Diethylstilbestrol inhibits the expression of the Steroidogenic Acute Regulatory protein in mouse fetal testis

Molecular and Cellular Endocrinology 220 (2004) 67–75

Diethylstilbestrol inhibits the expression of the Steroidogenic Acute Regulatory protein in mouse fetal testis Romain Guyot, Fanny Odet, Patrick Leduque, Maguelone G. Forest, Brigitte Le Magueresse-Battistoni∗ Inserm U329, Hopital Debrousse, 29 rue Soeur Bouvier, 69322 Lyon cedex 05, France Received 4 December 2003; received in revised form 26 March 2004; accepted 28 March 2004

Abstract This study investigated the early deleterious effects of an in-utero exposure to diethylstilbestrol (DES) on mouse testicular development. To that purpose, pregnant mice were injected daily with up to 100 ␮g/kg DES from 10.5 to 17.5 days postcoitum (dpc). At 18.5 dpc, testes were removed from fetuses for RNA (RT-PCR) and protein (Western blot, immunohistochemistry) analysis. Twenty-two genes were selected among which transcription factors, markers of differentiation of the different testicular cell lineages, steroidogenic enzymes and hormone receptors. The Steroidogenic Acute Regulatory (StAR) protein produced by the fetal Leydig cells was dramatically reduced in the DES-exposed testes. The P450c17 was the other gene modified following DES exposure. The alteration of these two genes is consistent with the decrease observed in the intratesticular testosterone levels, in the DES-exposed testes. Collectively, we demonstrated that DES did not alter testicular cell lineage specification but that it strongly inhibited the major function of the fetal Leydig cells. © 2004 Elsevier Ireland Ltd. All rights reserved. Keywords: In-utero exposure; Diethylstilbestrol; Mouse; Testis development; Leydig cell; StAR

1. Introduction Critical points in testis morphogenesis and masculinization of the embryo are the window and threshold of expression of the different effectors such as transcription factors and hormones, the specification of the testicular cell lineages including the Sertoli and the Leydig cells, and the synchrony in the overall cascade of events. The master switch is Sry, Abbreviations: DES, diethylstilbestrol; StAR, Steroidogenic Acute Regulatory protein; SF-1, Steroidogenic Factor-1; 3␤-HSD, 3betahydroxysteroid dehydrogenase; DAX-1, DSS-AHC critical region on the X; Sox-9, SRY homeobox-like gene 9; Wnt4, wingless-related MMTV integration site 4; AhR, aryl hydrocarbon receptor; AR, androgen receptor; ER, estrogen receptor; P450scc, the cholesterol side chain cleavage enzyme; P450c17, the cytochrome P450 17alpha-hydroxylase/C17-20 lyase; Dhh, Desert Hedgehog; DMRT-1, doublesex and mab3-related transcription factor; PCI, Protein C Inhibitor; NGFR, the nerve growth factor receptor; Oct-4, octamer-binding protein 4; TIMP, tissue inhibitor of metalloproteinases; RT-PCR, reverse transcriptase-polymerase chain reaction ∗ Corresponding author. Present address: Inserm U418, Hopital Debrousse, 29 rue soeur Bouvier, 69322 Lyon cedex 05, France. Tel.: +334-7825-1808; fax: +33-4-7825-6168. E-mail address: [email protected] (B.L. Magueresse-Battistoni).

the sex-determining gene in mammals, and Sry expression peaks at 11.5 days postcoitum (dpc) in the mouse (Swain and Lovell-Badge, 1999). Among transcription factors, the orphan nuclear receptor Steroidogenic Factor-1 (SF-1) exerts an essential role in the sexual differentiation and formation of the primary steroidogenic tissues. This is especially highlighted by the finding that SF-1 knockout mice lack gonads and adrenals (Luo et al., 1994). SF-1 is expressed by both Sertoli and Leydig cells, and SF-1 regulates the expression of the Anti-Müllerian Hormone/Müllerian Inhibiting Substance (AMH/MIS) secreted by Sertoli cells, and of the InsulinLike Factor 3 (Insl3) and steroidogenic enzymes genes synthesized by Leydig cells (Parker and Schimmer, 1997; Josso et al., 1998; Zimmermann et al., 1998; Morohashi, 1999; Nef et al., 2000; Koskimies et al., 2002; Jameson et al., 2003). It is now well established that estrogen exposure to pregnant mice or in the neonatal period alters profoundly testicular development (O’Donnel et al., 2001; Sharpe, 2003). In fact, much of the adverse effects of estrogen exposure in utero has come from diethylstilbestrol (DES), a potent synthetic estrogen used during the 1950s to 1970s to prevent miscarriages. The offspring of the treated women had an increased incidence of abnormalities of their reproductive

0303-7207/$ – see front matter © 2004 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.mce.2004.03.008

68

R. Guyot et al. / Molecular and Cellular Endocrinology 220 (2004) 67–75

tracts including cryptorchidism, hypoplastic testes and the presence of Müllerian duct remnants in the sons (Gill et al., 1979; Toppari et al., 1996). This was indicative that DES had a deleterious effect on male sex differentiation, and the predictive target was the hormonal sphere. In order to better understand the effects of DES in males, different experiments have been conducted in pregnant mice or rats during the second half of gestation when sexual differentiation takes place. Conclusive data pointed to an alteration in the synchrony of the timing of Müllerian duct formation, leading to persistence of Müllerian duct remnants in male mice (Visser et al., 1998), an involvement of Insl3 in the DES-induced cryptorchidism (Emmen et al., 2000; Nef et al., 2000), and a drastic disturbance of Leydig cell function: testosterone levels were decreased and masculinization was incomplete (Haavisto et al., 2001; Sharpe, 2003). It was thus predicted that these deleterious effects resulted from an alteration in SF-1 gene expression. However, the expression of SF-1 was found to be either unaltered (Emmen et al., 2000; Nef et al., 2000), stimulated (Visser et al., 1998) or inhibited (Majdic et al., 1997; Fielden et al., 2002) in the DES-exposed testes. These controversial data prompted us to re-evaluate the early adverse effects of DES on testis morphogenesis. To that purpose, 22 genes were tracked using a semi-quantitative RT-PCR procedure. These genes encode transcription factors including DAX-1 (DSS-AHC critical region on the X), GATA-4, SF-1, Sox-9 (SRY homeobox-like gene 9); a signalling molecule (Wnt4: wingless-related MMTV integration site 4) which regulates endothelial and steroidogenic cell migration in the developing male gonad; AMH/MIS or hormone receptors including the aryl hydrocarbon receptor (AhR), the androgen receptor (AR), the estrogen receptors type alpha (ER␣) and beta (ER␤); the Steroidogenic Acute Regulatory (StAR) protein which controls the rate-limiting step in steroidogenesis; steroidogenic enzymes including the 3beta-hydroxysteroid dehydrogenase type I (3␤-HSD), the cholesterol side chain cleavage enzyme (P450scc), the cytochrome P450 17alpha-hydroxylase/C17-20 lyase (P450c17), the 5 alpha-reductase type 1 (5␣-reductase 1); the Desert Hedgehog (Dhh) and the doublesex and mab3related transcription factor (DMRT-1) which both contribute to testis organogenesis; the Protein C Inhibitor (PCI), the nerve growth factor receptor p75 (NGFR) and the octamerbinding protein 4 (Oct-4) which are specific markers of Leydig, peritubular and primordial germ cells, respectively; the Tissue Inhibitors of Metalloproteinases (TIMPs) (Swain and Lovell-Badge, 1999; Stocco et al., 2001; Guyot et al., 2003; Jameson et al., 2003; Jeays-Ward et al., 2003; Schultz et al., 2003; Odet et al., 2004). Western blot and immunohistochemistry analyses may have been performed for some gene products, and the intratesticular testosterone levels were measured. Collectively, we demonstrated that DES did not alter testicular cell lineage specification. Two target genes for SF-1 but not SF-1 itself, were profoundly affected. These genes

are StAR and the P450c17. They were the only two genes of our list, that we found altered by DES. Their alteration is consistent with the decrease in the testosterone levels measured in this study.

2. Methods 2.1. Animals and tissues Pregnant mice CD-1 were purchased from Elevage Janvier (Le Genest, France). For determination of the age of the CD-1 mice embryos, the morning after vaginal plug formation was designated as 0.5 day postcoitum (dpc). Treatment was from gestational day 10.5 to day 17.5 and consisted in a daily and subcutaneous injection with diethylstilbestrol (from 10 to 100 ␮g/kg body weight; Sigma, St. Louis, MO) in sesame oil (Sigma), or with oil alone (controls). The dose of DES administered is indicated in brackets [10], [50] or [100] throughout in the text. Pregnant mice were sacrificed on 18.5 dpc. Fetuses were examined under a dissecting microscope and male gonads were recovered. We observed that DES-exposed males had testes positioned higher in the abdomen as compared to controls. This is consistent with a previous finding indicating that DES is inducing cryptorchidism (Emmen et al., 2000). For RNA analysis, testes from the same itter were pooled. Some testes were also recovered for histology, immunohistochemistry and/or measurement of testosterone levels. Experiments were conducted with the approval of the local committee on Animal Care, and in accordance with the European Guidelines (86/609/CEE). 2.2. RNA extraction, RT-PCR and semi-quantitative RT-PCR Procedures for RNA extraction and RT-PCR have been described elsewhere (Longin et al., 2001). Specific primers were designed using the Gene-Jockey computer software, and the optimal temperature of annealing for each pair of primers was defined (Table 1). Negative controls contained water instead of cDNA. PCR with no RT-reactions gave no band, eliminating the possibility of a genomic DNA contamination in the RNA preparations. Amplified cDNAs were visualized in a 1.5% agarose gel stained with ethidium bromide. A DNA ladder (Promega, Charbonnières, France) was loaded on each gel. PCR products were sequenced by Biofidal (Lyon, France). Conditions for reliable semi-quantitative RT-PCR have been optimized for each series of primers as described elsewhere (Guyot et al., 2003). Briefly, 0.5 ␮g of RNA was reverse-transcribed and the resulting cDNA samples were standardized by PCR using Hypoxanthine PhosphoRibosyl Transferase (HPRT). The number of cycles for each gene was adjusted in test experiments to be within the linear range of detection. Linearity of the signal was yielded using 30–60 ng RNA and running 22–26 cycles in the presence of alpha-33P dATP (0.75 ␮Ci; 2500 Ci/mmol)

R. Guyot et al. / Molecular and Cellular Endocrinology 220 (2004) 67–75

69

Table 1 List and sequence of the designed specific primers for PCR studies Studied genes and their accession number

Primers (5 → 3 )

Size (bp)

Optimal temperature (◦ C)

Cycle numbers

3␤-HSD (M58567) 3 beta-hydroxysteroid dehydrogenase type I

s: ACTGCAGGAGGTCAGAGCT

565

67

26

as: GCCAGTAACACACAGAATACC 5␣-Reductase I (NM 175283)

s: GCTATGGAGTTGGATGAGTTGC as: CAGTCTTCAGCATACACCGC

427

62

26

AMH (NM 007445) anti-Müllerian hormone

s: TGACAGTGAGAGGAGAGG as: TATCACTTCAGCCAGATGTAGG

247

60

24

AhR (D38417) arylhydrocarbon receptor

s: GTTGTCACAGCAGATGCCTTGG as: TGGCTGAAGTGGAGTAGC

431

65

25

AR (NM 013476) androgen receptor

s: TACATGTGGTCAAGTGGG as: TGTGTGGAAATAGATGGG

390

63

28

DAX-1 (NM 007430) dosage-sensitive sex reversal, Adrenal hypoplasia congenita, critical region on the X chromosome

s: CTGCTGAGATTCATCAATAGCG

303

57

25

Dhh (NM 007857) Desert Hedgehog

s: TCAAGGATGAGGAGAACAGCG as: ACCATACTTATTACGGTCACGG

224

63

26

DMRT-1 (AF202778) doublesex and mab3-related transcription factor

s: TTGTCTGCTGAGTCCTCC

375

69

26

as: TCACAAGAAGCCAGTATGGAG

as: AGGACGCAGACTCACATTCC ER␣ (NM 007956) estrogen receptor α

s: AATTCTGACAATCGACGCCAG as: GTGCTTCAACATTCTCCCTCCT

347

65.2

27

ER␤ (NM 010157) estrogen receptor β

s: CTTGCCTGTAAACAGAGAGACC as: GACGGCTCACTAGCACATTGG

508

65.2

31

GATA-4 (AF179424) transcription factor of the GATA family

s: CCTCTATCACAAGATGAACGGC

339

67.2

24

NGFR (NM 033217) nerve growth factor receptor

s: ACCGCTGACAACCTCATTCC

276

63

26

as: AGTGGCATTGCTGGAGTTACCG

as: TACTGTAGAGGTTGCCATCACC Oct-4 (X52437) octamer-binding protein 4

s: ACCAGGCTCAGAGGTATTGG as: TCCACCTTCTCCAACTTCACGG

230

69

27

P450c17 (NM 007809) cytochrome p450 17α-hydroxylase/C(17-20) lyase

s: GATACTGACCTACCATACAGACC

402

57

22

P450scc (NM 019779) cholesterol side-chain cleavage enzyme

s: GGAGCCATCAAGAACTTCGTGC

409

57

25

as: CCTCTTCACCTCAGGATTGTGC

as: TACTGGCTGAAGTCTCGC PCI (AH006766) Protein C Inhibitor

s: GTCTGGCATTACTGACCATACC as: GTCAATGATGAAGGATGAGAGC

430

60.5

26

SF-1 (S65878) Steroidogenic Factor-1

s: TCTCCAGACTCCACTGAAGC as: GCAGGAATGTTGGCTACACC

225

63

25

Sox-9 (AF421878) SRY-related high-mobility group box 9

s: TCCAGCAAGAACAAGCCACACG

270

55

24

511

66

26

585

56

26

243

69

24

253

62.5

29

354

65

24

as: CTTGTCCGTTCTTCACCG StAR (L36062) Steroidogenic Acute Regulatory protein

s: GCATACTCAACAACCAGGAAGG as: CTGGTTGATGATTGTCTTCGGC

TIMP-1 (NM 011593) tissue inhibitor of metalloproteinases type 1

s: CTGGCATCCTCTTGTTGCTA as: AGGGATCTCCAGGTGCACAA

TIMP-2 (M93954) tissue inhibitor of metalloproteinases type 2

s: ATCAGAGCCAAAGCAGGTGAGCG

Wnt4 (NM 009523) wingless-related MMTV integration site 4

s: TCTTCACAACAACGAGGCTGGC

as: GGTAATGTGCATCTTGCCATCTCC

as: CCAGGTCCTCATCTGTATGTGG HPRT (J00423) Hypoxanthine PhosphoRibosyl Transferase

s: CCTGCTGGATTACATTAAAGCACTG as: GTCAAGGGCATATCCAACAACAAAC

The size of the expected PCR fragments is reported in base pairs (bp) and the optimal temperature for annealing is in centigrades (◦ C). The number of cycle for each gene is indicated. s, sense; as, antisense.

70

R. Guyot et al. / Molecular and Cellular Endocrinology 220 (2004) 67–75

(Amersham Pharmacia Biotech Europe GmbH, Orsay, France). The number of cycles was higher than 26, in order to increase the intensity of the PCR signal obtained for 5 out of the 22 genes studied (Table 1). The PCR products were resolved by 8% polyacrylamide gel electrophoresis in 1× Tris–Borate EDTA (TBE) buffer. Gels were transferred to filter paper, dried and exposed for 5 h to Kodak biomax MR1 films (Sigma). The band densities were determined by scanning densitometric analysis (Alcatel TITN ANSWARE, Massy, France). 2.3. Extraction of mitochondrial proteins and Western blot analysis Mitochondrial proteins were extracted from 18.5 dpc testes. Briefly, 10 testes were homogenized at 4 ◦ C into 300 ␮l of a buffer containing 100 mM Tris–HCl (pH 7.2), 250 mM sucrose, 0.1 mM EDTA, 1 mM PMSF. The homogenate was centrifuged at 500 × g for 25 min to remove debris and the resulting supernatant was further centrifuged at 10,000 × g for 25 min. The pellet containing mitochondria was washed twice at 9000 × g for 15 min in the same buffer (Manna et al., 1999). Proteins were next extracted in PBS containing 1% NP-40 and 5 mM EDTA, and protein levels were measured by BCA protein assay (Pierce, Interchim, France). SDS-PAGE (10%) and Western blotting were carried out as reported elsewhere (Longin et al., 2001; Guyot et al., 2003), and two independent experiments were performed. Antibodies were an anti-StAR antibody (dilution 1:6000; a gift from D.M. Stocco), and an anti-rabbit IgG (dilution 1:2000) conjugated to peroxydase (Dako S.A., Trappes, France). Precision protein standards (Biorad, Hercules, CA) were loaded for estimation of the Mr of the bands, which were revealed using an ECL+ chemiluminescent detection system (Amersham). 2.4. Histology and immunohistochemistry The tissues were fixed overnight at 4 ◦ C in 0.1 M phosphate buffer, pH 7.4, containing 4% formaldehyde plus 10% picric acid, and embedded in Paraplast. Serial 5 ␮m sections were cut, mounted onto gelatinized slides, and deparaffinized. For histology, slides were stained with routine Papanicolaou stain. For indirect immunoperoxidase staining (Deltour et al., 1991; Guyot et al., 2003), the sections were pretreated for 5 min with 0.3% hydrogen peroxide, rinsed and blocked for 15 min in 5% milk. Then they were sequentially incubated with primary antibody overnight at 4 ◦ C, anti-rabbit IgG conjugated to peroxidase at a 1:500 dilution for 1 h at room temperature, and diaminobenzidine (DAB) solution. Specificity of the staining was assessed as described elsewhere (Deltour et al., 1991; Guyot et al., 2003). Primary antibodies used in this study include a rabbit anti-mouse type 1 3␤-HSD diluted 1:200 (a gift from I. Mason), and a rabbit anti-SF-1 diluted 1:200 (a gift from K. Morohashi). Sections incubated in the absence of the

primary antibody remained unstained. The experiment was performed with control and DES-treated tissues that were recovered from two independent experiments. 2.5. Measurement of testosterone production Intratesticular testosterone levels were assayed by a specific radioimmunoassay (RIA) after ethyl ether extraction, followed by chromatographic purification on Celite columns, as previously described (Forest, 1979). Precisely, the paired testes of fetuses exposed or not to DES were homogenized together into 0.1 M phosphate buffer, and two independent series of experiments were performed. 2.6. Statistics All values are the means ± S.E.M. The significance of the differences between the mean values of the treated and untreated controls was evaluated using ANOVA and the Mann–Whitney U-test. Differences are accepted as significant at P < 0.05.

3. Results 3.1. Effect of DES on the testicular morphology and on the intratesticular testosterone levels No morphologic changes were noted at 18.5 dpc in the testes of the DES [50] group, and the gross histology was comparable with the control group (Fig. 1a and b), consistent with earlier observations (Majdic et al., 1996; Nef et al., 2000). Also consistent with earlier observations (Sharpe, 2003), DES induced a significant (P < 0.05) decrease in the intratesticular testosterone levels. Precisely, control testes had 384 ± 147 ng testosterone/testis (n = 4 paired testes), and DES [10]-treated testes exhibited 74 ± 13 ng testosterone/testis (n = 4 paired testes). 3.2. Effect of DES on testicular gene expression Three experiments of injection of DES [100] to pregnant mice were performed with three to five animals per group. The 22 genes studied by RT-PCR are listed in Table 1. The data are summarized in Table 2, and gels for SF-1, DAX1, StAR and the steroidogenic enzyme genes are shown in Fig. 2. The RT-PCR band for SF-1 did not vary between the controls and the DES-treated, nor did change the levels for AMH/MIS, 3␤-HSD and P450scc which are three target genes for SF-1. By contrast, StAR and the P450c17 which are two other target genes for SF-1, had their expression markedly altered. The intensity of the PCR bands were significantly reduced, and they were 31 and 62% in the DES [100]-exposed testes as compared to controls (arbitrary fixed to 100%), for StAR and P450c17 respectively (Table 2,

R. Guyot et al. / Molecular and Cellular Endocrinology 220 (2004) 67–75

71

Fig. 1. Histological and immunohistochemical localisation of the 3␤-HSD and of SF-1 in 18.5 dpc testes exposed (b, d, f) or not (a, c, e) to DES [50]. The gross histology of the testes exposed to DES in (b) was comparable to the control testes shown in (a). At that age, the testis comprises the interstitium (I) containing Leydig cells positive for 3␤-HSD (arrowheads in c and d) and for SF-1 (arrowheads in e and f), and the seminiferous cords (SC). A positive immunostaining for SF-1 (short arrows in e and f) is also present in the Sertoli cell nuclei within the seminiferous cords. No evident alteration in the pattern of immunostaining for 3␤-HSD (c and d) or for SF-1 (e and f) is observed in the DES-exposed testes (d and f) as compared to the control testes (c and e). Bar, 90 ␮m.

Fig. 2). We also examined transcription factors other than SF-1 and potentially regulating/interfering with StAR expression such as DAX-1, GATA-4, and AhR (Stocco et al., 2001). None of them had its expression affected follow-

ing a DES [100]-exposure (Table 2, Fig. 2). The expression of the 5alpha-reductase was unchanged. Finally, genes encoding markers of Sertoli cells (Dhh and Sox-9), of Sertoli and germ cells (DMRT-1), of germ cells (Oct-4), of

Table 2 Effect of an in-utero exposure to DES on the expression of the 21 selected genes

Three experiments were carried out with three to five animals per group. Data obtained by scanning the autoradiographs were normalized to the HPRT signal, and values are the means ± S.E.M. ND, not determined. In grey, genes for which the autoradiographs are shown in Fig. 2. ∗ P < 0.05, as compared to control values.

72

R. Guyot et al. / Molecular and Cellular Endocrinology 220 (2004) 67–75

Fig. 3. Western blot analysis of StAR using mitochondrial proteins (15 ␮g per lane) prepared from control (lanes 1-3) or DES-exposed testes (DES; lanes 4–7) of 18.5 dpc. Adrenal (Ad) was used as a positive tissue. Lane 4, DES [10]; lanes 5–7, DES [100].

3.4. Western blot study of StAR

Fig. 2. RT-PCR analysis of SF-1, DAX-1, StAR, 3␤-HSD, P450c17 and P450scc using total RNA extracted from 18.5 dpc testes exposed (DES) or not (C, control) in utero to DES [100]. Three experiments were performed (Experiment 1, Experiment 2, Experiment 3), and three to five animals were used for each experiment. Testes removed from fetuses of the same litter were pooled, total RNA was extracted, and a semi-quantitative RT-PCR was developed. HPRT was used as an internal control. A representative gel is shown for each gene examined in the Experiment 1 and Experiment 2. In the Experiment 3, SF-1 and StAR were the only genes examined. ND, not determined.

peritubular cells (NGFR), and of Leydig cells (PCI) remained constant; the expression of Wnt4, of the receptors ER␣, ER␤, and AR remained also constant; inhibitors of proteases that we described as being potentially markers of the sexual differentiation program (Guyot et al., 2003; Odet et al., 2004) did not either change following a DES [100]exposure (Table 2). 3.3. Immunohistochemistry of 3β-HSD and SF-1 To extend our RT-PCR data on SF-1, we performed immunohistochemical studies using anti-SF-1 and anti3␤-HSD antibodies. Sections were recovered from male gonads of 18.5 dpc fetuses exposed or not in-utero to DES. As expected, SF-1 immunostaining was detected in the nuclei of Sertoli cells and Leydig cells, and Leydig cells had a stronger labeling signal than Sertoli cells (Morohashi, 1999; Swain and Lovell-Badge, 1999). We also used antibodies to 3␤-HSD to identify Leydig cells. No obvious differences were observed in the number of positive interstitial cells labeled with 3␤-HSD and SF-1 in the DES-exposed testes (Fig. 1d and f) as compared to the control testes (Fig. 1c and e). Sertoli cells were also equally immunostained for SF-1 in the DES-exposed and the control testes (Fig. 1e and f). Data presented in Fig. 1b, d and f have been obtained with an exposure of 50 ␮g/kg.

In a next step, mitochondrial proteins were prepared from control and DES-exposed testes, and a Western blot analysis was performed using anti-StAR antibodies. Adrenals were used as a positive tissue. As expected (Clark et al., 1994), StAR migrated as a single band of 30 kDa. Interestingly, the intensity of the StAR signal declined strongly in the DESexposed samples. It was very weak in the testes exposed in utero to DES [10], and became undetectable in samples exposed to DES [100] (Fig. 3).

4. Discussion In the present study, we found that 18.5 dpc testes exposed in-utero to DES from 10.5 to 17.5 dpc expressed SF1 at control levels. Further, we demonstrated that only two genes were altered among the 22 genes selected for being representative for the different testicular cell lineages and/or the state of differentiation of 18.5 dpc mouse testes. These genes are SF-1 target genes, and they encode StAR and the P450c17. Given that their rate of expression determines the extent of steroidogenesis, their alteration is consistent with the decrease in the intratesticular testosterone levels in the DES-exposed testes. Synthesis of testosterone is dependent upon the expression of highly regulated genes, including those encoding StAR and P450c17, and of largely constitutive enzymes such as 3␤-HSD type I. StAR controls the rate-limiting step in steroidogenesis, that is the transport of cholesterol from the outer to the inner mitochondrial membrane, even though some synthesis of testosterone independent of StAR has also been demonstrated (see in Stocco, 2002). Interestingly, the presence of StAR transcripts in testis is directly correlated with the activity of steroidogenesis (Stocco, 2002), and during mouse embryonic development, StAR expression parallels the appearance of the fetal Leydig cells (Clark et al., 1995; Odet et al., 2004). In addition, StAR knockout male mice are phenotypically sex reversed with testes located in the inguinal canal (see in Stocco, 2002). Nonetheless, the early deleterious effects of DES on StAR expression in fetal Leydig cells have never been studied to date.

R. Guyot et al. / Molecular and Cellular Endocrinology 220 (2004) 67–75

In the present study, we found that StAR expression tracked by RT-PCR and Western blot analyses, was strongly reduced in the DES-exposed testes. Furthermore, our data are consistent with a decrease in the capacity of Leydig cells to synthesize testosterone rather than in a decrease in the number of the fetal population of Leydig cells in the DES-exposed testes. Indeed, the gross histology of the DES-exposed testes was normal. The expression levels of a large number of specific testicular cell markers including PCI, a very early marker of the Leydig cell lineage (Odet et al., 2004) remained unaltered. Also, the expression of the 3␤-HSD type I gene monitored through RT-PCR and immunohistochemistry did not vary. Given that this gene encodes a constitutive enzyme of the steroidogenic pathway, its level of expression reflects the number of Leydig cells. We next examined the expression of transcription factors including SF-1 and those regulating and/or interfering with StAR expression: DAX-1, GATA-4 and AhR (Christenson and Strauss, 2001; Stocco et al., 2001). Inasmuch as DAX-1 works as a negative regulator of SF-1, and as both DAX-1 and SF-1 interact and regulate Insl3, P450c17 and StAR (Stocco et al., 2001; Koskimies et al., 2002; Lalli and Sassone-Corsi, 2003), we did expect some alteration in either one of these two regulators. However, we could not find any. In addition, we had no evident modification in the intensity of the SF-1 positive immunostaining nor in the number of the SF-1 positive cells in the DES-exposed testes as compared to control testes. These data confirmed a previous study performed in the mouse (Emmen et al., 2000). In contrast, Majdic et al. (1997) demonstrated a decrease in the expression of SF-1 in the testes of DESexposed rat fetuses, although in their study and consistent with us, P450scc remained unchanged. In addition, other endocrine disruptors including the phtalates may also disrupt steroidogenesis in fetal Leydig cells through acting on the expression of StAR and P450c17 without affecting the expression of SF-1 (Thompson et al., 2004). Given that multiple elements are involved in the regulation of the StAR gene (the CCAAT/enhancer binding proteins, Sp1, SREBP and CREB) (Stocco et al., 2001), it might be helpful to determine the rate of synthesis of these elements as a means to further understand the mechanism(s) by which DES acts on StAR gene expression. We also observed that the ERs and the AR remained unaffected in the DES-exposed testes, in contrast to previous reports (Tena-Sempere et al., 2000; Shibayama et al., 2001; Sharpe, 2003). Such a discrepancy is probably related to the timing to which testes have been exposed to DES, i.e. an inutero versus a neonatal exposure. Indeed, the fetal but not the adult population of Leydig cells develop normally in the absence of androgen receptors (Tfm mice; O’Shaughnessy et al., 2002). In addition, androgen receptors appear late, on and after 17 dpc in the rat testis (Majdic et al., 1995). With respect to the estrogen receptors, it is of interest to note that estrogen receptors are present early in gonad development, and the two main sites of synthesis are Leydig

73

cells for the ER␣, and gonocytes and Sertoli cells for the ER␤ (O’Donnell et al., 2001; Sharpe, 2003). Nonetheless, mice deleted for the ER␣ (␣ERKO; Eddy et al., 1996), ER␤ (Krege et al., 1998) or both (Couse et al., 1999) develop a grossly normal testis at birth. Whether the fetal testis is expressing the estrogen and androgen receptors in a constitutive fashion whereas the expression of these receptors in the postnatal testis would be sensitive to the environmental steroids might be a valuable hypothesis to further investigate. The precise cellular and molecular mechanisms underlying the action of DES in fetal testes are not fully understood. However some recent in vivo (Akingbemi et al., 2003) and in vitro (Lassurguère et al., 2003) experiments using the ICI 182,780 to counteract the estrogenic effects on testes support that ER␣ has a regulatory role in Leydig cell steroidogenic function. It would be of interest to examine the expression of the P450c17 and StAR in the adrenals of the DES-exposed fetuses, given that adrenals contain also estrogen receptors (Kuiper et al., 1997; Nagel et al., 2001).

Acknowledgements We are indebted to Drs. Douglas Stocco (Texas University, Lubbock, Texas), Ian Mason (University of Edinburgh, Scotland, UK) and Ken-Ichirou Morohashi (National Institute for Basic Biology, Myodaiji-cho, Okazaki, Japan) for providing us with the anti-StAR, anti-3␤-HSD and anti-SF-1 antibodies, respectively. We thank Marie-Pierre Monneret for technical assistance. This work was funded by Inserm and the “Ministère de l’Aménagement du Territoire et de l’Environnement” (MATE AC014G to BLMB). Romain Guyot is funded by MATE and Organon (Azko Nobel, France). Fanny Odet is funded by the “Ministère de la Recherche et de la Technologie” (MRT).

References Akingbemi, B.T., Ge, R., Rosenfeld, C.S., Newton, L.G., Hardy, D.O., Catterall, J.F., Lubahn, D.B., Korach, K.S., Hardy, M.P., 2003. Estrogen receptor-␣ gene deficiency enhances androgen biosynthesis in the mouse Leydig cells. Endocrinology 144, 84–93. Christenson, L.K., Strauss 3rd, J.F., 2001. Steroidogenic acute regulatory protein: an update on its regulation and mechanism of action. Arch. Med. Res. 32, 576–586. Clark, B.J., Wells, J., King, S.R., Stocco, D.M., 1994. The purification, cloning, and expression of a novel luteinizing hormone-induced mitochondrial protein in MA-10 mouse Leydig tumor cells. Characterization of the steroidogenic acute regulatory protein (StAR). J. Biol. Chem. 269, 28314–28322. Clark, B.J., Soo, S.C., Caron, K.M., Ikeda, Y., Parker, K.L., Stocco, D.M., 1995. Hormonal and developmental regulation of the steroidogenic acute regulatory protein. Mol. Endocrinol. 9, 1346–1355. Couse, J.F., Hewitt, S.C., Bunch, D.O., Sar, M., Walker, V.R., Davis, B.J., Korach, K.S., 1999. Postnatal sex reversal of the ovaries in mice lacking estrogen receptors alpha and beta. Science 286, 2328–2331.

74

R. Guyot et al. / Molecular and Cellular Endocrinology 220 (2004) 67–75

Deltour, L., Leduque, P., Paldi, A., Ripoche, M.A., Dubois, P., Jami, J., 1991. Polyclonal origin of pancreatic islets in aggregation mouse chimaeras. Development 112, 1115–1121. Eddy, E.M., Washburn, T.F., Bunch, D.D., Goulding, E.H., Gladen, B.C., Lubahn, D.B., Korach, K.S., 1996. Targeted disruption of the estrogen receptor gene in male mice causes alteration of spermatogenesis and infertility. Endocrinology 137, 4796–4805. Emmen, J.M., McLuskey, A., Adham, I.M., Engel, W., Verhoef-Post, M., Themmen, A.P., Grootegoed, J.A., Brinkmann, A.O., 2000. Involvement of insulin-like factor 3 (Insl3) in diethylstilbestrol-induced cryptorchidism. Endocrinology 141, 846–849. Fielden, M.R., Halgren, R.G., Fong, C.J., Staub, C., Johnson, L., Chou, K., Zacharewski, T.R., 2002. Gestational and lactational exposure of male mice to diethylstilbestrol causes long-term effects on the testis, sperm fertilizing ability in vitro, and testicular gene expression. Endocrinology 143, 3044–3059. Forest, M.G., 1979. Plasma androgens (testosterone and 4androstenedione) and 17-hydroxyprogesterone in the neonatal, prepubertal and peripubertal periods in the human and the rat: differences between species. J. Steroid. Biochem. 11, 543–548. Gill, W.B., Schumacher, G.F., Bibbo, M., Strauss, F.H.D., Schoenberg, H.W., 1979. Association of diethylstilbestrol exposure in utero with cryptorchidism, testicular hypoplasia and semen abnormalities. J. Urol. 122, 36–39. Guyot, R., Magre, S., Leduque, P., Le Magueresse-Battistoni, B., 2003. Differential expression of tissue inhibitor of metalloproteinases type 1 (TIMP-1) during mouse gonad development. Dev. Dyn. 227, 357–366. Haavisto, T., Nurmela, K., Pohjanvirta, R., Huuskonen, H., El-Gehani, F., Paranko, J., 2001. Prenatal testosterone and luteinizing hormone levels in male rats exposed during pregnancy to 2,3,7,8-tetrachlorodibenzop-dioxin and diethylstilbestrol. Mol. Cell. Endocrinol. 178, 169–179. Jameson, J.L., Achermann, J.C., Ozisik, G., Meeks, J.J., 2003. Battle of the sexes: new insights into genetic pathways of gonadal development. Trans. Am. Clin. Climatol. Assoc. 114, 51–65. Jeays-Ward, K., Hoyle, C., Brennan, J., Dandonneau, M., Alldus, G., Capel, B., Swain, A., 2003. Endocthelial and steroidogenic cell migration are regulated by WNT4 in the developing mammalian gonad. Development 130, 3663–3670. Josso, N., Racine, C., di Clemente, N., Rey, R., Xavier, F., 1998. The role of anti-Mullerian hormone in gonadal development. Mol. Cell. Endocrinol. 145, 3–7. Koskimies, P., Levallet, J., Sipila, P., Huhtaniemi, I., Poutanen, M., 2002. Murine relaxin-like factor promoter: functional characterization and regulation by transcription factors steroidogenic factor 1 and DAX-1. Endocrinology 143, 909–919. Krege, J.H., Hodgin, J.B., Couse, J.F., Enmark, E., Warner, M., Mahler, J.F., Sar, M., Korach, K.S., Gustafsson, J.A., Smithies, O., 1998. Generation and reproductive phenotypes of mice lacking estrogen receptor beta. Proc. Natl. Acad. Sci. U.S.A. 95, 15677–15682. Kuiper, G.G., Carlsson, B., Grandien, K., Enmark, E., Haggblad, J., Gustafsson, J.A., 1997. Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors alpha and beta. Endocrinology 138, 863–870. Lalli, E., Sassone-Corsi, P., 2003. DAX-1, an unusual orphan receptor at the crossroads of steroidogenic function and sexual differentiation. Mol. Endocrinol. 17, 1445–1553. Lassurguère, J., Livera, G., Habert, R., Jégou, B., 2003. Time- and doserelated effects of estradiol and diethylstilbestrol on the morphology and function of the fetal rat testis in culture. Toxicol. Sci. 73, 160– 169. Longin, J., Guillaumot, P., Chauvin, M.A., Morera, A.M., Le MagueresseBattistoni, B., 2001. MT1-MMP in rat testicular development and the control of Sertoli cell proMMP-2 activation. J. Cell. Sci. 114, 2125– 2134. Luo, X., Ikeda, Y., Parker, K.L., 1994. A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 77, 481–490.

Majdic, G., Millar, M.R., Saunders, P.T., 1995. Immunolocalisation of androgen receptor to interstitial cells in fetal rat testes and to mesenchymal and epithelial cells of associated ducts. J. Endocrinol. 147, 285–293. Majdic, G., Sharpe, R.M., O’Shaughnessy, P.J., Saunders, P.T., 1996. Expression of cytochrome P450 17alpha-hydroxylase/C17-20 lyase in the fetal rat testis is reduced by maternal exposure to exogenous estrogens. Endocrinology 137, 1063–1070. Majdic, G., Sharpe, R.M., Saunders, P.T., 1997. Maternal oestrogen/xenoestrogen exposure alters expression of steroidogenic factor-1 (SF-1/Ad4BP) in the fetal rat testis. Mol. Cell. Endocrinol. 127, 91–98. Manna, P.R., Pakarinen, P., El-Hefnawy, T., Huhtaniemi, I.T., 1999. Functional assessment of the calcium messenger system in cultured mouse Leydig tumor cells: regulation of human chorionic gonadotropininduced expression of the steroidogenic acute regulatory protein. Endocrinology 140, 1739–1751. Morohashi, K., 1999. Gonadal and extragonadal functions of Ad4BP/SF1: developmental aspects. Trends Endocrinol. Metab. 10, 169–173. Nagel, S.C., Hagelbarger, J.L., McDonnell, D.P., 2001. Development of an ER action indicator mouse for the study of estrogens, selective ER modulators (SERMs), and xenobiotics. Endocrinology 142, 4721– 4728. Nef, S., Shipman, T., Parada, L.F., 2000. A molecular basis for estrogeninduced cryptorchidism. Dev. Biol. 224, 354–361. Odet, F., Guyot, R., Leduque, P., Le Magueresse-Battistoni, B., 2004. Evidence for similar expression of Protein C Inhibitor and the urokinasetype plasminogen activator system during mouse testis development. Endocrinology 145, 1481–1489. O’Donnel, L., Robertson, K.M., Jones, M.E., Simpson, E.R., 2001. Estrogen and spermatogenesis. Endocr. Rev. 22, 289–318. O’Shaughnessy, P.J., Johnston, H., Willerton, L., Baker, P.J., 2002. Failure of normal adult Leydig cell development in androgen-receptordeficient mice. J. Cell. Sci. 115, 3491–3496. Parker, K.L., Schimmer, B.P., 1997. Steroidogenic factor 1: a key determinant of endocrine development and function. Endocr. Rev. 18, 361–377. Schultz, R., Suominen, J., Varre, T., Hakovirta, H., Parvinen, M., Toppari, J., Pelto-Huikko, M., 2003. Expression of aryl hydrocarbon receptor and aryl hydrocarbon receptor nuclear translocator messenger ribonucleic acids and proteins in rats and human testis. Endocrinology 144, 767–776. Sharpe, R.M., 2003. The ‘oestrogen hypothesis’—where do we stand now? Int. J. Androl. 26, 2–15. Shibayama, T., Fukata, K., Adachi, T., Komiyama, M., Igushi, T., Mori, C., 2001. Neonatal exposure to genistein reduces expression of estrogen receptor alpha and androgen receptor in testes of adult mice. Endocr. J. 48, 655–663. Stocco, D.M., Clark, B.J., Reinhart, A.J., Williams, S.C., Dyson, M., Dassi, B., Walsh, L.P., Manna, P.R., Wang, X., Zeleznik, A.J., Orly, J., 2001. Elements involved in the regulation of the StAR gene. Mol. Cell. Endocrinol. 177, 55–59. Stocco, D.M., 2002. Clinical disorders associated with abnormal cholesterol transport: mutations in the steroidogenic acute regulatory protein. Mol. Cell. Endocrinol. 191, 19–25. Swain, A., Lovell-Badge, R., 1999. Mammalian sex determination: a molecular drama. Genes Dev. 13, 755–767. Tena-Sempere, M., Navarro, J., Pinilla, L., Gonzalez, L.C., Huhtaniemi, I., Aguillar, E., 2000. Neonatal exposure to estrogen differentially alters receptor alpha and beta mRNA expression in rat testis during postnatal development. J. Endocrinol. 165, 345–357. Thompson, C.J., Ross, S.M., Gaido, K.W., 2004. Di(n-butyl)phthalate impairs cholesterol transport and steroidogenesis in the fetal rat testis through a rapid and reversible mechanism. Endocrinology 145, 1227– 1237. Toppari, J., Larsen, J.C., Christiansen, P., Giwercman, A., Grandjean, P., Guillette Jr., L.J., Jegou, B., Jensen, T.K., Jouannet, P., Keiding, N., Leffers, H., McLachlan, J.A., Meyer, O., Muller, J., Rajpert-De Meyts,

R. Guyot et al. / Molecular and Cellular Endocrinology 220 (2004) 67–75 E., Scheike, T., Sharpe, R., Sumpter, J., Skakkebaek, N.E., 1996. Male reproductive health and environmental xenoestrogens. Environ. Health Perspect. 104, 741–803. Visser, J.A., McLuskey, A., Verhoef-Post, M., Kramer, P., Grootegoed, J.A., Themmen, A.P., 1998. Effect of prenatal exposure to

75

diethylstilbestrol on Mullerian duct development in fetal male mice. Endocrinology 139, 4244–4251. Zimmermann, S., Schwarzler, A., Buth, S., Engel, W., Adham, I.M., 1998. Transcription of the Leydig insulin-like gene is mediated by steroidogenic factor-1. Mol. Endocrinol. 12, 706–713.