 or 250 mg/kg MOS from 4 to 42 D, respectively. SEM, standard error of means (n = 10). a,b Means within a row with different superscripts are different at P < 0.05.

cyclic high temperature treatment in this study could lead to heat stress, which was consistent with previous result by Han et al. (2010). Numerical reduction in rectal temperature of broilers at 42 D in the MOS group was observed in this study compared with the heat stress group. This finding indicates that dietary MOS supplementation could attenuate the heat stress and its detrimental effects on broilers at some extent, which was supported by simultaneously better growth performance of heat-stressed broilers ingesting MOS. The SOD is regarded as one of most important lines of antioxidant enzyme in scavenging free radicals. Lipid peroxidation is a process in which carbon–carbon double bonds are attacked by free radicals, and MDA is the end product of lipid peroxidation, and the accumulation of which could therefore be used as an index for lipid peroxidation. Oxidative stress can occur as a consequence of an imbalance between free radical production and the available antioxidant defense against them. Extensive researches have demonstrated that heat stress can stimulate the free radical formation (Mujahid et al., 2005), induce lipid peroxidation (Huang et al., 2015; Zhang et al., 2018), and disrupt antioxidant enzymes in the tissues of animals (Sahin et al., 2012; Yang et al., 2012; Pearce et al., 2014; Zhang et al.,

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez192/5475738 by University of Melbourne Library user on 21 April 2019

P value

MANNAN OLIGOSACCHARIDE IN CYCLIC HEAT STRESS

in agreement with mentioned findings, showing that dietary MOS supplementation increased VH and VH: CD ratio, whereas decreased CD in the both jejunum and ileum of heat-stressed broilers at 42 D. Those results suggest that dietary MOS is effective in alleviating intestinal morphology damage of broilers subjected to cyclic heat stress. Increased serum D-LA concentration and DAO activity are commonly associated with intestinal mucosal integrity injury, which therefore could be used as reliable marks to evaluate intestinal permeability and barrier function of animals (Li et al., 2002; Chen et al., 2016). In the present study, cyclic heat stress increased serum D-LA content at 21 and 42 D and DAO activity at 42 D, and it was consistent with the results of Zhang et al. (2017) and Wu et al. (2018), who reported that heat-stressed broilers exhibited a higher DAO activity and D-LA concentration in the serum. MUC2, a main component of gut mucus, covers the surface of intestinal mucosa, and thereby plays a vital role in repairing intestinal mucosal injury caused by adverse factors (Hutsko et al., 2016). Tight junctions are the crucial components of intestinal mucosal barrier and exert pivotal role in maintenance of paracellular permeability and barrier function (Ulluwishewa et al., 2011). It mainly consists of peripheral membrane protein ZO-1 and the transmembrane protein OCLN and claudins (Lerner and Matthias, 2015). Therefore, the downregulation of mRNA abundances of MUC2, ZO-1, OCLN, and claudins proteins would be harmful to intestinal structure and barrier function. In a recent paper, Zhang et al. (2017) have proved that heat stress could reduce mRNA abundances of MUC2, ZO-1, OCLN, and claudins proteins in the jejunual mucosa of broilers. Similarly, reduced gene expression levels of ZO-1 and OCLN proteins in the jejunal mucosa in heat-stressed broilers were observed by Song et al. (2013). Consistent with those results, broilers exposed to cyclic heat stress had decreased mRNA abundances of jejunal mucosal CLDN3 at 21 D, and jejunal mucosal MUC2 and OCLN and ileal mucosal MUC2, ZO-1, OCLN, and CLDN3 at 42 D. These findings, together with impaired intestinal morphology, imply that cyclic heat stress could disrupt intestinal barrier integrity, which in turn is possibly responsible for the increase in serum DAO activity and D-LA concentration of heat-stressed broilers. The beneficial effects of MOS on intestinal barrier function of animals under a normal condition have been reported. In broilers, Cheled-Shoval et al. (2011) have illustrated that MOS administration could enhance MUC2 secretion and its mRNA abundance in the intestinal mucosa. In fishes, it has been reported that dietary MOS addition exerted better cytoarchitecture and tight junction structures in the intestinal epithelial barrier (Torrecillas et al., 2013). Moreover, an MOS product has been proved to efficiently ameliorate impairment on epithelial barrier function in a Caco-2 cell model disrupted by Salmonella Enteritidis (Brufau et al., 2016). In the present study, we observed that dietary MOS

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez192/5475738 by University of Melbourne Library user on 21 April 2019

2018), ultimately leading to oxidative impairment. Consistently, in the current study, heat-stressed broilers exhibited a higher jejunal mucosal MDA content whereas a lower ileal mucosal SOD activity at 42 D. In animals, some exciting findings have recently been observed, in which dietary MOS can act as free radical scavenger to improve antioxidant enzymes including SOD and inhibit lipid peroxidation in the tissues and/or egg (Bozkurt et al., 2012; Attia et al., 2017; Zheng et al., 2018). In the present study, dietary MOS addition markedly reduced jejunal mucosal MDA concentration of broilers exposed to cyclic heat stress at 42 D, implying that MOS administration could attenuate intestinal mucosal oxidative damage resulting from heat stress. This result was in agreement with the findings by Liu et al. (2013), who have showed that dietary MOS supplementation could increase total antioxidant capacity and SOD activity, whereas decrease MDA accumulation of fishes under Aeromonas hydrophila infection. Additionally, available literature has illustrated that dietary MOS could accelerate gut development and maturation (Zdunczyk et al., 2005), improve its immunity and barrier function (Iji Paul et al., 2001; Attia et al., 2017; Zheng et al., 2018), and increase nutrients’ adsorption and utilization (Zheng et al., 2018), which together may partially account for the improved intestinal mucosal antioxidant capacity of heat-stressed broilers fed MOS in this study. Maintenance of normal microarchitecture of small intestine is very crucial for individual’s proper growth and development. The VH and CD serve as criteria that reflect gross intestinal morphology (Song et al., 2013). Previous works have demonstrated that heat stress could induce progressive deterioration on intestinal morphology of animals, resulting in a shorter VH and a lower VH: CD ratio, whereas a deeper CD in the intestine (Song et al., 2013, 2014; Zhang et al., 2017; Wu et al., 2018). Again, in the present study, heat-stressed broilers exhibited decreases in jejunal VH at 21 D, VH and VH: CD of jejunum and ileum at 21 and 42 D, whereas a increase in jejunal CD at 42 D. For heat-stressed broiler, its systemic blood flows is diverted from internal organs to peripheral circulation in order to heat dissipation, leading to less blood supply in the intestine, and eventually inducing epithelial cell lesion (Varasteh et al., 2015). A common method to evaluate the effect of dietary supplementation on intestinal health is the examination of its histopathology. It is undoubtedly that dietary MOS supplementation could exert beneficial consequence on animals’ intestinal morphology under a normal condition (Iji Paul et al., 2001; Mour˜ ao et al., 2006; Baurhoo et al., 2007; Dimitroglou et al., 2009). Furthermore, published papers have demonstrated that MOS addition into diets could efficiently attenuate the impairment on intestinal morphology of animals challenged by various adverse factors, such as Escherichia coli challenge and heat stress (Sohail et al., 2012; Wang et al., 2016). The results of the present study were

7

8

CHENG ET AL.

CONCLUSIONS This study demonstrated that cyclic heat stress (32 to 33◦ C for 8 h/d that was from 4 to 42 D) retarded growth performance (decreased ADG, ADFI, and feed conversion ratio; 51.2 g vs. 58.5 g, 89.7 g vs. 97.5 g, and 1.75 vs. 1.67, respectively) and impaired antioxidant status (increased jejunal MDA content, whereas decreased ileal SOD activity), morphology (reduced VH and VH: CD in jejunum (1560 μm vs. 1885 μm and 5.68 vs. 7.27) and ileum (955 μm vs. 1216 μm and 4.10 vs. 5.37) whereas increased jejunal CD), and barrier function (downregulated mRNA abundances of jejunal MUC2, OCLN, and CLDN3, and ileal MUC2, ZO1, OCLN, and CLDN3, whereas increased serum D-LA content and DAO activity) in intestine of broilers. Dietary MOS supplementation at a level of 250 mg/kg was effective in improving growth performance (increased ADG, ADFI, and feed conversion ratio, 56.3 g vs. 51.2 g, 96.4 g vs. 89.7 g, 1.71 vs. 1.75, respectively), intestinal antioxidant status (decreased jejunal MDA content), and barrier integrity (VH and VH: CD in jejunum (1655 μm vs. 1560 μm and 6.08 vs. 5.68) and ileum (1137 μm vs. 955 μm and 5.10 vs. 4.10), mRNA abundances of jejunal OCLN and ileal MUC2, ZO-1, and OCLN, whereas reduced ileal CD) of broilers exposed to cyclic heat stress.

ACKNOWLEDGMENTS The technical assistance of colleagues in our laboratories is gratefully acknowledged.

REFERENCES Ahmad, T., T. Khalid, T. Mushtaq, M. A. Mirza, A. Nadeem, M. E. Babar, and G. Ahmad. 2008. Effect of potassium chloride supple-

mentation in drinking water on broiler performance under heat stress conditions. Poult. Sci. 87:1276–1280. Ashraf, S., H. Zaneb, M. S. Yousaf, A. Ijaz, M. U. Sohail, S. Muti, M. M. Usman, S. Ijaz, and H. Rehman. 2013. Effect of dietary supplementation of prebiotics and probiotics on intestinal microarchitecture in broilers reared under cyclic heat stress. J. Anim. Physiol. Anim. Nutr. 97:68–73. Attia, Y. A., A. E. A. Al-Hamid, M. S. Ibrahim, M. A. Al-Harthi, F. Bovera, and A. S. Elnaggar. 2014. Productive performance, biochemical and hematological traits of broiler chickens supplemented with propolis, bee pollen, and mannan oligosaccharides continuously or intermittently. Livest. Sci. 164:87–95. Attia, Y. A., H. Al-Khalaifah, M. S. Ibrahim, A. E. A. Al-Hamid, M. A. Al-Harthi, and A. El-Naggar. 2017. Blood hematological and biochemical constituents, antioxidant enzymes, immunity and lymphoid organs of broiler chicks supplemented with propolis, bee pollen and mannan oligosaccharides continuously or intermittently. Poult. Sci. 96:4182–4192. Attia, Y. A., R. A. Hassan, A. E. Tag El-Din, and B. M. AbouShehema. 2011. Effect of ascorbic acid or increasing metabolizable energy level with or without supplementation of some essential amino acids on productive and physiological traits of slowgrowing chicks exposed to chronic heat stress. J. Anim. Physiol. Anim. Nutr. 95:744–755. Baurhoo, B., P. R. Ferket, and X. Zhao. 2009. Effects of diets containing different concentrations of mannanoligosaccharide or antibiotics on growth performance, intestinal development, cecal and litter microbial populations, and carcass parameters of broilers. Poult. Sci. 88:2262–2272. Baurhoo, B., L. Phillip, and C. A. Ruiz-Feria. 2007. Effects of purified lignin and mannan oligosaccharides on intestinal integrity and microbial populations in the ceca and litter of broiler chickens. Poult. Sci. 86:1070–1078. ¨ Toku¸so˘glu, K. K¨ Bozkurt, M., O. uc¸u ¨kyilmaz, H. Ak¸sit, M. C ¸ abuk, A. U˘ gur C ¸ atli, K. Seyrek, and M. C ¸ inar. 2012. Effects of dietary mannan oligosaccharide and herbal essential oil blend supplementation on performance and oxidative stability of eggs and liver in laying hens. Ital. J. Anim. Sci. 11: 223–229. Brufau, M. T., J. Campo-Sabariz, R. Bou, S. Carn´e, J. Brufau, B. Vil` a, A. M. Marqu´es, F. Guardiola, R. Ferrer, and R. Mart´ın-Venegas. 2016. Salmosan, a β -galactomannan-rich product, protects epithelial barrier function in Caco-2 cells infected by Salmonella enterica serovar Enteritidis. J. Nutr. 146:1492–1498. Che, T. M., M. Song, Y. Liu, R. W. Johnson, K. W. Kelley, W. G. Van Alstine, K. A. Dawson, and J. E. Pettigrew. 2012. Mannan oligosaccharide increases serum concentrations of antibodies and inflammatory mediators in weanling pigs experimentally infected with porcine reproductive and respiratory syndrome virus. J. Anim. Sci. 90:2784–2793. Cheled-Shoval, S. L., E. Amit-Romach, M. Barbakov, and Z. Uni. 2011. The effect of in ovo administration of mannan oligosaccharide on small intestine development during the pre- and posthatch periods in chickens. Poult. Sci. 90:2301–2310. Chen, Z., J. Xie, B. Wang, and J. Tang. 2014. Effect of γ -aminobutyric acid on digestive enzymes, absorption function, and immune function of intestinal mucosa in heat-stressed chicken. Poult. Sci. 93:2490–2500. Chen, Y., H. Zhang, Y. Cheng, Y. Li, C. Wen, and Y. Zhou. 2018. Dietary L-threonine supplementation attenuates lipopolysaccharide-induced inflammatory responses and intestinal barrier damage of broiler chickens at an early age. Br. J. Nutr. 119:1254–1262. Chen, J. L., P. Zheng, C. Zhang, B. Yu, J. He, J. Yu, J. Q. Luo, X. B. Mao, Z. Q. Huang, and D. W. Chen. 2017. Benzoic acid beneficially affects growth performance of weaned pigs which was associated with changes in gut bacterial populations, morphology indices and growth factor gene expression. J. Anim. Physiol. Anim. Nutr. 101:1137–1146. Cheng, Y., M. Du, Q. Xu, Y. Chen, C. Wen, and Y. Zhou. 2018. Dietary mannan oligosaccharide improves growth performance, muscle oxidative status, and meat quality in broilers under cyclic heat stress. J. Therm. Biol. 75:106–111. Dimitroglou, A., D. L. Merrifield, R. Moate, S. J. Davies, P. Spring, J. Sweetman, and G. Bradley. 2009. Dietary mannan

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez192/5475738 by University of Melbourne Library user on 21 April 2019

supplementation numerically reduced serum D-LA concentration at 21 D and DAO activity at 42 D, whereas increased (significantly or numerically) mRNA expressions of jejunal mucosal MUC2 and OCLN and ileal mucosal MUC2, OCLN, and CLDN3 of broilers under heat stress at 42 D. Those findings were in accordance with the results of Song et al., (2013), who confirmed that cello-oligosaccharide was effective to mitigate impairment on intestinal barrier integrity of heat-stressed broilers, implying that dietary MOS supplementation also exert protective effects on damaged intestinal barrier function of broilers subjected to heat stress. Previous researches have illustrated that dietary MOS exerted regulatory effects on intestinal microorganism and immunity (Mour˜ ao et al., 2006; Baurhoo et al., 2009; Dimitroglou et al., 2009; Zheng et al., 2018), Those findings, coupled with the beneficial effects of MOS on intestinal oxidative status, morphology, and proteins synthesizes related to mucins and tight junctions, would account for the improved intestinal barrier function of heat-stressed broilers administrated MOS.

MANNAN OLIGOSACCHARIDE IN CYCLIC HEAT STRESS

Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 25:402–408. Lu, Q., J. Wen, and H. Zhang. 2007. Effect of chronic heat exposure on fat deposition and meat quality in two genetic types of chicken. Poult. Sci. 86:1059–1064. Mour˜ ao, J. L., V. Pinheiro, A. Alves, C. M. Guedes, L. Pinto, M. J. Saavedra, P. Spring, and A. Kocher. 2006. Effect of mannan oligosaccharides on the performance, intestinal morphology and cecal fermentation of fattening rabbits. Anim. Feed Sci. Technol. 126:107–120. Mujahid, A., Y. Yoshiki, Y. Akiba, and M. Toyomizu. 2005. Superoxide radical production in chicken skeletal muscle induced by acute heat stress. Poult. Sci. 84:307–314. NRC, 1994. Nutrient Requirements of Poultry, 9th ed. Natl. Acad. Press, Washington, DC, USA. Parks, C. W., J. L. Grimes, P. R. Ferket, and A. S. Fairchild. 2001. The effect of mannanoligosaccharides, bambermycins, and virginiamycin on performance of large white male market turkeys. Poult. Sci. 80:718–723. Pearce, S. C., M. V. Sanz-Fernandez, J. H. Hollis, L. H. Baumgard, and N. K. Gabler. 2014. Short-term exposure to heat stress attenuates appetite and intestinal integrity in growing pigs. J. Anim. Sci. 92:5444–5454. Rajaei-Sharifabadi, H., L. Ellestad, T. Porter, A. Donoghue, W. G. Bottje, and S. Dridi. 2017. Noni (Morinda citrifolia) modulates the hypothalamic expression of stress- and metabolic-related genes in broilers exposed to acute heat stress. Front. Genet. 8:192. Sahin, K., C. Orhan, Z. Tuzcu, M. Tuzcu, and N. Sahin. 2012. Curcumin ameloriates heat stress via inhibition of oxidative stress and modulation of Nrf2/HO-1 pathway in quail. Food Chem. Toxicol. 50:4035–4041. Sandercock, D. A., R. R. Hunter, G. R. Nute, M. A. Mitchell, and P. M. Hocking. 2001. Acute heat stress-induced alterations in blood acid-base status and skeletal muscle membrane integrity in broiler chickens at two ages: implications for meat quality. Poult. Sci. 80:418–425. Shashidhara, R. G., and G. Devegowda. 2003. Effect of dietary mannan oligosaccharide on broiler breeder production traits and immunity. Poult. Sci. 82:1319–1325. Shen, L., C. R. Weber, D. R. Raleigh, D. Yu, and J. R. Turner. 2011. Tight junction pore and leak pathways: a dynamic duo. Annu. Rev. Physiol. 73:283–309. Sims, M. D., K. A. Dawson, K. E. Newman, P. Spring, and D. M. Hoogell. 2004. Effects of dietary mannan oligosaccharide, bacitracin methylene disalicylate, or both on the live performance and intestinal microbiology of turkeys. Poult. Sci. 83:1148–1154. Sohail, M. U., A. Ijaz, M. S. Yousaf, K. Ashraf, H. Zaneb, M. Aleem, and H. Rehman. 2010. Alleviation of cyclic heat stress in broilers by dietary supplementation of mannan-oligosaccharide and Lactobacillus-based probiotic: Dynamics of cortisol, thyroid hormones, cholesterol, C-reactive protein, and humoral immunity. Poult. Sci. 89:1934–1938. Sohail, M. U., M. E. Hume, J. A. Byrd, D. J. Nisbet, A. Ijaz, A. Sohail, M. Z. Shabbir, and H. Rehman. 2012. Effect of supplementation of prebiotic mannan-oligosaccharides and probiotic mixture on growth performance of broilers subjected to chronic heat stress. Poult. Sci. 91:2235–2240. Sohail, M. U., A. Ijaz, M. Younus, M. Z. Shabbir, Z. Kamran, S. Ahmad, H. Anwar, M. S. Yousaf, K. Ashraf, A. H. Shahzad, and H. Rehman. 2013. Effect of supplementation of mannan oligosaccharide and probiotic on growth performance, relative weights of viscera, and population of selected intestinal bacteria in cyclic heat-stressed broilers. J. Appl. Poult. Res. 22:485–491. Song, Z. H., K. Cheng, X. C. Zheng, H. Ahmad, L. L. Zhang, and T. Wang. 2018. Effects of dietary supplementation with enzymatically treated Artemisia annua on growth performance, intestinal morphology, digestive enzyme activities, immunity, and antioxidant capacity of heat-stressed broilers. Poult. Sci. 97:430–437. Song, J., L. F. Jiao, K. Xiao, Z. S. Luan, C. H. Hu, B. Shi, and X. A. Zhan. 2013. Cello-oligosaccharide ameliorates heat stress-induced impairment of intestinal microflora, morphology and barrier integrity in broilers. Anim. Feed Sci. Technol. 185:175–181.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez192/5475738 by University of Melbourne Library user on 21 April 2019

oligosaccharide supplementation modulates intestinal microbial ecology and improves gut morphology of rainbow trout, Oncorhynchus mykiss (Walbaum). J. Anim. Sci. 87:3226–3234. ´ G´ omez-Verduzco, G., A. Cortes-Cuevas, C. L´opez-Coello, E. AvilaGonz´ alez, and G. M. Nava. 2009. Dietary supplementation of mannan-oligosaccharide enhances neonatal immune responses in chickens during natural exposure to Eimeria spp. Acta. Vet. Scand. 51:11. Ganesan, S., C. M. Summers, S. C. Pearce, N. K. Gabler, R. J. Valentine, L. H. Baumgard, R. P. Rhoads, and J. T. Selsby. 2017. Short-term heat stress causes altered intracellular signaling in oxidative skeletal muscle. J. Anim. Sci. 95:2438–2451. Habashy, W. S., M. C. Milfort, K. Adomako, Y. A. Attia, R. Rekaya, and S. E. Aggrey. 2017a. Effect of heat stress on amino acid digestibility and transporters in meat-type chickens. Poult. Sci. 96:2312–2319. Habashy, W. S., M. C. Milfort, A. L. Fuller, Y. A. Attia, R. Rekaya, and S. E. Aggrey. 2017b. Effect of heat stress on protein utilization and nutrient transporters in meat-type chickens. Int. J. Biometeorol. 61:2111–2118. Habibian, M., S. Ghazi, M. M. Moeini, and A. Abdolmohammadi. 2014. Effects of dietary selenium and vitamin E on immune response and biological blood parameters of broilers reared under thermoneutral or heat stress conditions. Int. J. Biometeorol. 58:741–752. Halas, V., and I. Nochta. 2012. Mannan oligosaccharides in nursery pig nutrition and their potential mode of action. Animals. 2:261– 274. Han, A. Y., M. H. Zhang, X. L. Zuo, S. S. Zheng, C. F. Zhao, J. H. Feng, and C. Cheng. 2010. Effect of acute heat stress on calcium concentration, proliferation, cell cycle, and interleukin-2 production in splenic lymphocytes from broiler chickens. Poult. Sci. 89:2063–2070. He, X., Z. Lu, B. Ma, L. Zhang, J. Li, Y. Jiang, G. Zhou, and F. Gao. 2018. Effects of chronic heat exposure on growth performance, intestinal epithelial histology, appetite-related hormones and genes expression in broilers. J. Sci. Food Agric. 98:4471–4478. Huang, C., H. Jiao, Z. Song, J. Zhao, X. Wang, and H. Lin. 2015. Heat stress impairs mitochondria functions and induces oxidative injury in broiler chickens. J. Anim. Sci. 93:2144–2153. Hutsko, S. L., K. Meizlisch, M. Wick, and M. S. Lilburn. 2016. Early intestinal development and mucin transcription in the young poult with probiotic and mannan oligosaccharide prebiotic supplementation. Poult. Sci. 95:1173–1178. Iji, P. A., A. A. Saki, and R. Tivey David. 2001. Intestinal structure and function of broiler chickens on diets supplemented with a mannan oligosaccharide. J. Sci. Food Agric. 81:1186–1192. Jazi, V., A. D. Foroozandeh, M. Toghyani, B. Dastar, R. Rezaie Koochaksaraie, and M. Toghyani. 2018. Effects of Pediococcus acidilactici, mannan-oligosaccharide, butyric acid and their combination on growth performance and intestinal health in young broiler chickens challenged with Salmonella Typhimurium. Poult. Sci. 97:2034–2043. Kim, G. B., Y. M. Seo, C. H. Kim, and I. K. Paik. 2011. Effect of dietary prebiotic supplementation on the performance, intestinal microflora, and immune response of broilers. Poult. Sci. 90: 75–82. Lerner, A., and T. Matthias. 2015. Changes in intestinal tight junction permeability associated with industrial food additives explain the rising incidence of autoimmune disease. Autoimmun. Rev. 14:479–489. Li, J. Y., Y. Lu, S. Hu, D. Sun, and Y.-M. Yao. 2002. Preventive effect of glutamine on intestinal barrier dysfunction induced by severe trauma. World J. Gastroenterol. 8:168–171. Liu, B., L. Xu, X. Ge, J. Xie, P. Xu, Q. Zhou, L. Pan, and Y. Zhang. 2013. Effects of mannan oligosaccharide on the physiological responses, HSP70 gene expression and disease resistance of Allogynogenetic crucian carp (Carassius auratus gibelio) under Aeromonas hydrophila infection. Fish Shellfish Immunol. 34:1395–1403. Liu, L. L., J. H. He, H. B. Xie, Y. S. Yang, J. C. Li, and Y. Zou. 2014. Resveratrol induces antioxidant and heat shock protein mRNA expression in response to heat stress in black-boned chickens. Poult. Sci. 93:54–62.

9

10

CHENG ET AL. Wu, Q. J., N. Liu, X. H. Wu, G. Y. Wang, and L. Lin. 2018. Glutamine alleviates heat stress-induced impairment of intestinal morphology, intestinal inflammatory response, and barrier integrity in broilers. Poult. Sci. 97:2675–2683. Xie, J., L. Tang, L. Lu, L. Zhang, X. Lin, H. C. Liu, J. Odle, and X. Luo. 2015. Effects of acute and chronic heat stress on plasma metabolites, hormones and oxidant status in restrictedly fed broiler breeders. Poult. Sci. 94:1635–1644. Yang, Y., M. Gao, W. Nie, J. Yuan, B. Zhang, Z. Wang, and Z. Wu. 2012. Dietary magnesium sulfate supplementation protects heat stress-induced oxidative damage by restoring the activities of anti-oxidative enzymes in broilers. Biol. Trace Elem. Res. 146:53– 58. Zdunczyk, Z., J. Juskiewicz, J. Jankowski, E. Biedrzycka, and A. Koncicki. 2005. Metabolic response of the gastrointestinal tract of turkeys to diets with different levels of mannan-oligosaccharide. Poult. Sci. 84:903–909. Zhang, J. F., K. W. Bai, W. P. Su, A. A. Wang, L. L. Zhang, K. H. Huang, and T. Wang. 2018. Curcumin attenuates heat-stressinduced oxidant damage by simultaneous activation of GSHrelated antioxidant enzymes and Nrf2-mediated phase II detoxifying enzyme systems in broiler chickens. Poult. Sci. 97:1209–1219. Zhang, C., X. H. Zhao, L. Yang, X. Y. Chen, R. S. Jiang, S. H. Jin, and Z. Y. Geng. 2017. Resveratrol alleviates heat stress-induced impairment of intestinal morphology, microflora, and barrier integrity in broilers. Poult. Sci. 96:4325–4332. Zhao, P. Y., J. H. Jung, and I. H. Kim. 2012. Effect of mannan oligosaccharides and fructan on growth performance, nutrient digestibility, blood profile, and diarrhea score in weanling pigs. J. Anim. Sci. 90:833–839. Zheng, C., F. Li, Z. Hao, and T. Liu. 2018. Effects of adding mannan oligosaccharides on digestibility and metabolism of nutrients, ruminal fermentation parameters, immunity, and antioxidant capacity of sheep. J. Anim. Sci. 96:284–292.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez192/5475738 by University of Melbourne Library user on 21 April 2019

Song, J., K. Xiao, Y. L. Ke, L. F. Jiao, C. H. Hu, Q. Y. Diao, B. Shi, and X. T. Zou. 2014. Effect of a probiotic mixture on intestinal microflora, morphology, and barrier integrity of broilers subjected to heat stress. Poult. Sci. 93:581–588. Steed, E., M. S. Balda, and K. Matter. 2010. Dynamics and functions of tight junctions. Trends Cell Biol. 20:142–149. Torrecillas, S., A. Makol, M. B. Betancor, D. Montero, M. J. Caballero, J. Sweetman, and M. Izquierdo. 2013. Enhanced intestinal epithelial barrier health status on European sea bass (Dicentrarchus labrax) fed mannan oligosaccharides. Fish Shellfish Immunol. 34:1485–1495. Turner, J. R. 2009. Intestinal mucosal barrier function in health and disease. Nat. Rev. Immunol. 9:799–809. Ulluwishewa, D., R. C. Anderson, W. C. McNabb, P. J. Moughan, J. M. Wells, and N. C. Roy. 2011. Regulation of tight junction permeability by intestinal bacteria and dietary components. J. Nutr. 141:769–776. Varasteh, S., S. Braber, P. Akbari, J. Garssen, and J. FinkGremmels. 2015. Differences in susceptibility to heat stress along the chicken intestine and the protective effects of galactooligosaccharides. PLoS One 10:e0138975. Wang, W., Z. Li, Q. Han, Y. Guo, B. Zhang, and R. D’inca. 2016. Dietary live yeast and mannan-oligosaccharide supplementation attenuate intestinal inflammation and barrier dysfunction induced by Escherichia coli in broilers. Br. J. Nutr. 116: 1878–1888. Wang, Y., P. Saelao, K. Chanthavixay, R. Gallardo, D. Bunn, S. J. Lamont, J. M. Dekkers, T. Kelly, and H. Zhou. 2018a. Physiological responses to heat stress in two genetically distinct chicken inbred lines. Poult. Sci. 97:770–780. Wang, W. C., F. F. Yan, J. Y. Hu, O. A. Amen, and H. W. Cheng. 2018b. Supplementation of Bacillus subtilis-based probiotic reduces heat stress-related behaviors and inflammatory response in broiler chickens. J. Anim. Sci. 96:1654–1666.