- Email: [email protected]
Difference in DNA methylation levels of gastric c-myc, p16, and hMLH1among traditional Chinese medical syndromes for chronic atrophic gastritis
European Journal of Integrative Medicine 21 (2018) 82–87
Contents lists available at ScienceDirect
European Journal of Integrative Medicine journal homepage: www.elsevier.com/locate/eujim
Research paper
Difference in DNA methylation levels of gastric c-myc, p16, and hMLH1among traditional Chinese medical syndromes for chronic atrophic gastritis Danli Caia, Zhiyun Chena, Xiaobing Doub, Jing Qiuc, Qingsheng Liud,
T
⁎
a
Department of ICU, The First Affiliated Hospital of Zhejiang Chinese Medical University, Hangzhou, Zhejiang, 310006, China College of Life Science, Zhejiang Chinese Medical University, Hangzhou, Zhejiang, 310053, China c Zhejiang Chinese Medical University, Hangzhou, Zhejiang, 310053, China d Department of digestive, Hangzhou Traditional Chinese Medical Hospital, Hangzhou, Zhejiang, 310006, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Chronic atrophic gastritis DNA methylation TCM syndromes
Introduction: This study aimed to evaluate the difference in DNA methylation levels of c-myc, p16, and hMLH1 among traditional Chinese medicine (TCM) syndromes and also investigate the relationship between chronic atrophic gastritis (CAG). Methods: A total of 192 patients endoscopically diagnosed with CAG TCM syndromes were selected based on previous questionnaire studies. Pyrosequencing was used to detect DNA methylation of gastric c-myc, p16, and hMLH1 genes. The difference and correction in DNA methylation levels of gastric c-myc, p16, and hMLH1 genes in different TCM syndromes were analyzed. Results: The methylation rate of c-myc and p16 genes among different TCM syndromes showed significant differences. The descending order for the methylation rates of c-myc gene was as follows: stomach heat impairing yin > stasis toxin stagnation > phlegm–dampness coagulation > deficiency of cold in spleen and stomach > deficiency of qi and blood > liver–stomach disharmony. The descending order for p16 gene was as follows: liver–stomach disharmony > deficiency of cold in spleen and stomach > deficiency of qi and blood > stomach heat impairing yin > stasis toxin stagnation. Conclusions: The methylation rates of c-myc and p16 genes, but not hMLH1 gene, were correlated with different TCM syndromes. Attention and vigilence should be paid to individuals with liver–stomach disharmony, deficiency of qi and blood, and deficiency of cold in spleen and stomach who may be at risk of developing gastric cancer. Regular follow-up with endoscopy and gastric mucosal pathology examination is required for early treatment and prevention of gastric cancer.
1. Introduction The incidence of gastric cancer is high in China. Each year, about 15–16 million people die from gastric cancer, and its mortality rate ranks first among various malignant tumors. Chronic atrophic gastritis (CAG) is a chronic disease characterized by unknown etiology of gastric epithelial and glandular atrophy, mucosal thinning, mucosa and muscle thickening associated with intestinal metaplasia, and dysplasia. CAG is an important stage in the occurrence and progression from normal mucosa to gastric cancer. The occurrence rate of CAG with intestinal metaplasia or dysplasia is 7%–9%, indicating a positive correlation. In the case of glandular atrophy and chronic inflammation in gastric tissue, hypermethylation of the tumor suppressor gene promoter of the
⁎
mucosal cells occurs, and the expression of the tumor suppressor protein is low [1]. Gastric mucosa is a site in the human body that has early contact with various harmful substances. Moreover, mucosal epithelial cells react strongly and rapidly to these substances. Therefore, it has become important to detect and correct DNA methylation abnormality and reduce the incidence of gastric cancer at the early stage for preventing and reversing CAG. The p16 gene is one of the most important tumor suppressor genes. In gastric cancer, the change in the expression of p16 is not caused by gene mutations or deletions but by methylation of the promoters. The frequency of methylation in CAG, intestinal metaplasia, gastric adenoma, and gastric cancer gradually increases, which reflects the evolution of cancer and also proves that it is an early event. The c-myc gene
Corresponding author at: Department of Digestive, Hangzhou Traditional Chinese Medical Hospital, Hangzhou, Zhejiang, 310006, China. E-mail addresses: [email protected] (D. Cai), [email protected] (Z. Chen), [email protected] (X. Dou), [email protected] (Q. Liu).
https://doi.org/10.1016/j.eujim.2018.07.001 Received 16 April 2018; Received in revised form 15 June 2018; Accepted 9 July 2018 1876-3820/ © 2018 Elsevier GmbH. All rights reserved.
European Journal of Integrative Medicine 21 (2018) 82–87
D. Cai et al.
2012LH002)
is an oncogene with highly conserved DNA-binding protein. The expression of c-myc protein in early gastric cancer and CAG is significantly higher than that in chronic nonatrophic gastritis, suggesting that the overexpression of c-myc protein is closely related to precancerous lesions and gastric cancer. hMLH1 is a DNA mismatch repair gene that can inhibit the occurrence of gastric cancer. Its dysfunction may lead to defects in cell mismatch repair function resulting in an increase in whole genomic instability, thereby leading to tumor suppressor gene inactivation and oncogene activation. Previous studies have shown methylation of hMLH1 to be involved in the progression of early gastric cancer; for instance, the frequency of methylation of hMLH1 in cancer tissue was shown to be 42.2%, which was more frequent compared with 2.1% in intestinal metaplasia and 11.5% in adenoma [2]. Abnormal methylation of CpG island in the promoter region of hMLH1 gene is the main cause of the lack of protein expression. Currently, studies on CAG TCM syndromes are scarce. In this study, DNA methylation of c-myc, p16, and hMLH1 was considered as a starting point, and pyrosequencing was used to detect the DNA methylation level of c-myc, p16, and hMLH1 in the gastric mucosa of CAG patients confirmed by histopathology. This study also compared the difference in DNA methylation level for gastric mucosa p16, c-myc, and hMLH1, and analyzed their correlation with CAG TCM syndromes.
2.3. Experimental materials and methods 2.3.1. Collection of specimens Gastroscopy was performed for the observed subjects, and antrum, gastric angle, or gastric body mucosa was used to conduct the pathological tissue biopsy. The fresh specimens were placed in the Eppendorf tube and stored in liquid nitrogen immediately. DNA methylation of c-myc, p16, and hMLH1 in mucosal tissue was detected using pyrosequencing, and the operations strictly followed the instructions on the kit. For pyrosequencing, 2 μL of reaction haptoglobin was added into the 96-well polymerase chain reaction (PCR) plate, and mixed with 38 μL of buffer and 40 μL of PCR product for 10 min at room temperature. The vacuum pump was turned on to draw the suspension of haptoglobin and PCR product, which were then sequentially rinsed with 70% ethanol, 0.2 mL of NaOH, and buffer for 5 s. The vacuum pump was closed, haptoglobin and PCR product were mixed with 40 μL of annealing buffer (including sequencing primer 1.5 μL), and denaturation was performed for 2 min at 85 °C. Finally, the sample was cooled down to room temperature, which resulted in annealing and hybridization of the primer and template. According to the pyrosequencing software, sequence-designed information was used to calculate the dose. Then, the substrate mixture, a mixture of enzyme, and four kinds of dNTP (Qiagen) were sequentially added in the reagent capsule. Next, the reagent capsule and 96-well plate were placed in the pyrosequencing detector (PyroMark Q96 ID, Qiagen) to conduct the reaction. The Pyro Q-CpG software was used to analyze and obtain methylation quantitative data for each site. Primer synthesis is shown in Table 1.
2. Materials and methods 2.1. General information A total of 192 patients with CAG confirmed by electronic gastroscopy and gastric mucosal biopsy were selected from the outpatient and hospitalized patients in our hospital from January 2013 to January 2016 (Fig. 1). According to the “Chinese clinical research guidelines for new drug,” these patients were divided into groups with different syndromes, including liver–stomach disharmony, stasis toxin stagnation, phlegm–dampness coagulation, deficiency of cold in spleen and stomach, stomach heat impairing yin, and deficiency of qi and blood. Among these 192 patients, 98 patients were males and 94 females; the youngest was 30 years old, and the oldest 75 years old (average age, 60.94 ± 11.14 years). The age and gender among the different syndrome groups were not statistically significant as confirmed using the chi-square test (P > 0.05). This study was approved by the ethics committee of the hospital.
2.4. Statistical analysis The SPSS 18.0 statistical analysis software (SPSS Inc., IL, USA) was used to analyze the data. The two-tailed test was used for statistics, and α = 0.05 was the significance level. Continuous data were evaluated using mean (x−) ± standard deviation. The normality test and variance homogeneous test were conducted; if they conformed to the normal distribution, then single factor variance analysis of multigroup mean value comparison was used; otherwise, nonparametric test was used. The Spearman ranking method was used for correlation analysis. Categorical data were presented by cases, and the nonparametric Kruskal–Wallis test was performed.
2.2. Inclusion and exclusion criteria of the patients The inclusion criteria were as follows: (1) CAG patients who met the diagnostic criteria (male or female), (2) patients aged between 18 and 75 years, (3) patients who had not taken proton pump inhibitors or antibiotics during the last 4 weeks, and (4) patients who voluntarily participated in the study and signed informed consent. The exclusion criteria were as follows: (1) patients who had a history of gastric surgery or (2) patients diagnosed with gastric cancer. This study has been approved by the medical ethics committee of the Hangzhou Traditional Chinese Medical Hospital (Number:
3. Results Using the chi-square test, no statistically significant difference in age was found among different CAG TCM syndromes statistically significant (χ2 = 4.46, P > 0.05) (Table 2). Using single factor analysis of variance, no statistically significant difference was found in gender among the different CAG TCM syndromes (P > 0.05) (Table 3). Fig. 1. chronic atrophic gastritis with moderate intestinal metaplasia. Note: A. Mild chronic atrophic gastritis with moderate intestinal metaplasia (HE × 200). B. Moderate chronic atrophic gastritis with moderate intestinal metaplasia (HE × 200). C. Severe chronic atrophic gastritis with severe intestinal metaplasia (HE × 200).
83
European Journal of Integrative Medicine 21 (2018) 82–87
D. Cai et al.
Table 1 Primer synthesis.
Table 3 Comparison of gender between TCM different syndromes.
Name of primer
Sequence of primer (5' to 3')
5' Modification
P16-F P16-R P16-S c-myc-F c-myc-R c-myc-S mlh1-F mlh1-R mlh1-S
AGAGGATTTGAGGGATAGGG CTACCTACTCTCCCCCTCT GGGTTGGTTGGTTATTAG GGTAGGTTAGGGTGGAAGAGT ATCCCCAAATAAACAAAATAACCTC GGGTATTTTGTATTGGAATT GGTATTTTTGTTTTTATTGGTTGGATATTT AATACCAATCAAATTTCTCAACTCTAT TTTTAAAAAAGAATTAATAGGAAG
5' Biotin
5' Biotin
5' Biotin
Syndromes
Age
Liver–stomach disharmony Stasis toxin stagnation Phlegm–dampness coagulation Deficiency of qi and blood Deficiency of cold in spleen and stomach Stomach heat impairing yin
55.80 66.20 67.33 62.83 62.63 63.10
± ± ± ± ± ±
9.08 9.46 8.40 8.67 9.97 11.11
Note: TCM, traditional Chinese medicine. Table 4 Relationships of methylation rate of c-myc, p16, and hMLH1 genes between different syndromes of CAG TCM.
3.1. Relationship between different CAG TCM syndromes and methylation of c-myc gene Using single factor analysis of variance, this study found that the methylation rate of c-myc gene in different CAG TCM syndromes was statistically significant (P < 0.05). The methylation rate of c-myc gene in each syndrome in the descending order was as follows: stomach heat impairing yin > stasis toxin stagnation > phlegm–dampness coagulation > deficiency of cold in spleen and stomach > deficiency of qi and blood > liver–stomach disharmony. Pairwise comparison between the groups revealed a significant difference between phlegm–dampness coagulation, stomach heat impairing yin, stasis toxin stagnation, and liver–stomach disharmony (P < 0.05). A significant difference was found on comparing deficiency of cold in spleen and stomach with stomach heat impairing yin and stasis toxin stagnation (P < 0.05). Similarly, a significant difference was found on comparing deficiency of qi and blood with phlegm–dampness coagulation and stasis toxin stagnation (P < 0.05). Pairwise comparison between groups revealed a significant difference between stomach heat impairing yin, stasis toxin stagnation, and liver–stomach disharmony (P < 0.05). The nonparametric test found no significant difference in the methylation rate of hMLH1 gene in different CAG TCM syndromes (P > 0.05) (Table 4, Figs. 1–4).
Syndrome
N
c-myc
p16
hMLH1
Liver–stomach disharmony Deficiency of cold in spleen and stomach Deficiency of qi and blood Phlegm–dampness coagulation Stomach heat impairing yin Stasis toxin stagnation
32
4.13 ± 0.78
8.66 ± 2.95
2.01 ± 0.62
32
5.14 ± 1.26
7.78 ± 3.44
1.77 ± 1.22
32
4.78 ± 0.84
6.03 ± 1.70
2.63 ± 0.47
32
6.00 ± 1.41a
5.11 ± 2.03
2.31 ± 1.60
32
7.04 ± 1.46
abc
32
6.48 ± 1.53
abc
4.08 ± 1.03 3.81 ± 1.23
a
a
2.22 ± 1.28 1.98 ± 0.69
Note: a represents comparison with the group of liver–stomach disharmony, P < 0.05; b represents comparison with the group of deficiency of cold of spleen and stomach, P < 0.05; c represents comparison with the group of deficiency of qi and blood, P < 0.05.
DNA damage not repaired in time, thereby forming a tumor. The promoter region of p16 gene is unmethylated in normal cells, and the gene can express and transcript normally. Methylation of gene promoter can induce tumor suppressor gene inactivation, such as p16, CDX2, and PASSF1A [3–5]. Kang [6] found that the frequency of methylation of p16 in CAG, intestinal metaplasia, adenoma, and gastric cancer gradually increased, which reflected the evolution of carcinogenesis and also proved that it was an early event. The results of the present study found that the frequency of methylation of p16 in different syndromes in descending order was as follows: liver–stomach disharmony > deficiency of cold in spleen and stomach > deficiency of qi and blood > phlegm–dampness coagulation > stomach heat impairing yin > stasis toxin stagnation. The c-myc gene is an oncogene with highly conserved DNA-binding protein. In precancerous lesion tissue, methylation of c-myc gene was found to be lower than that in normal tissue. A study showed that the third exon of c-myc gene was the key for gene activation, and the transcription of c-myc oncogene in a number of tumor cells was changed by DNA demethylation in the same third exon [7]. Silva [7] studied the expression of myc gene in precancerous lesions and found that the expression of c-myc mRNA in the intestinal metaplasia significantly increased than that in superficial gastritis. The present study showed that the methylation of c-myc gene in different syndromes in descending order was as follows: stomach heat impairing yin > stasis toxin stagnation > phlegm–dampness coagulation > deficiency of cold in
4. Discussion The clinical manifestations of CAG belong to the Chinese medicine category “stomachache, noisy, fullness, bloating.” Its pathogenesis is complex, and the state of the disease is protracted. Furthermore, it is asthenia in origin and superficiality. A large number of studies show that Chinese medicine uses the aforementioned four diagnoses as the basis for treating CAG. It has a certain efficacy in alleviating mucosal atrophy, reversing intestinal metaplasia and dysplasia, and so on. Gastric mucosa is a site in the human body that has a direct contact with various harmful substances. Moreover, mucosal epithelial cells have a strong and fast reaction to these substances. Hence, it has become important to inactivate tumor suppressor genes by hypermethylation of CpG island in the promoter region. The inactivation of oncogenes, however, occurs due to hypomethylation. Silent gene transcription is often associated with methylation, which results in the loss of function or dysfunction of some important genes, such as oncogenes, tumor suppressor genes, and DNA repair genes. This leads to abnormal differentiation and regulation of normal cell growth, with Table 2 Comparison of age between TCM different syndromes.
Male Female
Liver–stomach disharmony
Stasis toxin stagnation
Phlegm–dampness coagulation
Deficiency of qi and blood
Deficiency of cold in spleen and stomach
Stomach heat impairing yin
15 17
14 18
18 14
17 15
16 16
18 14
Note: TCM, traditional Chinese medicine. 84
European Journal of Integrative Medicine 21 (2018) 82–87
D. Cai et al.
Fig. 2. Methylation rate of c-myc in chronic atrophic gastritis with liver–stomach disharmony syndrome, cold in spleen and stomach syndrome, qi and blood syndrome, phlegm–dampness coagulation syndrome, stomach heat impairing yin syndrome, stasis toxin stagnation syndrome.
spleen and stomach > deficiency of qi and blood > liver–stomach disharmony. hMLH1 is a DNA mismatch repair gene, which can inhibit the
occurrence of gastric cancer. The abnormality of hMLH1 gene may lead to the defects in cell mismatch repair function resulting in an increase in instability for the whole genome, thereby leading to inactivation of
Fig. 3. Methylation rate of hMLH1 in chronic atrophic gastritis with liver–stomach disharmony syndrome, cold in spleen and stomach syndrome, qi and blood syndrome, phlegm–dampness coagulation syndrome, stomach heat impairing yin syndrome, stasis toxin stagnation syndrome. 85
European Journal of Integrative Medicine 21 (2018) 82–87
D. Cai et al.
Fig. 4. Methylation rate of p16 in chronic atrophic gastritis with liver–stomach disharmony syndrome, cold in spleen and stomach syndrome, qi and blood syndrome, phlegm–dampness coagulation syndrome, stomach heat impairing yin syndrome, stasis toxin stagnation syndrome.
carcinogenesis. Therefore, high attention should be paid to CAG with liver–stomach disharmony, deficiency of qi and blood, and deficiency of cold in spleen and stomach. Regular follow-up with endoscopy and gastric mucosal pathology examination is required for early treatment and prevention of gastric cancer. Atrophied sites of CAG are closely associated with the incidence of gastric cancer [8,9]. The known carcinogenesis rate of gastric body atrophy is higher than that of antral atrophy. Further study is needed to confirm whether the carcinogenesis rate of atrophy in different sites of CAG is associated with the aforementioned TCM syndromes, and rule out whether a small sample size would affect the experimental results. However, this study had some limitations. One limitation is the amount of samples (patients with CAG) was limited and the fact that it is a signal-center analysis. Another limitation is the mechanism research was not very thorough. Thus, a prospective, multi-center study must be performed in the future to validate the results observed.
tumor suppressor genes and activation of oncogenes. Methylation of hMLH1 was shown to be involved in the progression of early-stage gastric cancer. For example, the frequency of methylation of hMLH1 in cancer tissue is 42.2%, which is higher than 2.2% in intestinal metaplasia and 11.5% in adenoma [2]. Thus, the study concluded that the abnormal methylation of CpG island in the region of hMLH1 gene promoter was the main cause of deficiency of protein expression, and the deficiency of hMLH1 protein expression was associated with gastric cancer. Using a nonparametric test, the study found that the methylation rate of hMLH1 gene in different CAG TCM syndromes was not significantly different (P > 0.05), suggesting that the methylation rate of hMLH1 gene was not associated with different CAG TCM syndromes. The aforementioned results showed that, for different TCM syndromes, the methylation rate of c-myc gene in phlegm–dampness coagulation, stomach heat impairing yin, and stasis toxin stagnation was higher than that in the other three syndromes, but the methylation rate of p16 gene was lower than that in the other three syndromes. C-myc is an oncogene. The increase in its methylation rate can inhibit the expression of c-myc protein. P16 is a tumor suppressor gene. The decrease in the methylation rate of gene promoter can inhibit the inactivation of tumor suppressor gene, suggesting that the CAG population with the three syndromes had a lower incidence of carcinogenesis compared with the other three syndromes. However, the methylation rate of c-myc gene in liver–stomach disharmony, deficiency of qi and blood, and deficiency of cold in spleen and stomach was lower than that in the other three syndromes, and the methylation rate of p16 gene was higher than that in the other three syndromes, suggesting that the CAG population with the three syndromes had a higher incidence of
5. Conclusion Our study shows that the relationship between different CAG TCM syndromes and methylation of c-myc, p16, and hMLH1 gene was evaluated. The methylation rates of c-myc and p16 genes, but not hMLH1 gene, were correlated with different TCM syndromes. High attention should be paid to liver–stomach disharmony, deficiency of qi and blood, and deficiency of cold in spleen and stomach. Regular follow-up with endoscopy and gastric mucosal pathology examination is required for early treatment and prevention of gastric cancer. 86
European Journal of Integrative Medicine 21 (2018) 82–87
D. Cai et al.
Funding
[3] J.F. Zhang, J.G. Zhang, X.L. Kuai, H. Zhang, W. Jiang, W.F. Ding, Z.L. Li, H.J. Zhu, Z.B. Mao, Reactivation of the homeotic tumor suppressor gene CDX2 by 5-aza-2’deoxycytidine-induced demethylation inhibits cell proliferation and induces caspaseindependent apoptosis in gastric cancer cells, Exp. Ther. Med. 5 (2013) 735–741. [4] W.J. Shen, D.Q. Dai, Y. Teng, H.B. Liu, Regulation of demethylation and re-expression of RASSF1A gene in gastric cancer cell lines by combined treatment of 5-AzaCdR and NaB, World J. Gastroenterol. 14 (2008) 595–600. [5] J. Liu, Y.S. Xie, F.L. Wang, L.J. Zhang, Y. Zhang, H.S. Luo, Cytotoxicity of 5-Aza-2’deoxycytidine against gastric cancer involves DNA damage in an ATM-P53 dependent signaling pathway and demethylation of P16(INK4A), Biomed. Pharmacother. 67 (2013) 78–87. [6] G.H. Kang, Y.H. Shim, H.Y. Jung, CpG island methylation along multistep gadtric carcinogenesis, Lab. Invest. 83 (2003) 73–78. [7] T.C. Silva, M.F. Leal, D.Q. Calcagno, C.R.T. Souza, A.S. Khayat, N.P.C. Santos, R.C. Montenegro, S.H.B. Rabenhorst, M.Q. Nascimento, P.P. Assumpção, M.A.C. Smith, R.R. Burbano, hTERT, MYC and TP53 deregulation in gastric preneoplastic lesions, BMC Gastroenterol. 12 (2012) 85. [8] A.C. de Vries, N.C. van Grieken, C.W. Looman, M.K. Casparie, E. de Vries, G.A. Meijer, E.J. Kuipers, Gastriccancer risk in patients with premalignant gastric lesions: anationwide cohort study in the Netherlands, Gastroenterology 134 (2008) 945–952. [9] L. Vannella, E. Lahner, J. Osborn, C. Bordi, M. Miglione, F.G. Delle, B. Annibale, Risk factors for progression to gastric neoplastic lesions in patients with atrophic gastritis, Aliment. Pharmacol. Ther. 31 (2010) 1042–1050.
This work was financially supported by grants from the Natural Science Foundation of Zhejiang Poince (No. LY13H290004), the Science and Technology Projects of Hangzhou (No. 20130733Q18), the Health Science and Technology Key Projects of Hangzhou (No. 2016Z09), the Chinese Medicine Science and Technology Program of Zhejiang Poince (No. 2012ZB108). Conflict of interest None. References [1] K. Sugano, Premalignant conditions of gastric cancer, J. Gastroenterol. Hepatol. 28 (2013) 906–911. [2] H. Kim, H. Kim, S.E. Kim, N.G. Kim, S.H. Noh, Concerted promoter hypermethylation of hMLH1, p16INK4a, and E-cadherin in gastric carcinomas with microsatellite instability, J. Pathol. 2000 (2003) 23–31.
87
Contents lists available at ScienceDirect
European Journal of Integrative Medicine journal homepage: www.elsevier.com/locate/eujim
Research paper
Difference in DNA methylation levels of gastric c-myc, p16, and hMLH1among traditional Chinese medical syndromes for chronic atrophic gastritis Danli Caia, Zhiyun Chena, Xiaobing Doub, Jing Qiuc, Qingsheng Liud,
T
⁎
a
Department of ICU, The First Affiliated Hospital of Zhejiang Chinese Medical University, Hangzhou, Zhejiang, 310006, China College of Life Science, Zhejiang Chinese Medical University, Hangzhou, Zhejiang, 310053, China c Zhejiang Chinese Medical University, Hangzhou, Zhejiang, 310053, China d Department of digestive, Hangzhou Traditional Chinese Medical Hospital, Hangzhou, Zhejiang, 310006, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Chronic atrophic gastritis DNA methylation TCM syndromes
Introduction: This study aimed to evaluate the difference in DNA methylation levels of c-myc, p16, and hMLH1 among traditional Chinese medicine (TCM) syndromes and also investigate the relationship between chronic atrophic gastritis (CAG). Methods: A total of 192 patients endoscopically diagnosed with CAG TCM syndromes were selected based on previous questionnaire studies. Pyrosequencing was used to detect DNA methylation of gastric c-myc, p16, and hMLH1 genes. The difference and correction in DNA methylation levels of gastric c-myc, p16, and hMLH1 genes in different TCM syndromes were analyzed. Results: The methylation rate of c-myc and p16 genes among different TCM syndromes showed significant differences. The descending order for the methylation rates of c-myc gene was as follows: stomach heat impairing yin > stasis toxin stagnation > phlegm–dampness coagulation > deficiency of cold in spleen and stomach > deficiency of qi and blood > liver–stomach disharmony. The descending order for p16 gene was as follows: liver–stomach disharmony > deficiency of cold in spleen and stomach > deficiency of qi and blood > stomach heat impairing yin > stasis toxin stagnation. Conclusions: The methylation rates of c-myc and p16 genes, but not hMLH1 gene, were correlated with different TCM syndromes. Attention and vigilence should be paid to individuals with liver–stomach disharmony, deficiency of qi and blood, and deficiency of cold in spleen and stomach who may be at risk of developing gastric cancer. Regular follow-up with endoscopy and gastric mucosal pathology examination is required for early treatment and prevention of gastric cancer.
1. Introduction The incidence of gastric cancer is high in China. Each year, about 15–16 million people die from gastric cancer, and its mortality rate ranks first among various malignant tumors. Chronic atrophic gastritis (CAG) is a chronic disease characterized by unknown etiology of gastric epithelial and glandular atrophy, mucosal thinning, mucosa and muscle thickening associated with intestinal metaplasia, and dysplasia. CAG is an important stage in the occurrence and progression from normal mucosa to gastric cancer. The occurrence rate of CAG with intestinal metaplasia or dysplasia is 7%–9%, indicating a positive correlation. In the case of glandular atrophy and chronic inflammation in gastric tissue, hypermethylation of the tumor suppressor gene promoter of the
⁎
mucosal cells occurs, and the expression of the tumor suppressor protein is low [1]. Gastric mucosa is a site in the human body that has early contact with various harmful substances. Moreover, mucosal epithelial cells react strongly and rapidly to these substances. Therefore, it has become important to detect and correct DNA methylation abnormality and reduce the incidence of gastric cancer at the early stage for preventing and reversing CAG. The p16 gene is one of the most important tumor suppressor genes. In gastric cancer, the change in the expression of p16 is not caused by gene mutations or deletions but by methylation of the promoters. The frequency of methylation in CAG, intestinal metaplasia, gastric adenoma, and gastric cancer gradually increases, which reflects the evolution of cancer and also proves that it is an early event. The c-myc gene
Corresponding author at: Department of Digestive, Hangzhou Traditional Chinese Medical Hospital, Hangzhou, Zhejiang, 310006, China. E-mail addresses: [email protected] (D. Cai), [email protected] (Z. Chen), [email protected] (X. Dou), [email protected] (Q. Liu).
https://doi.org/10.1016/j.eujim.2018.07.001 Received 16 April 2018; Received in revised form 15 June 2018; Accepted 9 July 2018 1876-3820/ © 2018 Elsevier GmbH. All rights reserved.
European Journal of Integrative Medicine 21 (2018) 82–87
D. Cai et al.
2012LH002)
is an oncogene with highly conserved DNA-binding protein. The expression of c-myc protein in early gastric cancer and CAG is significantly higher than that in chronic nonatrophic gastritis, suggesting that the overexpression of c-myc protein is closely related to precancerous lesions and gastric cancer. hMLH1 is a DNA mismatch repair gene that can inhibit the occurrence of gastric cancer. Its dysfunction may lead to defects in cell mismatch repair function resulting in an increase in whole genomic instability, thereby leading to tumor suppressor gene inactivation and oncogene activation. Previous studies have shown methylation of hMLH1 to be involved in the progression of early gastric cancer; for instance, the frequency of methylation of hMLH1 in cancer tissue was shown to be 42.2%, which was more frequent compared with 2.1% in intestinal metaplasia and 11.5% in adenoma [2]. Abnormal methylation of CpG island in the promoter region of hMLH1 gene is the main cause of the lack of protein expression. Currently, studies on CAG TCM syndromes are scarce. In this study, DNA methylation of c-myc, p16, and hMLH1 was considered as a starting point, and pyrosequencing was used to detect the DNA methylation level of c-myc, p16, and hMLH1 in the gastric mucosa of CAG patients confirmed by histopathology. This study also compared the difference in DNA methylation level for gastric mucosa p16, c-myc, and hMLH1, and analyzed their correlation with CAG TCM syndromes.
2.3. Experimental materials and methods 2.3.1. Collection of specimens Gastroscopy was performed for the observed subjects, and antrum, gastric angle, or gastric body mucosa was used to conduct the pathological tissue biopsy. The fresh specimens were placed in the Eppendorf tube and stored in liquid nitrogen immediately. DNA methylation of c-myc, p16, and hMLH1 in mucosal tissue was detected using pyrosequencing, and the operations strictly followed the instructions on the kit. For pyrosequencing, 2 μL of reaction haptoglobin was added into the 96-well polymerase chain reaction (PCR) plate, and mixed with 38 μL of buffer and 40 μL of PCR product for 10 min at room temperature. The vacuum pump was turned on to draw the suspension of haptoglobin and PCR product, which were then sequentially rinsed with 70% ethanol, 0.2 mL of NaOH, and buffer for 5 s. The vacuum pump was closed, haptoglobin and PCR product were mixed with 40 μL of annealing buffer (including sequencing primer 1.5 μL), and denaturation was performed for 2 min at 85 °C. Finally, the sample was cooled down to room temperature, which resulted in annealing and hybridization of the primer and template. According to the pyrosequencing software, sequence-designed information was used to calculate the dose. Then, the substrate mixture, a mixture of enzyme, and four kinds of dNTP (Qiagen) were sequentially added in the reagent capsule. Next, the reagent capsule and 96-well plate were placed in the pyrosequencing detector (PyroMark Q96 ID, Qiagen) to conduct the reaction. The Pyro Q-CpG software was used to analyze and obtain methylation quantitative data for each site. Primer synthesis is shown in Table 1.
2. Materials and methods 2.1. General information A total of 192 patients with CAG confirmed by electronic gastroscopy and gastric mucosal biopsy were selected from the outpatient and hospitalized patients in our hospital from January 2013 to January 2016 (Fig. 1). According to the “Chinese clinical research guidelines for new drug,” these patients were divided into groups with different syndromes, including liver–stomach disharmony, stasis toxin stagnation, phlegm–dampness coagulation, deficiency of cold in spleen and stomach, stomach heat impairing yin, and deficiency of qi and blood. Among these 192 patients, 98 patients were males and 94 females; the youngest was 30 years old, and the oldest 75 years old (average age, 60.94 ± 11.14 years). The age and gender among the different syndrome groups were not statistically significant as confirmed using the chi-square test (P > 0.05). This study was approved by the ethics committee of the hospital.
2.4. Statistical analysis The SPSS 18.0 statistical analysis software (SPSS Inc., IL, USA) was used to analyze the data. The two-tailed test was used for statistics, and α = 0.05 was the significance level. Continuous data were evaluated using mean (x−) ± standard deviation. The normality test and variance homogeneous test were conducted; if they conformed to the normal distribution, then single factor variance analysis of multigroup mean value comparison was used; otherwise, nonparametric test was used. The Spearman ranking method was used for correlation analysis. Categorical data were presented by cases, and the nonparametric Kruskal–Wallis test was performed.
2.2. Inclusion and exclusion criteria of the patients The inclusion criteria were as follows: (1) CAG patients who met the diagnostic criteria (male or female), (2) patients aged between 18 and 75 years, (3) patients who had not taken proton pump inhibitors or antibiotics during the last 4 weeks, and (4) patients who voluntarily participated in the study and signed informed consent. The exclusion criteria were as follows: (1) patients who had a history of gastric surgery or (2) patients diagnosed with gastric cancer. This study has been approved by the medical ethics committee of the Hangzhou Traditional Chinese Medical Hospital (Number:
3. Results Using the chi-square test, no statistically significant difference in age was found among different CAG TCM syndromes statistically significant (χ2 = 4.46, P > 0.05) (Table 2). Using single factor analysis of variance, no statistically significant difference was found in gender among the different CAG TCM syndromes (P > 0.05) (Table 3). Fig. 1. chronic atrophic gastritis with moderate intestinal metaplasia. Note: A. Mild chronic atrophic gastritis with moderate intestinal metaplasia (HE × 200). B. Moderate chronic atrophic gastritis with moderate intestinal metaplasia (HE × 200). C. Severe chronic atrophic gastritis with severe intestinal metaplasia (HE × 200).
83
European Journal of Integrative Medicine 21 (2018) 82–87
D. Cai et al.
Table 1 Primer synthesis.
Table 3 Comparison of gender between TCM different syndromes.
Name of primer
Sequence of primer (5' to 3')
5' Modification
P16-F P16-R P16-S c-myc-F c-myc-R c-myc-S mlh1-F mlh1-R mlh1-S
AGAGGATTTGAGGGATAGGG CTACCTACTCTCCCCCTCT GGGTTGGTTGGTTATTAG GGTAGGTTAGGGTGGAAGAGT ATCCCCAAATAAACAAAATAACCTC GGGTATTTTGTATTGGAATT GGTATTTTTGTTTTTATTGGTTGGATATTT AATACCAATCAAATTTCTCAACTCTAT TTTTAAAAAAGAATTAATAGGAAG
5' Biotin
5' Biotin
5' Biotin
Syndromes
Age
Liver–stomach disharmony Stasis toxin stagnation Phlegm–dampness coagulation Deficiency of qi and blood Deficiency of cold in spleen and stomach Stomach heat impairing yin
55.80 66.20 67.33 62.83 62.63 63.10
± ± ± ± ± ±
9.08 9.46 8.40 8.67 9.97 11.11
Note: TCM, traditional Chinese medicine. Table 4 Relationships of methylation rate of c-myc, p16, and hMLH1 genes between different syndromes of CAG TCM.
3.1. Relationship between different CAG TCM syndromes and methylation of c-myc gene Using single factor analysis of variance, this study found that the methylation rate of c-myc gene in different CAG TCM syndromes was statistically significant (P < 0.05). The methylation rate of c-myc gene in each syndrome in the descending order was as follows: stomach heat impairing yin > stasis toxin stagnation > phlegm–dampness coagulation > deficiency of cold in spleen and stomach > deficiency of qi and blood > liver–stomach disharmony. Pairwise comparison between the groups revealed a significant difference between phlegm–dampness coagulation, stomach heat impairing yin, stasis toxin stagnation, and liver–stomach disharmony (P < 0.05). A significant difference was found on comparing deficiency of cold in spleen and stomach with stomach heat impairing yin and stasis toxin stagnation (P < 0.05). Similarly, a significant difference was found on comparing deficiency of qi and blood with phlegm–dampness coagulation and stasis toxin stagnation (P < 0.05). Pairwise comparison between groups revealed a significant difference between stomach heat impairing yin, stasis toxin stagnation, and liver–stomach disharmony (P < 0.05). The nonparametric test found no significant difference in the methylation rate of hMLH1 gene in different CAG TCM syndromes (P > 0.05) (Table 4, Figs. 1–4).
Syndrome
N
c-myc
p16
hMLH1
Liver–stomach disharmony Deficiency of cold in spleen and stomach Deficiency of qi and blood Phlegm–dampness coagulation Stomach heat impairing yin Stasis toxin stagnation
32
4.13 ± 0.78
8.66 ± 2.95
2.01 ± 0.62
32
5.14 ± 1.26
7.78 ± 3.44
1.77 ± 1.22
32
4.78 ± 0.84
6.03 ± 1.70
2.63 ± 0.47
32
6.00 ± 1.41a
5.11 ± 2.03
2.31 ± 1.60
32
7.04 ± 1.46
abc
32
6.48 ± 1.53
abc
4.08 ± 1.03 3.81 ± 1.23
a
a
2.22 ± 1.28 1.98 ± 0.69
Note: a represents comparison with the group of liver–stomach disharmony, P < 0.05; b represents comparison with the group of deficiency of cold of spleen and stomach, P < 0.05; c represents comparison with the group of deficiency of qi and blood, P < 0.05.
DNA damage not repaired in time, thereby forming a tumor. The promoter region of p16 gene is unmethylated in normal cells, and the gene can express and transcript normally. Methylation of gene promoter can induce tumor suppressor gene inactivation, such as p16, CDX2, and PASSF1A [3–5]. Kang [6] found that the frequency of methylation of p16 in CAG, intestinal metaplasia, adenoma, and gastric cancer gradually increased, which reflected the evolution of carcinogenesis and also proved that it was an early event. The results of the present study found that the frequency of methylation of p16 in different syndromes in descending order was as follows: liver–stomach disharmony > deficiency of cold in spleen and stomach > deficiency of qi and blood > phlegm–dampness coagulation > stomach heat impairing yin > stasis toxin stagnation. The c-myc gene is an oncogene with highly conserved DNA-binding protein. In precancerous lesion tissue, methylation of c-myc gene was found to be lower than that in normal tissue. A study showed that the third exon of c-myc gene was the key for gene activation, and the transcription of c-myc oncogene in a number of tumor cells was changed by DNA demethylation in the same third exon [7]. Silva [7] studied the expression of myc gene in precancerous lesions and found that the expression of c-myc mRNA in the intestinal metaplasia significantly increased than that in superficial gastritis. The present study showed that the methylation of c-myc gene in different syndromes in descending order was as follows: stomach heat impairing yin > stasis toxin stagnation > phlegm–dampness coagulation > deficiency of cold in
4. Discussion The clinical manifestations of CAG belong to the Chinese medicine category “stomachache, noisy, fullness, bloating.” Its pathogenesis is complex, and the state of the disease is protracted. Furthermore, it is asthenia in origin and superficiality. A large number of studies show that Chinese medicine uses the aforementioned four diagnoses as the basis for treating CAG. It has a certain efficacy in alleviating mucosal atrophy, reversing intestinal metaplasia and dysplasia, and so on. Gastric mucosa is a site in the human body that has a direct contact with various harmful substances. Moreover, mucosal epithelial cells have a strong and fast reaction to these substances. Hence, it has become important to inactivate tumor suppressor genes by hypermethylation of CpG island in the promoter region. The inactivation of oncogenes, however, occurs due to hypomethylation. Silent gene transcription is often associated with methylation, which results in the loss of function or dysfunction of some important genes, such as oncogenes, tumor suppressor genes, and DNA repair genes. This leads to abnormal differentiation and regulation of normal cell growth, with Table 2 Comparison of age between TCM different syndromes.
Male Female
Liver–stomach disharmony
Stasis toxin stagnation
Phlegm–dampness coagulation
Deficiency of qi and blood
Deficiency of cold in spleen and stomach
Stomach heat impairing yin
15 17
14 18
18 14
17 15
16 16
18 14
Note: TCM, traditional Chinese medicine. 84
European Journal of Integrative Medicine 21 (2018) 82–87
D. Cai et al.
Fig. 2. Methylation rate of c-myc in chronic atrophic gastritis with liver–stomach disharmony syndrome, cold in spleen and stomach syndrome, qi and blood syndrome, phlegm–dampness coagulation syndrome, stomach heat impairing yin syndrome, stasis toxin stagnation syndrome.
spleen and stomach > deficiency of qi and blood > liver–stomach disharmony. hMLH1 is a DNA mismatch repair gene, which can inhibit the
occurrence of gastric cancer. The abnormality of hMLH1 gene may lead to the defects in cell mismatch repair function resulting in an increase in instability for the whole genome, thereby leading to inactivation of
Fig. 3. Methylation rate of hMLH1 in chronic atrophic gastritis with liver–stomach disharmony syndrome, cold in spleen and stomach syndrome, qi and blood syndrome, phlegm–dampness coagulation syndrome, stomach heat impairing yin syndrome, stasis toxin stagnation syndrome. 85
European Journal of Integrative Medicine 21 (2018) 82–87
D. Cai et al.
Fig. 4. Methylation rate of p16 in chronic atrophic gastritis with liver–stomach disharmony syndrome, cold in spleen and stomach syndrome, qi and blood syndrome, phlegm–dampness coagulation syndrome, stomach heat impairing yin syndrome, stasis toxin stagnation syndrome.
carcinogenesis. Therefore, high attention should be paid to CAG with liver–stomach disharmony, deficiency of qi and blood, and deficiency of cold in spleen and stomach. Regular follow-up with endoscopy and gastric mucosal pathology examination is required for early treatment and prevention of gastric cancer. Atrophied sites of CAG are closely associated with the incidence of gastric cancer [8,9]. The known carcinogenesis rate of gastric body atrophy is higher than that of antral atrophy. Further study is needed to confirm whether the carcinogenesis rate of atrophy in different sites of CAG is associated with the aforementioned TCM syndromes, and rule out whether a small sample size would affect the experimental results. However, this study had some limitations. One limitation is the amount of samples (patients with CAG) was limited and the fact that it is a signal-center analysis. Another limitation is the mechanism research was not very thorough. Thus, a prospective, multi-center study must be performed in the future to validate the results observed.
tumor suppressor genes and activation of oncogenes. Methylation of hMLH1 was shown to be involved in the progression of early-stage gastric cancer. For example, the frequency of methylation of hMLH1 in cancer tissue is 42.2%, which is higher than 2.2% in intestinal metaplasia and 11.5% in adenoma [2]. Thus, the study concluded that the abnormal methylation of CpG island in the region of hMLH1 gene promoter was the main cause of deficiency of protein expression, and the deficiency of hMLH1 protein expression was associated with gastric cancer. Using a nonparametric test, the study found that the methylation rate of hMLH1 gene in different CAG TCM syndromes was not significantly different (P > 0.05), suggesting that the methylation rate of hMLH1 gene was not associated with different CAG TCM syndromes. The aforementioned results showed that, for different TCM syndromes, the methylation rate of c-myc gene in phlegm–dampness coagulation, stomach heat impairing yin, and stasis toxin stagnation was higher than that in the other three syndromes, but the methylation rate of p16 gene was lower than that in the other three syndromes. C-myc is an oncogene. The increase in its methylation rate can inhibit the expression of c-myc protein. P16 is a tumor suppressor gene. The decrease in the methylation rate of gene promoter can inhibit the inactivation of tumor suppressor gene, suggesting that the CAG population with the three syndromes had a lower incidence of carcinogenesis compared with the other three syndromes. However, the methylation rate of c-myc gene in liver–stomach disharmony, deficiency of qi and blood, and deficiency of cold in spleen and stomach was lower than that in the other three syndromes, and the methylation rate of p16 gene was higher than that in the other three syndromes, suggesting that the CAG population with the three syndromes had a higher incidence of
5. Conclusion Our study shows that the relationship between different CAG TCM syndromes and methylation of c-myc, p16, and hMLH1 gene was evaluated. The methylation rates of c-myc and p16 genes, but not hMLH1 gene, were correlated with different TCM syndromes. High attention should be paid to liver–stomach disharmony, deficiency of qi and blood, and deficiency of cold in spleen and stomach. Regular follow-up with endoscopy and gastric mucosal pathology examination is required for early treatment and prevention of gastric cancer. 86
European Journal of Integrative Medicine 21 (2018) 82–87
D. Cai et al.
Funding
[3] J.F. Zhang, J.G. Zhang, X.L. Kuai, H. Zhang, W. Jiang, W.F. Ding, Z.L. Li, H.J. Zhu, Z.B. Mao, Reactivation of the homeotic tumor suppressor gene CDX2 by 5-aza-2’deoxycytidine-induced demethylation inhibits cell proliferation and induces caspaseindependent apoptosis in gastric cancer cells, Exp. Ther. Med. 5 (2013) 735–741. [4] W.J. Shen, D.Q. Dai, Y. Teng, H.B. Liu, Regulation of demethylation and re-expression of RASSF1A gene in gastric cancer cell lines by combined treatment of 5-AzaCdR and NaB, World J. Gastroenterol. 14 (2008) 595–600. [5] J. Liu, Y.S. Xie, F.L. Wang, L.J. Zhang, Y. Zhang, H.S. Luo, Cytotoxicity of 5-Aza-2’deoxycytidine against gastric cancer involves DNA damage in an ATM-P53 dependent signaling pathway and demethylation of P16(INK4A), Biomed. Pharmacother. 67 (2013) 78–87. [6] G.H. Kang, Y.H. Shim, H.Y. Jung, CpG island methylation along multistep gadtric carcinogenesis, Lab. Invest. 83 (2003) 73–78. [7] T.C. Silva, M.F. Leal, D.Q. Calcagno, C.R.T. Souza, A.S. Khayat, N.P.C. Santos, R.C. Montenegro, S.H.B. Rabenhorst, M.Q. Nascimento, P.P. Assumpção, M.A.C. Smith, R.R. Burbano, hTERT, MYC and TP53 deregulation in gastric preneoplastic lesions, BMC Gastroenterol. 12 (2012) 85. [8] A.C. de Vries, N.C. van Grieken, C.W. Looman, M.K. Casparie, E. de Vries, G.A. Meijer, E.J. Kuipers, Gastriccancer risk in patients with premalignant gastric lesions: anationwide cohort study in the Netherlands, Gastroenterology 134 (2008) 945–952. [9] L. Vannella, E. Lahner, J. Osborn, C. Bordi, M. Miglione, F.G. Delle, B. Annibale, Risk factors for progression to gastric neoplastic lesions in patients with atrophic gastritis, Aliment. Pharmacol. Ther. 31 (2010) 1042–1050.
This work was financially supported by grants from the Natural Science Foundation of Zhejiang Poince (No. LY13H290004), the Science and Technology Projects of Hangzhou (No. 20130733Q18), the Health Science and Technology Key Projects of Hangzhou (No. 2016Z09), the Chinese Medicine Science and Technology Program of Zhejiang Poince (No. 2012ZB108). Conflict of interest None. References [1] K. Sugano, Premalignant conditions of gastric cancer, J. Gastroenterol. Hepatol. 28 (2013) 906–911. [2] H. Kim, H. Kim, S.E. Kim, N.G. Kim, S.H. Noh, Concerted promoter hypermethylation of hMLH1, p16INK4a, and E-cadherin in gastric carcinomas with microsatellite instability, J. Pathol. 2000 (2003) 23–31.
87