Differences in 15N uptake amongst spruce seedlings colonized by three pioneer ectomycorrhizal fungi in the field

fungal ecology 2 (2009) 110–120

available at www.sciencedirect.com

journal homepage: www.elsevier.com/locate/funeco

Differences in 15N uptake amongst spruce seedlings colonized by three pioneer ectomycorrhizal fungi in the field Melanie D. JONESa,*, Frank GRENONb, Heather PEATc, Michele FITZGERALDd, Leigh HOLTe, Leanne J. PHILIPf, Robert BRADLEYg a

Biology and Physical Geography Unit and SARAHS Centre, University of British Columbia Okanagan, 3333 University Way, Kelowna, British Columbia V1V 1V7, Canada b Centre d’enseignement et de recherche en foresterie (CERFO), 2424 chemin Ste-Foy, Que´bec, QC G1V 1T2, Canada c P.O. Box 68, Forget, Saskatchewan S0C 0X0, Canada d British Columbia Ministry of Agriculture and Lands, 1690 Powick Road, Kelowna, BC V1X7G5, Canada e Golder Associates Ltd., 2390 Argentia Road, Mississauga, Ontario L5 N 5Z7, Canada f Department of Forest Sciences, University of British Columbia, Vancouver, British Columbia V6T 1Z4, Canada g De´partement de Biologie, Universite´ de Sherbrooke, Sherbrooke, Que´bec J1K 2R1, Canada

article info

abstract

Article history:

Amongst the factors hypothesized to be responsible for high ectomycorrhizal fungal

Received 28 August 2008

diversity are resource partitioning and niche differentiation. However, functional differ-

Revision received 29 January 2009

ences amongst ectomycorrhizal fungi, which are pre-requisites for resource partitioning,

Accepted 4 February 2009

are known primarily from lab studies; now realistic field experiments are needed in order

Published online 17 April 2009

to establish that these differences exist under field conditions. In this study, Picea engel-

Corresponding editor: Bjo¨rn Lindahl

mannii seedlings planted in a subalpine clearcut became naturally colonized over the course of 1 y. Then a defined volume of soil around each seedling was injected with

15

N-

Keywords:

labelled nitrate, ammonium or aspartate. Seedling biomass and N content increased, but N

Ammonium

concentration decreased, with percent colonization of root systems. Accumulation of

Cenococcum

per unit dry weight was not affected by the proportion of roots colonized but, rather, was

Community assemblage

influenced by the primary ectomycorrhizal fungus colonizing the seedling. Seedlings

Dark septate fungi

colonized by a Wilcoxina sp. accumulated more

Functional diversity

a Cenococcum sp. The presence of dark septate hyphae in the mantle was associated with

15

lower accumulation of

Nitrate

demonstrate that the physiological differences required to support the concept of niche

Nitrogen uptake

differentiation amongst ectomycorrhizal fungi exist in the field.

N

Picea

15

N

15

N per g than seedlings colonized by

15

N by seedlings colonized by Amphinema byssoides. Our results

ª 2009 Elsevier Ltd and The British Mycological Society. All rights reserved.

Wilcoxina

Introduction Communities of ectomycorrhizal (EM) fungi are typically diverse, with a conservative estimate of 50 EM fungal species per host species within a local area (Dickie 2007; Twieg et al.

2007). Amongst the factors hypothesized to be responsible for this high diversity are competitive interactions (Koide et al. 2005; Kennedy et al. 2007), differences in dispersal (Peay et al. 2007), random founder effects (Dahlberg 2001), as well as resource partitioning and niche differentiation (Bruns 1995;

* Corresponding author. Tel.: þ1 250 807 9553; fax: þ1 250 807 8004. E-mail address: [email protected] (M.D. Jones). 1754-5048/$ – see front matter ª 2009 Elsevier Ltd and The British Mycological Society. All rights reserved. doi:10.1016/j.funeco.2009.02.002

15

N uptake by ectomycorrhizal fungi in situ

Dickie 2007). The niche differentiation hypothesis is supported by evidence of host preferences (Ishida et al. 2007), differences in the distribution of EM fungal species amongst soil horizons and soil moisture environments (Goodman & Trofymow 1998; Dickie et al. 2002; Genney et al. 2006; Robertson et al. 2006), and changes in EM fungal abundance across seasons (Bue´e et al. 2005; Koide et al. 2007). However, such correlations do not confirm that resource partitioning is occurring amongst EM fungal species. Neutral theory, which is an alternative to niche partitioning, assumes that species are functionally equivalent and, thus, it can be considered the null hypothesis of species assemblage (Hubbell 2005). Our contribution to these theoretical discussions is to test whether physiological differences with respect to soil N uptake into host tissues can be observed amongst EM fungi occurring in the field. Studies examining physiological differences amongst EM fungi have typically been done in the lab, with a surprising number (for symbiotic organisms) being carried out on fungi growing in pure culture. Laboratory experiments using EM fungi in symbiosis have shown that species differ in the forms of N they absorb (Turnbull et al. 1995; Wallander et al. 1997; Boukcim & Plassard 2003), as well as in their tolerance of drought (Parke et al. 1983) and heavy metals (Meharg 2003). Laboratory experiments must be interpreted with caution, however, because seedlings are typically grown in artificial substrates and/or without normal mycorrhizosphere microflora. To increase ecological relevance, physiological differences amongst EM fungal species have also been studied in the field. For example, roots colonized with different EM fungal species have been excised in the field, brought back to the laboratory, and subsequently shown to differ in N accumulation (Wallenda & Read 1999) or extracellular enzyme activity (Bue´e et al. 2005; Courty et al. 2005). Unfortunately, such manipulations result in the loss of extramatrical hyphae, arguably the most important part of a mycorrhiza with respect to nutrient uptake. Alternatively, field-grown ectomycorrhizas have been excised following uptake of isotope-labelled nutrients, and differences in isotopic signature used to infer physiological differences amongst EM fungal species (e.g. Wallander et al. 1997). These experiments cannot reveal, however, differences in nutrient supply to the host plant. Differences in natural abundance of N amongst EM sporocarps have also been used to infer functional differences amongst EM fungal species in the field (Hobbie et al. 2005), but again this approach does not provide information on N transfer to the host. To our knowledge, only one field experiment has attempted to confirm that different naturally occurring EM fungal species cause differential accumulation of nutrients by their hosts. Dighton et al. (1990) found evidence that the accumulation of 32P by birch leaves depended on the dominant EM fungus in the region of soil treated with labelled P. Given that N is the limiting nutrient for plant growth in many temperate forest ecosystems (Brockley 1992; Huang et al. 2007) and that boreal forest plants absorb both mineral and low molecular weight organic forms of soil N (Na¨sholm et al. 1998), we devised an experiment that would directly address the question of EM fungal functional diversity based on uptake and transfer of N. We used a unique approach to overcome the problems described above: we planted a large number (600) of

111

Engelmann spruce (Picea engelmannii) seedlings, allowed them to become colonized naturally by zero, one or several EM fungi, and then applied 15N-labelled nitrate, ammonium or aspartate to the soil around the seedlings. Aspartate was selected as a model amino acid because it is an important component of the amino acid pool in cold, northern soils (Kielland 1995). We worked at a site where approximately one-third of spruce seedlings typically remain non-mycorrhizal at the end of their first season of growth, with some of the remaining seedlings colonized by only one EM fungus (Hagerman et al. 1999). By starting with a large number of seedlings, we could test for differences in N uptake amongst EM fungi in situ, even though we could not know the mycorrhizal status of each seedling at the time of labelling. This approach allowed us to forgo artificial inoculation or fungicide treatments. We hypothesized that N uptake by mycorrhizal seedlings would be higher than by non-mycorrhizal seedlings, and would differ amongst seedlings colonized by different EM fungi.

Materials and methods Growing and planting of seedlings Seeds of Engelmann spruce were surface sterilized (30 % H2O2 for 15 min þ 2 % H2O2 for 2 h), rinsed in deionized water, planted in a sterile mixture of peat and sand (3:1 v/v), and grown in a greenhouse for 9 weeks with a photoperiod of 18 h d1. In mid-Jul., 600 seedlings were planted in a 1 ha cutblock in a subalpine fir (Abies lasiocarpa)/Engelmann spruce forest at approximately 1 600 m elevation on Mt. Mara (51 N, 119 W), British Columbia, Canada. This site, which had been logged 5 y previously, falls within the Wet Cold Engelmann Spruce–Subalpine Fir Biogeoclimatic Subzone (ESSFwc2) (Coupe´ et al. 1991). The herbaceous vegetation was dominated by Sitka valerian (Valeriana sitchensis), oak fern (Gymnocarpium dryopteris), one-leaved foamflower (Tiarella unifoliata) and rosy twisted stalk (Streptopus roseus). The only other EM hosts in the cutblock were occasional, scattered Engelmann spruce seedlings, approximately 30 cm in height, which had been planted 4 y earlier. Soils are classified as Orthic Humo-Ferric Podzols with Hemimor humus (Soil Classification Working Group 1998). This site is typically free of snow for 3 months of the year (Jul.–Sep.). The seedlings (1 cm tall) were planted at regular 0.5  0.5 m spacing, avoiding the previously planted spruce seedlings by at least 0.5 m, in a 10  15 m plot located 10 m from the edge of the forest. A hand trowel was inserted vertically into the soil, the small root system placed on the vertical face of the soil, and the gap closed. The substratum into which each seedling was planted was classified as primarily mineral soil (soil disturbed during logging with no subsequent development of organic horizons), organic soil (humus to planting depth – approximately 7–10 cm), or decayed wood, based on the soil exposed at planting. Small (10 cm tall) cages made of wire mesh (5 mm openings) were placed over the seedlings to protect them from herbivores. Prior to planting, the roots of 10 randomly selected seedlings were stained in 0.05 % trypan blue–lactic acid and found to be non-mycorrhizal. Twenty seedlings, randomly sampled in late Aug., were beginning to

112

be colonized by EM fungi, but mantles were not completely developed. Immediately following snowmelt the following year (late Jun.), while the soil was still very moist, a 10 cm  15 cm tall plastic liner (Part #ZC-208, Gidding Machine Co., Ft. Collins, Colorado) was inserted into the soil around each remaining living seedling (ca. 500 seedlings), using a Gidding corer. Each soil core, complete with seedling and sleeve, was removed intact, the bottom covered with a watertight vinyl cap, (Part #ZC-308, Gidding Machine Co., Ft. Collins, Colorado), and the unit replaced into the hole. This was done to prevent variable losses of label from the soil around the roots over the short uptake period due to lateral or vertical movement through the soil profile. This also meant that a consistent volume of soil was labelled for each seedling and that competition for uptake of 15N by neighbouring plants was reduced. Seedlings were left for 3 weeks before isotope labelling to allow hyphae and roots to recover from the disturbance. During this period, seedlings received only natural precipitation. By midJul, when the labelling began, all needle buds had flushed.

Isotope labelling Sixteen injection treatments, comprising three N forms (NO3N, NH4-N, or aspartate-N) and a control (water) combined with four chase periods (0, 4, 26, or 78 h after injection), were randomly assigned to seedlings stratified by planting substratum. Each set of 16 seedlings was labelled on the same day and comprised seedlings growing in the same substratum type. There were 28 replicate treatment sets: eight in mineral soil and 10 each in organic soil and decayed wood (16 treatments  28 replicates ¼ 448 seedlings total). Because the seedlings were labelled in situ, the mycorrhizal status of each seedling was not known at the time of labelling. Beginning on Jul. 20 and continuing for 21 consecutive days, soils around one or two treatment sets were injected between 9:00 and 11:00 each morning with either 20 ml of water or 20 ml of solution containing 636 mg of N (99 atom% 15N) as K15NO3, (15NH4)2SO4, or 15N-aspartate. To label the soils as uniformly as possible, we used the method of Jonasson & Chapin (1991). Solutions were injected in 4 ml aliquots along five equally spaced points located equidistant between the stem and the edge of the core. A blunt-ended stainless steel needle with four outwardly oriented holes was inserted 10 cm into the soil at each point and the plunger of the syringe was depressed slowly as the needle was pulled upward through the soil. Seedlings were harvested according to their assigned chase period, those from the 0 h treatment being harvested immediately following injection. Shoots were excised from roots in the field; both tissues were rinsed separately with fresh 0.05 M CaCl2 to remove isotope adhering to the outside of the plant, and placed in plastic bags on ice. Soil was immediately sieved through a 5.6 mm mesh and placed in a sealed plastic bag on ice. All instruments were rinsed between seedlings with 0.05 M CaCl2 and deionized water. Soils and tissues were returned to the laboratory the same day and stored overnight at 4  C.

Soil analyses The next morning, soil from each core was gently mixed in the plastic bags and a sub-sample (ca. 30 g) was dried at 105  C for

M.D. Jones et al.

48 h to determine moisture content. A second sub-sample (30 g) was weighed, shaken for 1 h in 100 ml of 1.0 N KCl solution, filtered (Whatman #42) and frozen at 20  C. The remainder of each sample was air-dried and later analyzed for pH (1:2 ¼ soil:water) and organic matter content by loss-onignition (16 h at 550  C). Sub-samples of soil extracts were oxidized so that dissolved organic N would be converted to NO3-N (D’Elia et al. 1977). After being syringe filtered through a 0.45 mm PVDF membrane filter (Durapore), a 5 ml aliquot was placed in an acid-washed, 50 ml Falcon tube and stored at 20  C. When all samples were filtered, 10 ml of persulphate solution (0.15 M potassium persulphate, 0.35 M NaOH, 0.45 M boric acid) was added to each tube and all vials were weighed and then autoclaved at 121  C for 45 min. After autoclaving, tubes were reweighed to determine loss due to evaporation and 5 ml of deionized water was added. Samples were transferred to 25 ml scintillation vials and stored at 20  C. The original soil extracts (for analysis of dissolved inorganic N), as well as the oxidized sub-samples (for analysis of dissolved organic N) were shipped frozen to the Laboratoire d’E´cologie des Sols, Universite´ de Sherbrooke, for further processing and analysis. There, concentrations of NHþ 4 -N,  NO 3 -N and NO2 -N were measured on a Technicon II AutoAnalyser (Pulse Instrumentation Ltd., Saskatoon, Canada) using the nitroprusside-salicylate method for NHþ 4 and copper-coated Cd reduction column standard method for  NO 3 þ NO2 . Extracts were prepared for mass spectrometry by passive diffusion on acid traps according to Brooks et al. (1989), with the amount of N diffused adjusted with 10 mg N l1 (NH4)2SO4 to 300 mg N, with expected enrichment of about 1 % N, as suggested by Bradley & Fyles (1996). Prior to the diffusion process, Devarda’s alloy was added to the extracts of the soils þ injected with K15NO3 to convert NO 3 to NH4 . Traps were dried in a desiccator containing a layer of H2SO4, and then encapsulated in Sn capsules for isotopic analysis.

Mycorrhizal identification Every root tip of each seedling exposed to a 26 or 78 h chase period was examined microscopically at magnifications of 50 or 400. A root was classified as a mycorrhiza based on the presence of a mantle. Mycorrhizas formed by Wilcoxina spp. typically have thin mantles and hence required observation at the higher magnification. All ectomycorrhizas were categorized morphologically (Goodman et al. 1996a). Characters used to group mycorrhizas into morphotypes included colour and branching pattern of the mycorrhiza; hyphal width, cell wall thickness, presence of clamps, and encrustations of the extramatrical hyphae; and mantle pattern and thickness. These characteristics were compared with published descriptions (Agerer 1987–1996; Goodman et al. 1996b), including our earlier studies at this site (Hagerman 1997; Hagerman et al. 1999). Fungal DNA from mycorrhizas of the four most common morphotypes was extracted, amplified and sequenced for identification. Extraction and amplification of the internal transcribed spacer (ITS) region of the fungal nuclear rDNA and part of the 28S ribosomal gene followed the methods of Sakakibara et al. (2002) using the primers ITS1

15

N uptake by ectomycorrhizal fungi in situ

113

(50 TCCGTAGGTGAACCTGCGG30 ; White et al. 1990) and NL6bmun (50 CAAGCGTTTCCCTTTCAACA30 ; Egger 1995). For Cenococcum and Wilcoxina mycorrhizas, following extraction, PCR products were cleaned with a Wizard (Promega) cleanup kit and cloned using a pGEM (Promega) cloning kit prior to sequencing with primers ITS4 (TCCTCCGCTTATTGATATGC; White et al. 1990) and NL6Bmun. PCR products of the Amphinema and Lactarius mycorrhizas were cleaned, but not cloned, prior to sequencing. Forward and reverse sequences were aligned in Sequencher 4.2 (Gene Codes, Ann Arbor, MI). The resulting consensus sequences were then manually corrected and trimmed. We submitted the ITS portion of the sequence (ITS1, 5.8S and ITS2 regions), either alone or together with the partial 28S rRNA gene, for BLAST searching through the NCBIlinked (http://www.ncbi.nlm.nih.gov) and UNITE (http://unite. ut.ee/; Ko˜ljalg et al. 2005) databases.

Analysis of plant tissues Seedling roots and shoots were dried at 60  C for 72 h, ground through a 20-mesh screen in a Thomas Wiley Mini-Mill, and 1 mg sub-samples wrapped in Sn capsules and sent to the Stable Isotope Lab (University of California–Davis) for analysis of 15N and total N by continuous flow mass spectrometry.

Data analysis No accumulation of 15N could be detected with only 4 h exposure to 15N-labelled soil, hence only data from the 26 and 78 h chase periods were used to calculate seedling N uptake rates. Net accumulation of 15N from the applied label, in mg 15N per mg tissue (15NACC/MG), was calculated for each N form as follows: 15

NACC=MG ¼ 15Ntx  15Nt0

(1)

where 15

N¼

atom% 15 N in tissue  tissue N content tissue biomass

(2)

and where tx refers to a chase period of 26 or 78 h, and t0 refers to seedlings harvested immediately after injection. Accumulation of NH4-N or NO3-N per unit mass (NH4-NACC/MG or NO3-NACC/MG) of shoot or root was then estimated as NH4  NACC=MG ¼ 15NACC=MG  ð14þ15 NH4SOIL =15 NH4SOIL Þ

(3)

NO3  NACC=MG ¼ 15NACC=MG  ð14þ15 NO3SOIL =15 NO3SOIL Þ

(4)

where 14þ15NH4SOIL and 14þ15NO3SOIL are, respectively, the total amounts of NH4-N and NO3-N extracted at 0 h, and 15NH4SOIL and 15NO3SOIL are respectively the amounts of NH4–15N and NO3–15N extracted at 0 h. The ratio of 14þ15NH4SOIL/15NH4SOIL was 5.417 for mineral soil, 6.7527 for organic soil, and 5.525 for decayed wood. The ratio of 14þ15NO3SOIL/15NO3SOIL was 1.254 for mineral soil, 1.700 for organic soil and 1.450 for decayed wood. Using a standard Mantel test (e.g. Lekberg et al. 2007) of fungal community dissimilarity against inter-seedling distance, we found no evidence to suggest that seedlings growing near one another shared more similar EM fungal communities (based upon the Jaccard index) than seedlings

further apart (N ¼ 122 seedlings; Mantel r ¼ 0.007; P > 0.25). Results were similar when the Mantel test used randomizations stratified by planting substratum (N ¼ 42 in mineral soil, 35 in organic soil and 45 in decayed wood), and when the Bray– Curtis index was used in lieu of the Jaccard index (both P > 0.3). Each seedling was therefore treated as an independent sampling unit within the main statistical analyses. The influence of mycorrhizal colonization on seedling dry weight, tissue N concentration and accumulation of 15N was evaluated using a linear regression of these variables against the percentage of the roots that were mycorrhizal, with planting substratum, form of 15N applied, and labelling period included as dummy variables. To compare the effects of different fungi on uptake of 15N, data were used from only those seedlings where 80 % of the mycorrhizas on the root system, representing at least 25 % of the total number of root tips, were considered to be formed by one EM fungus. Data on species effects were analyzed using analysis of covariance, with fungal species as a categorical predictor and % colonization as a continuous covariate predictor variable. These analyses were performed in the R statistical environment (R version 2.7.0 for Mac). Initially all interactions were included in the models; each was then simplified to the minimal adequate model using the Akaike Information Criterion (Burnham & Anderson 2002) calculated by the STEP function in R. In all cases, except for total accumulation of 15N per shoot, the minimal adequate model excluded the interaction terms. Soil variables, including pH, loss-on-ignition, and N pools, were compared amongst soil substrata using one-factor ANOVA with JMP Version 5.1.2 (SAS Inc.). Where necessary, plant or soil data were transformed by log10 or square root to meet the criteria of normality and homogeneity of variance. If the transformations were not effective in satisfying these criteria, a Wilcoxon (two groups) or Kruskal–Wallis (more than two groups) test was performed instead of the ANOVA for soil variables. Distribution of non-mycorrhizal plants amongst N forms, labelling times, and planting substratum was analyzed by Chi-square analysis. For all statistical tests, relationships were considered significant at a ¼ 0.05.

Results Soil planting sites Approximately 60 % of the extractable N in the soils prior to labelling was dissolved organic N (6.2  0.7 mg N per core), with most of the remainder being NH4-N (3.7  0.3 mg N per core). Nitrate comprised only 3 % of the extractable N (0.3  0.1 mg N per core). The mean pH was 3.92  0.04. Neither pH (P ¼ 1.0; Kruskal–Wallis) nor the pool sizes of the three forms of N (P  0.1) differed amongst cores that were classified as different substratum types (mineral, organic, wood). Mass loss-on-ignition varied amongst soil substrates (P ¼ 0.002; Kruskal–Wallis): organic matter content was 23.5  4.2 % in cores classified as mineral soil, 27.8  5.1 % in organic soil and 53.6  7.3 % in decayed wood. Gravimetric water content (g water g1 dry soil) was 0.95  0.08 in cores classified as mineral soil, 1.27  0.07 in organic soil and 1.93  0.07 in decayed wood (water potential data not available).

114

M.D. Jones et al.

Seedlings planted in decayed wood had higher root and total seedling biomass than seedlings planted in sites classified as mineral soil (Table 1). There was no effect of planting site on shoot biomass; however, the concentration of N in shoot tissues was higher for seedlings planted in sites classified as organic than in those classified as mineral. Planting substrata did not affect N concentrations in roots (Table 1), total N content in shoots (684  27 mg) or roots (206  10 mg), nor the accumulation of 15N (shoots: 10.7  2.0 mg g1 dwt; roots: 105.6  5.7 mg g1 dwt).

Influence of mycorrhizal colonization At the time of labelling, approximately 20 % of the seedlings remained entirely non-mycorrhizal. Non-mycorrhizal seedlings were distributed amongst each planting substratum (P ¼ 0.7), 15 N form (P ¼ 0.8) and labelling period (P ¼ 0.8). More heavily colonized seedlings had higher root (P < 0.0001) and total (P ¼ 0.007) biomass, but not shoot biomass (Fig 1). Interestingly, more extensive colonization of the root systems was associated with lower concentrations of N in both shoots (P ¼ 0.002) and roots (P < 0.0001; Fig 2a, b). As a result of their larger size, more heavily colonized roots contained more total N than less colonized roots (P ¼ 0.004; Fig 2c). The total N content of shoots was not affected by mycorrhizal colonization. Accumulation of 15N per unit dwt of shoot or root was not affected by the extent of mycorrhizal colonization across a range

Table 1 – Dry weights and nitrogen concentrations of shoots and root systems of 15-m-old Picea engelmannii seedlings grown in a subalpine clearcut for 13 m and then treated with 636 mg 15N as nitrate or ammonium or aspartate for 26 or 78 h Dry weight (mg) Shoots of seedlings in mineral soil Shoots of seedlings in organic soil Shoots of seedlings in decayed wood Roots of seedlings in mineral soil Roots of seedlings in organic soil Roots of seedlings in decayed wood Whole seedlings in mineral soil Whole seedlings in organic soil Whole seedlings in decayed wood

N concentration in tissue (mg g1)

54.5  2.9

11.1  0.5 a

55.6  2.9

13.6  0.6 b

59.7  2.8

12.1  0.5 ab

14.8  1.1 a

12.5  0.6

15.6  1.1 ab

13.5  0.5

20.1  1.4 b

12.8  0.5

69.4  3.8 a

nc

71.1  3.8 ab

nc

79.8  3.9 b

nc

Data are shown as means  1 SEM. Means followed by different letters were significantly different at P ¼ 0.05 according to t-tests amongst intercepts of regressions between the variables shown and % of root tips forming mycorrhizas. nc ¼ not calculated.

of 0–100 % of roots colonized. Shoots, but not roots, accumulated more 15N per g when soils were labelled with ammonium (14.7  3.9 mg g1 dwt) or nitrate (12.8  3.7 mg g1 dwt) than with aspartate (4.1  2.4 mg g1 dwt; P ¼ 0.008). By accounting for the dilution of 15N by initial soil 14N-ammonium and 14N-nitrate pools, we determined that seedlings tended to accumulate higher amounts of total NH4-N than NO3-N over the labelling period (Roots: P ¼ 0.09, Shoots: P ¼ 0.05, Kruskal–Wallis; data not shown). We could not estimate total aspartate uptake (i.e., including unlabelled soil aspartate) because initial aspartate pools were unknown. Uptake duration (26 vs. 78 h) and soil substratum did not affect the amount of 15N accumulated in plant tissues.

N uptake by seedlings colonized by different ectomycorrhizal fungi Three EM fungi, Wilcoxina sp., Amphinema sp. and Cenococcum sp., were common enough to evaluate their effect on N uptake into the seedlings. We also considered as a separate group those seedlings with dark septate (DS) hyphae mixed into the Amphinema mantles, a common occurrence at this site. Based on the criteria described above (80 % of mycorrhizas formed by one fungus, with those mycorrhizas representing at least 25 % of all root tips), there were six Wilcoxina, sixteen Amphinema, eight Cenococcum and nine Amphinema þ DS seedlings. Each of these four seedling groups had representatives exposed to each form of 15N and from all three substratum types. Seedlings colonized by these fungi did not differ in root dry weight (18.5  1.3 mg), total N concentration (shoots: 11.4  0.6; roots: 12.3  0.7 mg N g1 dwt) or number of root tips colonized by the primary fungus (35.4  3.9 per seedling). Shoot weights of seedlings colonized primarily by Amphinema sp. were smaller (44.7  4.2 mg) than other groups (Wilcoxina sp.: 65.4  8.5 mg; Amphinema þ DS: 65.7  8.0 mg; Cenococcum: 73.6  12.2 mg). The percentage of roots colonized (from 25 % to 78 %) did not influence seedling biomass nor the overall concentrations of N in shoots or roots. Neither were there any significant interactions between the percentage of roots colonized and effects of EM fungal species on biomass or N concentration. There were, however, significant differences amongst EM plants in the amount of 15N accumulated, depending on the fungus colonizing the roots. Seedlings colonized primarily by Wilcoxina accumulated 15N at the highest rate per unit dry weight in both shoots and roots, whereas those colonized primarily by Cenococcum or Amphinema þ DS accumulated significantly less (Fig 3). This resulted in significantly higher total accumulation of 15N in shoots and roots of Wilcoxina seedlings than in shoots of Cenococcum seedlings (P ¼ 0.001) and roots of Cenococcum or Amphinema þ DS seedlings (P ¼ 0.005; Fig 4). Mean 15N accumulation per unit dry weight by non-mycorrhizal (NM) seedlings was intermediate to those by groups of seedlings colonized by specific fungi (Fig 3). There was no effect of the percentage of roots colonized by the fungi on accumulation of 15N per unit dry weight (Supplementary Fig S1) and no interaction between N form applied and EM fungal species effects. There was, however, a positive relationship between percentage of roots colonized by the EM fungus and EM fungus for total 15N accumulated in roots (P ¼ 0.04) and a significant interaction between colonization and

15

N uptake by ectomycorrhizal fungi in situ

b

0.4 0.35

0.4

root dry wt (square root of g)

shoot dry wt (square root of g)

a

115

0.3 0.25 0.2 0.15 0.1 0.05

0.35 0.3 0.25 0.2 0.15 0.1 0.05 0

0 0 10 20 30 40 50 60 70 80 90 100

0

10 20 30 40 50 60 70 80 90 100

% of root tips colonized

% of root tips colonized

c

0.5

total seedling dry wt (square root of g)

0.45 0.4 0.35 0.3 0.25 0.2 0.15 0.1 0.05 0 0

10

20

30

40

50

60

70

80

90 100

% of roots colonized Fig 1 – Shoot (a), root (b) and total (c) dry weight of Picea engelmannii seedlings grown in a subalpine clearcut for 13 months. Where lines are drawn, significant (P £ 0.05) relationships occurred between dry weights and the percentage of root tips naturally colonized in situ by ectomycorrhizal fungi.

EM fungus for total 15N accumulation by shoots (P ¼ 0.04; Fig 4). Specifically, seedlings more heavily colonized with Cenococcum accumulated more total 15N than those less colonized, whereas there was a slight negative relationship between total accumulation of 15N into shoots and % colonization for seedlings colonized by the other fungi.

Discussion In our study, larger spruce seedlings had a higher percentage of mycorrhizal roots than smaller seedlings. Because mycorrhizal colonization occurred in situ, we cannot determine whether colonization stimulated the growth of seedlings or whether smaller seedlings were less apt to be colonized because their smaller root systems had a lower probability of encountering inoculum. In any case colonization had no effect on the uptake of 15N per unit biomass, regardless of the form of 15N applied. This was contrary to our hypothesis and to several other field and laboratory studies (e.g. Wallander et al. 1997; Quoreshi & Timmer 2000; Kennedy et al. 2007). The lack of a more pronounced colonization effect on short-term uptake per unit biomass may have been because 15N was applied in a readily available, soluble form in close proximity to roots. Ectomycorrhizal fungi stimulate N uptake primarily by providing access to N from complex organic forms and by absorbing less mobile forms from soil beyond the depletion zones that develop around roots (Smith & Read 1997). Our results are consistent with studies finding greater N

accumulation per unit dry weight in EM than in NM seedlings where complex forms of organic N dominate the N pool, but not where inorganic forms of N are abundant (Eltrop & Marschner 1996; Schmidt et al. 2006). Our study took place 5 y after clearcut harvesting, at a time when mineralization of organic N had resulted in increased concentrations of both nitrate and ammonium compared to uncut forests (Hope 2001): in our unlabelled samples, inorganic N (ammonium, nitrate) represented 40 % of the soluble N pool. It is common to find such high ratios of inorganic N to soluble organic N in clearcut soils (Hannam & Prescott 2003). Therefore, our results regarding a lack of colonization effect on short-term uptake of inorganic N, per unit dry weight, are highly relevant for disturbed sites in temperate coniferous forests. Over the long-term, however, highly colonized root systems contained more total N, but had lower N concentrations, than less colonized seedlings. This effect is consistent with a dilution of N in seedlings whose growth was stimulated by mycorrhizas as a result of increased uptake of some other limiting nutrient or by water. However, other studies of young spruce growing in the same clearcuts at Sicamous Creek have detected adequate foliar P, K, Mg, Ca, S, B, Cu, Fe, Mn, and Zn, but slightly to moderately deficient N levels, depending on the site preparation treatment (G. Hope and C. Prescott, unpublished data). This suggests that these other nutrients are not likely to be limiting. Furthermore, Sicamous Creek is a moist site and, hence, N is still expected to be the most limiting soil-derived resource. It is possible that growth stimulation and N dilution were associated with a biological or hormonal effect (Simard et al. 2002).

116

M.D. Jones et al.

a

b Shoots

log10 concentration of N (mg g-1)

log10 concentration of N (mg g-1)

1.6 1.4 1.2 1 0.8 0.6

1.6

Roots

1.4 1.2 1 0.8 0.6

0

10 20 30 40 50 60 70 80 90 100

0

10 20 30 40 50 60 70 80 90 100

% of root tips colonized

log10 N content of roots (µg)

c

% of root tips colonized

3 2.5 2 1.5 1 0.5

Roots 0

10 20 30 40 50 60 70 80 90 100

% of roots colonized Fig 2 – N concentrations in (a) shoots and (b) roots and (c) N contents of roots of Picea engelmannii seedlings grown in a subalpine clearcut for 13 months. Lines represent significant (P < 0.05) relationships with the percentage of root tips naturally colonized in situ by ectomycorrhizal fungi. In (a), shoots of seedlings growing in organic planting sites (open circles, dashed line) had significantly (P £ 0.05) higher N concentrations than shoots of seedlings growing in mineral soil (open squares, solid line); crosses [ seedlings in decayed wood.

15N accumulated (µg per g dwt)

The most important result of this experiment is the demonstration of physiological differences amongst EM fungi for N uptake into host plants in the field. Although differences

100

Wilcoxina Amphinema

80 60

Amphinema + DS Cenococcum

40 20 0 -20

Shoots

Roots

Fig 3 – 15N accumulated per unit dry weight by shoots and roots of Picea engelmannii seedlings colonized in situ by different ectomycorrhizal fungi and labelled with 636 mg 15N for 26 or 78 h (data combined). At least 80 % of the mycorrhizas on each seedling were formed by Wilcoxina sp., Amphinema byssoides, Amphinema with dark septate hyphae in the mantle or Cenococcum sp. The horizontal lines represent mean accumulation of 15N by non-mycorrhizal seedlings. Bars are standard error of the mean.

in N accumulation and assimilation by seedlings mycorrhizal with different EM fungi have been demonstrated frequently in the lab (e.g. Finlay et al. 1988; Abuzinadah & Read 1989; Turnbull et al. 1995; Boukcim & Plassard 2003), being able to detect the same phenomenon in highly variable field soils is noteworthy. Indeed, one of the most remarkable aspects of our results is how the high variability in N uptake amongst the spruce seedlings could be parsed, even across different soil substrata, by considering groups of seedlings colonized by different EM fungi. Although NM and lightly colonized seedlings took up similar amounts of 15N per unit dry weight as heavily colonized seedlings, our separate analysis of heavily colonized seedlings indicates that this is a result of high variability amongst EM seedlings colonized by different EM fungi, rather than a true lack of an effect of mycorrhization. Not only did seedlings colonized by different EM fungi accumulate different total amounts of 15N, they responded differently to the extent of colonization, depending on the fungus. Such differences amongst EM fungi may explain why metaanalyses can fail to detect an effect of colonization extent on seedling response to mycorrhization (Karst et al. 2008). Overall, our results indicate that physiological differences amongst EM fungi are responsible for some of the variation in nutrient uptake amongst seedlings growing in the field. The importance of ascomycetous EM fungi in northern forests is becoming increasingly appreciated (Egger 2006; Tedersoo et al. 2006), and the fungi that differed most in our

15

N uptake by ectomycorrhizal fungi in situ

b

1

Shoots

Total accumulation of 15N (log 10 µg +1)

Total accumulation of 15N (log10 µg +3)

a

117

0.8 0.6 0.4 0.2 0 -0.2

20

30

40

50

60

70

80

% of roots colonized by fungus

1

Roots

0.8 0.6 0.4 0.2 0 -0.2 -0.4

20

30

40

50

60

70

80

% of roots colonized by fungus

Fig 4 – Total 15N accumulated per (a) shoot or (b) root of Picea engelmannii seedlings colonized in situ by different ectomycorrhizal fungi and labelled with 636 mg 15N for 26 or 78 h. At least 80 % of the mycorrhizas on each seedling were formed by Wilcoxina sp. (star, solid line), Amphinema byssoides (open circles, large dashes), Amphinema with dark septate hyphae in the mantle (closed circles, small dashes) or Cenococcum sp. (crosses, dotted line).

study were two ascomycetes: a Cenococcum sp. and a Wilcoxina sp. The differences in 15N accumulation observed amongst seedlings colonized by these two fungi could have several explanations including differential expression of ammonium, nitrate or amino acid transporters by the fungi or roots (Benjdia et al. 2006), effects of the fungi on host nutrient demand (Glass 2003) or differences in the activities of bacteria or microfungi specific to the mycorrhizospheres of different fungi (Olsson & Wallander 1998; Timonen et al. 1998; FreyKlett et al. 2005; Wu et al. 2005). Detailed follow-up studies in the lab will be required to distinguish amongst these possibilities. It is unlikely that differences in N accumulation were due to differences in the length and exploration pattern of extramatrical hyphae produced by each fungus. Wilcoxina, which was associated with the greatest accumulation of 15N, and Cenococcum, which was associated with the lowest accumulation, are both classified by Agerer (2001) in the shortdistance exploration category of mycorrhizas. Amphinema sp., which was associated with intermediate to high accumulation of 15N in its hosts, produces rhizomorphs that extend a medium distance from the root (Agerer 2001). If hyphal length was responsible for differences amongst seedlings, uptake and accumulation of 15N would be expected to be lowest in seedlings colonized primarily by Cenococcum or Wilcoxina, but this was not the case. The finding that total accumulation of 15N was especially low in seedlings with less than 50 % of their roots colonized by Cenococcum is highly relevant because Cenococcum mycorrhizas are often found as individual scattered mycorrhizas within a root system (M. Jones, personal observation). Dark septate ascomycetous fungi are frequently detected together with EM fungi in ectomycorrhizas (Twieg et al. 2007; Wagg et al. 2008); however, their effect on nutrient uptake by those mycorrhizas has not been previously studied (Mandyam & Jumpponen 2005). These fungi are often members of species complexes of Cadophora, Phialophora, Phialocephala or Rhizoscyphus spp. (Zhang & Zhuang 2004; Hambleton & Sigler 2005; Bergemann & Garbelotto 2006). When they form ectomycorrhizas alone, some authors have found these fungi to be mildly pathogenic (Wang & Wilcox 1985; Wilcox & Wang

1987a, b), but when coinoculated with ericoid mycorrhizal fungi, they can stimulate N uptake (Vohnik et al. 2005). In the present study, dark septate hyphae in the mantles of Amphinema mycorrhizas were associated with positive effects on long-term seedling growth, but with a reduction in the uptake of 15N. Further experimentation will be required to determine the mechanism by which the dark septate fungi in our system and others influence EM physiology (Mandyam & Jumpponen 2005). A strength of our experimental design is that seedlings became colonized with EM fungi under natural forest regeneration conditions. Therefore we feel that our results reflect actual short-term uptake in the field. We caused some soil disturbance by coring around the seedlings several weeks before isotope labelling; however, we are confident that the coring procedure was necessary and had minimal effect on our interpretation. First, it was necessary to prevent extensive uptake of 15N by neighbouring plants. Growth of herbaceous plants was substantial on the clearcut, and coring was essential to reduce competition from the root systems of these plants. Second, the spacing of the spruce seedlings planted 4 y earlier was scattered and irregular. We anticipate that approximately 20 % of our experimental seedlings were close enough to one of these seedlings to have the potential to be colonized by EM fungi from their root systems. Coring eliminated this additional source of variation. Finally, given that the exploration types of the dominant EM fungi we encountered typically extend less than 0.5 cm from the mantle surface (Agerer 2001), we expect that very little severing of hyphae occurred during insertion of the plastic liners. Thus, by labelling soil of consistent volume and with reduced numbers of roots of other plants, we were better able to evaluate the effects of mycorrhization on N uptake. A major point of discussion amongst community ecologists is the relative importance of dispersal limitation vs. niche partitioning in structuring biological communities (Chu et al. 2007; Zhou & Zhang 2008). The former is a key factor influencing community composition according to neutral models of community assemblage. Amongst EM fungi, there is

118

evidence that both factors are important (Bruns 1995; Dickie 2007; Ishida et al. 2007; Peay et al. 2007). However, most of the evidence for niche differentiation amongst EM fungi is based on differences in spatial distributions. To provide stronger evidence for resource partitioning, such differences should be correlated with the expected differences in physiology. Here we studied three EM fungi that are widespread (Izzo et al. 2006; Douhan et al. 2007), highly abundant (Hagerman et al. 1999; Mah et al. 2001; Rudawska et al. 2006) colonizers of young conifers in disturbed environments. Hence physiological differences amongst them are likely not as great as would be expected amongst EM fungi found in mature forests. Nevertheless, our approach was able to detect differences suggestive of resource partitioning even within a very simple early successional community.

Conclusion Our data illustrate that functional differences exist amongst ectomycorrhizal fungi in the field for N uptake into their hosts. This is noteworthy because we were able to detect this diversity amongst seedlings planted in highly diverse forest soils. Our findings that differences in uptake of soluble N amongst plants mycorrhizal with different EM fungi were obscured when overall effects of mycorrhizal colonization were examined means that misleading conclusions may be drawn from models that consider all EM fungi as functionally equivalent. Instead, a closer examination of differences amongst mycorrhizal fungi in their effects on plant hosts will add conceptual richness and explanatory power to current models of interactions between mycorrhizal fungi and plants (Bever 2003; Johnson et al. 2006).

Acknowledgements Funding for the study was provided by a Natural Sciences and Engineering Research Council of Canada Strategic Grant to Robert Bradley (PI), Melanie Jones, Cindy Prescott, and Tony Glass, and by Okanagan University College. We are extremely grateful to a dedicated field and lab crew that was led by Carl Redmond and included Tabitha Becroft, Adrienne Boon, Amanda Clowers, Lisa Dreger, John Grant, Karen Hogg, Melissa Holt, Aaron Macnabb, Steven Morse, James Reid, Stacey Sakakibara, Jeff Smith, and Bernie Wilson. Frann Antignano carried out the molecular work and Sarah Hambleton provided advice on sequence analysis. Rich Boone, Terry Chapin, and Knut Kielland of the University of Alaska Fairbanks supplied valuable advice during the initial design of the experiment. Jason Pither, Bjo¨rn Lindahl and Franc¸ois Rineau provided statistical advice and thought-provoking comments.

Supplementary material Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.funeco.2009.02.002.

M.D. Jones et al.

references

Abuzinadah RA, Read DJ, 1989. The role of proteins in the nitrogen nutrition of ectomycorrhizal plants. 4. The utilization of peptides by birch (Betula pendula L) infected with different mycorrhizal fungi. New Phytologist 112: 55–60. Agerer R, 1987–1996. Colour atlas of ectomycorrhizae. Einhorn-Verlag Eduard Dietenberger, Schwa¨bisch Gmu¨nd, Germany. Agerer R, 2001. Exploration types of ectomycorrhizae. Mycorrhiza 11: 107–114. Benjdia M, Rikirsch E, Muller T, Morel M, Corratge C, Zimmermann S, Chalot M, Frommer WB, Wipf D, 2006. Peptide uptake in the ectomycorrhizal fungus Hebeloma cylindrosporum: characterization of two di- and tripeptide transporters (HcPTR2A and B). New Phytologist 170: 401–410. Bergemann SE, Garbelotto M, 2006. High diversity of fungi recovered from the roots of mature tanoak (Lithocarpus densiflorus) in northern California. Canadian Journal of Botany 84: 1380–1394. Bever JD, 2003. Soil community feedback and the coexistence of competitors: conceptual frameworks and empirical tests. New Phytologist 157: 465–473. Boukcim H, Plassard C, 2003. Juvenile nitrogen uptake capacities and root architecture of two open-pollinated families of Picea abies. Effects of nitrogen source and ectomycorrhizal symbiosis. Journal of Plant Physiology 160: 1211–1218. Bradley RL, Fyles JW, 1996. Method to avoid isotope discrimination during the diffusion of NHþ 4 from N-15-labelled soil extracts. Soil Biology and Biochemistry 28: 695–697. Brockley RP, 1992. Effects of fertilization on the nutrition and growth of a slow-growing Engelmann spruce plantation in south central British Columbia. Canadian Journal of Forest Research 22: 1617–1622. Brooks PD, Stark JM, McInteer BB, Preston T, 1989. Diffusion method to prepare soil extracts for automated N-15 analysis. Soil Science Society of America Journal 53: 1707–1711. Bruns TD, 1995. Thoughts on the processes that maintain local species-diversity of ectomycorrhizal fungi. Plant and Soil 170: 63–73. Bue´e M, Vairelles D, Garbaye J, 2005. Year-round monitoring of diversity and potential metabolic activity of the ectomycorrhizal community in a beech (Fagus silvatica) forest subjected to two thinning regimes. Mycorrhiza 15: 235–245. Burnham KP, Anderson DR, 2002. Model Selection and Multimodel Inference: a Practical Information-theoretic Approach. Springer, New York. Chu CJ, Wang YS, Du GZ, Maestre FT, Luo YJ, Wang G, 2007. On the balance between niche and neutral processes as drivers of community structure along a successional gradient: insights from alpine and sub-alpine meadow communities. Annals of Botany 100: 807–812. Coupe´ R, Stewart AC, Wikeem BM, 1991. Engelmann spruce – subalpine fir zone. In: Meidinger, D., Pojar, J. (Eds), Ecosystems of British Columbia. Research Branch, British Columbia Ministry of Forests, Victoria, Canada, pp. 223–236. Courty PE, Pritsch K, Schloter M, Hartmann A, Garbaye J, 2005. Activity profiling of ectomycorrhiza communities in two forest soils using multiple enzymatic tests. New Phytologist 167: 309–319. Dahlberg A, 2001. Community ecology of ectomycorrhizal fungi: an advancing interdisciplinary field. New Phytologist 150: 555–562. D’Elia C, Steudler PA, Corwin N, 1977. Determination of total nitrogen in aqueous samples using persulfate digestion. Limnology and Oceanography 22: 760–764. Dickie IA, 2007. Host preference, niches and fungal diversity. New Phytologist 174: 230–233.

15

N uptake by ectomycorrhizal fungi in situ

Dickie IA, Xu B, Koide RT, 2002. Vertical niche differentiation of ectomycorrhizal hyphae in soil as shown by T-RFLP analysis. New Phytologist 156: 527–535. Dighton J, Mason PA, Poskitt JM, 1990. Field use of P-32 to measure phosphate – uptake by birch mycorrhizas. New Phytologist 116: 655–661. Douhan GW, Huryn KL, Douhan LI, 2007. Significant diversity and potential problems associated with inferring population structure within the Cenococcum geophilum species complex. Mycologia 99: 812–819. Egger KN, 1995. Molecular analysis of ectomycorrhizal fungal communities. Canadian Journal of Botany 73 (Suppl. 1): S1415–S1422. Egger KN, 2006. The surprising diversity of ascomycetous mycorrhizas. New Phytologist 170: 421–423. Eltrop L, Marschner H, 1996. Growth and mineral nutrition of nonmycorrhizal and mycorrhizal Norway spruce (Picea abies) seedlings grown in semi-hydroponic sand culture. I. Growth and mineral nutrient uptake in plants supplied with different forms of nitrogen. New Phytologist 133: 469–478. Finlay RD, Ek H, Odham E, So¨derstro¨m B, 1988. Mycelial uptake, translocation and assimilation of nitrogen from 15N-labelled ammonium by Pinus sylvestris plants infected with four different ectomycorrhizal fungi. New Phytologist 110: 59–66. Frey-Klett P, Chavatte M, Clausse ML, Courrier S, Le Roux C, Raaijmakers J, Martinotti MG, Pierrat JC, Garbaye J, 2005. Ectomycorrhizal symbiosis affects functional diversity of rhizosphere fluorescent pseudomonads. New Phytologist 165: 317–328. Genney DR, Anderson IC, Alexander IJ, 2006. Fine-scale distribution of pine ectomycorrhizas and their extramatrical mycelium. New Phytologist 170: 381–390. Glass ADM, 2003. Nitrogen use efficiency of crop plants: physiological constraints upon nitrogen absorption. Critical Reviews in Plant Sciences 22: 453–470. Goodman DM, Trofymow JA, 1998. Distribution of ectomycorrhizas in micro-habitats in mature and old-growth stands of Douglas-fir on southeastern Vancouver island. Soil Biology and Biochemistry 30: 2127–2138. Goodman DM, Durall DM, Trofymow JA, 1996a. Describing ectomycorrhizae. In: Goodman, D.M., Durall, D.M., Trofymow, J.A., Berch, S.M. (Eds), A Manual of Concise Descriptions of North American Ectomycorrhizae. Mycologue Publications and Canada-B.C. Forest Resource Development Agreement, Canadian Forest Service, Victoria, Canada, pp. 3A.1–3A.5. Goodman DM, Durall DM, Trofymow JA, Berch SM, 1996b. A Manual of Concise Descriptions of North American Ectomycorrhizae. Mycologue Publications and Canada-B.C. Forest Resource Development Agreement, Canadian Forest Service, Victoria, Canada. Hagerman SM, 1997. Quantifying the effects of different clear-cut sizes on ectomycorrhizal fungi at a subalpine forest: persistence and diversity. MSc thesis, University of British Columbia, Canada. Hagerman SM, Jones MD, Bradfield GE, Sakakibara SM, 1999. Ectomycorrhizal colonization of Picea engelmannii  Picea glauca seedlings planted across cut blocks of different sizes. Canadian Journal of Forest Research 29: 1856–1870. Hambleton S, Sigler L, 2005. Meliniomyces, a new anamorph genus for root-associated fungi with phylogenetic affinities to Rhizoscyphus ericae (Hymenoscyphus ericae), Leotiomycetes. Studies in Mycology 53: 1–27. Hannam KD, Prescott CE, 2003. Soluble organic nitrogen in forests and adjacent clearcuts in British Columbia, Canada. Canadian Journal of Forest Research 33: 1709–1718. Hobbie EA, Jumpponen A, Trappe J, 2005. Foliar and fungal 15N:14N ratios reflect development of mycorrhizae and nitrogen

119

supply during primary succession: testing analytical models. Oecologia 146: 258–268. Hope G, 2001. The Soil Ecosystem of an ESSF Forest and its Response to a Range of Harvesting Disturbances. Extension Note 53. British Columbia Ministry of Forests, Victoria, Canada. Huang JG, Bergeron Y, Denneler B, Berninger F, Tardif J, 2007. Response of forest trees to increased atmospheric CO2. Critical Reviews in Plant Sciences 26: 265–283. Hubbell SP, 2005. Neutral theory in community ecology and the hypothesis of functional equivalence. Functional Ecology 19: 166–172. Ishida TA, Nara K, Hogetsu T, 2007. Host effects on ectomycorrhizal fungal communities: insight from eight host species in mixed conifer-broadleaf forests. New Phytologist 174: 430–440. Izzo A, Nguyen DT, Bruns TD, 2006. Spatial structure and richness of ectomycorrhizal fungi colonizing bioassay seedlings from resistant propagules in a Sierra Nevada forest: comparisons using two hosts that exhibit different seedling establishment patterns. Mycologia 98: 374–383. Johnson NC, Hoeksema JD, Bever JD, Chaudhary VB, Gehring C, Klironomos J, Koide R, Miller RM, Moore J, Moutoglis P, Schwartz M, Simard S, Swenson W, Umbanhowar J, Wilson G, Zabinski C, 2006. From Lilliput to Brobdingnag: extending models of mycorrhizal function across scales. Bioscience 56: 889–900. Jonasson S, Chapin FS, 1991. Seasonal uptake and allocation of phosphorus in Eriophorum vaginatum L measured by labeling with P-32. New Phytologist 118: 349–357. Karst J, Marczak L, Jones MD, Turkington R, 2008. The mutualism– parasitism continuum in ectomycorrhizas: a quantitative assessment using meta-analysis. Ecology 89: 1032–1042. Kennedy PG, Bergemann SE, Hortal S, Bruns TD, 2007. Determining the outcome of field-based competition between two Rhizopogon species using real-time PCR. Molecular Ecology 16: 881–890. Kielland K, 1995. Landscape patterns of free amino acids in arctic tundra soils. Biogeochemistry 31: 85–98. Koide RT, Xu B, Sharda J, Lekberg Y, Ostiguy N, 2005. Evidence of species interactions within an ectomycorrhizal fungal community. New Phytologist 165: 305–316. Koide RT, Shumway DS, Xu B, Sharda JN, 2007. On temporal partitioning of a community of ectomycorrhizal fungi. New Phytologist 174: 420–429. Ko˜ljalg U, Larsson K-H, Abarenkov K, Nilsson RH, Alexander IJ, Eberhardt U, Erland S, Hoiland K, Kjoller R, Larsson E, Pennanen T, Sen R, Taylor AFS, Tedersoo L, Vralstad T, Ursing BM, 2005. UNITE: a database providing web-based methods for the molecular identification of ectomycorrhizal fungi. New Phytologist 166: 1063–1068. Lekberg Y, Koide RT, Rohr JR, Aldrich-Wolfe L, Morton JB, 2007. Role of niche restrictions and dispersal in the composition of arbuscular mycorrhizal fungal communities. Journal of Ecology 95: 95–105. Mah K, Tackaberry LE, Egger KB, Massicotte HB, 2001. The impacts of broadcast burning after clear-cutting on the diversity of ectomycorrhizal fungi associated with hybrid spruce seedlings in central British Columbia. Canadian Journal of Forest Research 31: 224–235. Mandyam K, Jumpponen A, 2005. Seeking the elusive function of the root-colonising dark septate endophytic fungi. Studies in Mycology 53: 173–189. Meharg AA, 2003. The mechanistic basis of interactions between mycorrhizal associations and toxic metal cations. Mycological Research 107: 1253–1265. Na¨sholm T, Ekblad A, Nordin A, Giesler R, Ho¨gberg M, Ho¨gberg P, 1998. Boreal forest plants take up organic nitrogen. Nature 392: 914–916.

120

Olsson PA, Wallander H, 1998. Interactions between ectomycorrhizal fungi and the bacterial community in soils amended with various primary minerals. FEMS Microbiology Ecology 27: 195–205. Parke JL, Linderman RG, Black CH, 1983. The role of ectomycorrhizas in drought tolerance of Douglas-fir seedlings. New Phytologist 95: 83–95. Peay KG, Bruns TD, Kennedy PG, Bergemann SE, Garbelotto M, 2007. A strong species-area relationship for eukaryotic soil microbes: island size matters for ectomycorrhizal fungi. Ecology Letters 10: 470–480. Quoreshi M, Timmer VR, 2000. Growth, nutrient dynamics, and ectomycorrhizal development of container-grown Picea mariana seedlings in response to exponential nutrient loading. Canadian Journal of Forest Research 30: 191–201. Robertson SJ, Tackaberry LE, Egger KN, Massicotte HB, 2006. Ectomycorrhizal fungal communities of black spruce differ between wetland and upland forests. Canadian Journal of Forest Research 36: 972–985. Rudawska M, Leski T, Trocha LK, Gornowicz R, 2006. Ectomycorrhizal status of Norway spruce seedlings from bare-root forest nurseries. Forest Ecology and Management 236: 375–384. Sakakibara SM, Jones MD, Gillespie M, Hagerman SM, Forrest ME, Simard SW, Durall DM, 2002. A comparison of ectomycorrhiza identification based on morphotyping and PCR-RFLP analysis. Mycological Research 106: 868–878. Schmidt S, Handley LL, Sangtiean T, 2006. Effects of nitrogen source and ectomycorrhizal association on growth and delta N-15 of two subtropical Eucalyptus species from contrasting ecosystems. Functional Plant Biology 33: 367–379. Simard SW, Jones MD, Durall DM, 2002. Carbon and nutrient fluxes within and between mycorrhizal plants. In: Sanders, I.R., van der Heijden, M. (Eds), Mycorrhizal Ecology. Springer Verlag, Berlin, Germany, pp. 33–74. Smith SE, Read DJ, 1997. Mycorrhizal Symbiosis. Academic Press, San Diego. Soil Classification Working Group, 1998. The Canadian System of Soil Classification. Agriculture and Agri-Food Canada Publication 1646, third ed. NRC Research Press, Ottawa, Canada. Tedersoo L, Hansen K, Perry BA, Kjøller R, 2006. Molecular and morphological diversity of pezizalean ectomycorrhiza. New Phytologist 170: 581–596. Timonen S, Jorgensen KS, Haahtela K, Sen R, 1998. Bacterial community structure at defined locations of Pinus sylvestris – Suillus bovinus and Pinus sylvestris – Paxillus involutus

M.D. Jones et al.

mycorrhizospheres in dry pine forest humus and nursery peat. Canadian Journal of Microbiology 44: 499–513. Turnbull MH, Goodall R, Stewart GR, 1995. The impact of mycorrhizal colonization upon nitrogen source utilization and metabolism in seedlings of Eucalyptus grandis Hill ex Maiden and Eucalyptus maculata Hook. Plant Cell and Environment 18: 1386–1394. Twieg BD, Durall DM, Simard SW, 2007. Ectomycorrhizal fungal succession in mixed temperate forests. New Phytologist 176: 437–447. Vohnik M, Albrechtova J, Vosatka M, 2005. The inoculation with Oidiodendron maius and Phialocephala fortinii alters phosphorus and nitrogen uptake, foliar C:N ratio and root biomass distribution in Rhododendron cv. Azurro. Symbiosis 40: 87–96. Wagg C, Pautler M, Massicotte HB, Peterson RL, 2008. The cooccurrence of ectomycorrhizal, arbuscular mycorrhizal, and dark septate fungi in seedlings of four members of the Pinaceae. Mycorrhiza 18: 103–110. Wallander H, Amebrant K, Ostrand F, Karen O, 1997. Uptake of N15-labelled alanine, ammonium and nitrate in Pinus sylvestris L. ectomycorrhiza growing in forest soil treated with nitrogen, sulphur or lime. Plant and Soil 195: 329–338. Wallenda T, Read DJ, 1999. Kinetics of amino acid uptake by ectomycorrhizal roots. Plant Cell and Environment 22: 179–187. Wang CJK, Wilcox HE, 1985. New species of ectendomycorrhizal and pseudomycorrhizal fungi – Phialophora finlandia, Chloridium paucisporum, and Phialocephala fortinii. Mycologia 77: 951–958. White TJ, Bruns T, Lee S, Taylor J, 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelfand, D.H., Sninski, J.J., White, T.J. (Eds), PCR Protocols: a Guide to Methods and Applications. Academic Press, San Diego, pp. 315–322. Wilcox HE, Wang CJK, 1987a. Mycorrhizal and pathological associations of dematiaceous fungi in roots of 7-month-old tree seedlings. Canadian Journal of Forest Research 17: 884–899. Wilcox HE, Wang CJK, 1987b. Ectomycorrhizal and ectendomycorrhizal associations of Phialophora finlandia with Pinus resinosa, Picea rubens, and Betula alleghaniensis. Canadian Journal of Forest Research 17: 976–990. Wu T, Kabir Z, Koide RT, 2005. A possible role for saprotrophic microfungi in the N nutrition of ectomycorrhizal Pinus resinosa. Soil Biology and Biochemistry 37: 965–975. Zhang YH, Zhuang WY, 2004. Phylogenetic relationships of some members in the genus Hymenoscyphus (Ascomycetes, Helotiales). Nova Hedwigia 78: 475–484. Zhou SR, Zhang DY, 2008. A nearly neutral model of biodiversity. Ecology 89: 248–258.