Differences in amino acid sequences of mistletoe lectin I and III B-subunits determining carbohydrate binding specificity

Biochimica et Biophysica Acta 1675 (2004) 155 – 164 http://www.elsevier.com/locate/bba

Differences in amino acid sequences of mistletoe lectin I and III B-subunits determining carbohydrate binding specificity Irina B. Pevznera,1, Igor I. Agapova,1, Hideaki Niwab, Natalia V. Maluchenkoa,1, Mikhail M. Moisenovicha,1, Uwe Pfqllerc, Alexander G. Tonevitskya,* a

Biological Department, M.V. Lomonosov Moscow State University, Vorobyevy Gory, Moscow 119899, Russia School of Crystallography, Birkbeck College, University of London, Malet Street, London, WC1E 7HX, UK c Institute of Phytochemistry, University of Witten/Herdecke, Stockumer Str. 10, D-58448, Witten, Germany

b

Received 21 July 2004; received in revised form 2 September 2004; accepted 7 September 2004 Available online 19 September 2004

Abstract Toxic lectins of European mistletoe Viscum album L.—MLI (viscumin), MLII and MLIII—are present in water extracts of this plant. Earlier we have cloned the full-length gene of MLIII precursor [A.G. Tonevitsky, I.I. Agapov, I.B. Pevzner, N.V. Maluchenko, M.M. Mojsenovich, U. Pfueller, M.P. Kirpichnikov, (2004) Biochemistry (Mosc.), 69 (6), 790–800, in press]. Here for the first time we report the cloning and expression in Escherichia coli cells of MLIII gene fragment encoding the carbohydrate-binding subunit. We have proved with our panel of monoclonal antibodies against ML toxins that the cloned fragment encoded MLIII B-subunit. The immunochemical and sugarbinding activities of renatured recombinant MLIII B-subunit were demonstrated in ELISA and ELLA, respectively. The comparative analysis of amino acid sequences of the cloned rMLIIIB and the B-subunits of other type II RIPs—MLI, ricin, abrin and nigrin b—was performed, revealing the main differences in primary structure of MLI and MLIII B-chains, which could determine their sugar specificity. The antigenicity analysis of MLI and MLIII B-subunits showed one epitope 25RDDDFRDGNQ34 in MLIB that is absent in MLIIIB sequence. The role of the toxic lectins and their subunits in immunological properties of mistletoe extracts is discussed. D 2004 Elsevier B.V. All rights reserved. Keywords: Mistletoe toxic lectin; Recombinant MLIII B-subunit; Monoclonal antibody

1. Introduction Abbreviations: ABB, abrin-a B-subunit; BSA, bovine serum albumin; ELISA, enzyme-linked immunosorbent assay; Gal, galactose; GalNAc, Nacetylgalactosamine; Gnd-HCl, guanidine hydrochloride; IPTG, isopropylh-d-thiogalactopyranoside; MLI, MLII, MLIII, mistletoe lectins I (viscumin), II, III; MLIB, native MLI B-subunit; MLIIIB, native MLI B-subunit; monAb, monoclonal antibody; PBS, phosphate buffered saline; PCR, polymerase chain reaction; RIP I, ribosome inactivating protein type I; RIP II, ribosome inactivating protein type II; rMLIA, recombinant MLI A-subunit; rMLIB, recombinant MLI B-subunit; rMLIIIA, recombinant MLIII A-subunit; rMLIIIB, recombinant MLIII B-subunit; RTB, ricin Bsubunit; SDS-PAGE, sodium dodecylsulfate polyacrylamide gel electrophoresis; SNAV, nigrin b (Sambucus nigra agglutinin V); SNAVB, nigrin b B-subunit * Corresponding author. Tel./fax: +95 196 0522. E-mail addresses: [email protected] (H. Niwa)8 [email protected] (U. Pf q ller)8 [email protected] (A.G. Tonevitsky). 1 Tel./fax: +95 196 0522. 0304-4165/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.bbagen.2004.09.002

European mistletoe (Viscum album L.) is a semiparasite of coniferous and leafy trees. Mistletoe extracts have been used in immunomodulation and antitumor therapy in Europe since it was shown that complete extracts and their constituents possess immunomodulatory effects such as the enhancement of the phagocytic activity of granulocytes and monocytes and the release of inflammatory cytokines [1–4] and also have anticancer properties [5,6]. The mistletoe toxic lectins are present in all mistletoe extracts. There are three isoforms of European mistletoe lectins: MLI (viscumin), MLII and MLIII [7], which belong to type II ribosome-inactivating proteins (RIPII) [8]. RIPII are heterodimeric glycoproteins consisting of two subunits linked by a disulfide bond. The toxin A-subunit possesses a highly specific N-glycosidase activity and modifies the 28

156

I.B. Pevzner et al. / Biochimica et Biophysica Acta 1675 (2004) 155–164

S rRNA of eukaryotic ribosome 60 S subunit [9], thus arresting the protein synthesis in a cell. The B-subunit is a lectin that binds to cell surfaces causing cell agglutination in vitro [10] and facilitating toxin internalization and it is the reason for a higher cytotoxicity of RIPII in comparison with one-chain RIPI [11]. Despite the high similarity in primary amino acid sequence of three ML-toxins [12,13], there are differences in sugar specificity between these proteins, estimated by hemagglutination inhibition test. MLI, the most abundant of the three mistletoe lectins, is 120-fold more specific towards Gal than GalNAc [14,15], while MLIII shows more affinity for GalNAc, and MLII has intermediate specificity [10,16]. Also the mistletoe toxic lectins differ in the molecular weights of their A- and B-chains: for MLI—29 and 34 kDa, for MLII—27 and 32 kDa, for MLIII—25 and 30 kDa, respectively. MLI at high concentration exists as a noncovalently associated heterotetramer AB-BA with a molecular weight of 115 kDa, while MLII and MLIII, as well as ricin and abrin, are heterodimeric toxins [10]. Furthermore, these toxins display differences in their biological activity. Buessing et al. [17] reported MLIII to be most active in the induction of apoptotic cell death of cultured human lymphocytes, which is in agreement with the findings of Dietrich et al. [12] and Kopp et al. [18], who showed MLIII to be the most potent (followed by MLII and MLI) in the growth inhibition of leukemic Molt4 cells. Hajto et al. [1] found that the carbohydrate-binding B-chain of MLI is responsible for the stimulation of natural killer (NK)-cell activity in vivo while the A-chain appeared to be completely inactive at the same concentration since it has no capacity of selectively binding to cellular receptor glycoproteins. Obtaining recombinant carbohydrate-binding subunits of mistletoe lectins will be useful in the investigation of the potential therapeutic effects of isolated B-chain and in the assessment of the influence of protein glycosylation on structure/function relationships. Eck et al. [19] expressed the recombinant MLI B-chain and studied its carbohydrate binding activity as well as the biological characteristics of recombinant heterodimer of rMLIA and rMLIB. The recombinant heterodimer demonstrated the same biochemical and biological characteristics as the native MLI did. The difference between rMLIB and the plant-derived MLI B-chain in binding with h-d-lactose and GalNAc and the similarity in binding with asialofetuin have been shown. Here we report the cloning and the separate expression of European mistletoe V. album L. MLIII gene fragment encoding the B-chain (rMLIIIB) in Escherichia coli cells. The deduced amino acid sequence of MLIII B-chain was compared with the B-subunits of viscumin, ricin, abrin-a and nigrin b (SNAV) and the main differences in primary structure of MLI and MLIII Bchains that determine the sugar specificity of lectins were revealed. Antigenicity analysis of MLI and MLIII B-

chains based on the amino acid sequences of proteins was conducted. One antigenic epitope was found in MLI B-subunit, which is absent in MLIIIB. The structure and immunochemical properties of recombinant MLIII Bsubunit investigated with a panel of specific monoclonal antibodies showed the presence of antigenic epitopes in rMLIIIB. The sugar-binding activity of rMLIIIB studied in ELISA demonstrated that the obtained recombinant protein forms properly folded carbohydrate-binding sites.

2. Materials and methods 2.1. Materials The oligonucleotides were synthesized by Sintol (Moscow, Russia). DNA-modifying enzymes were purchased from Fermentas (Vilnius, Lithuania). For plasmid DNA isolation and PCR-product preparations, we used the QIAprep and QIAquick purification kits from QIAGEN GmbH (Hilden, Germany). E. coli strain BL21 [B F dcm ompT hsdSB (rB mB ) galE (DE3) was from Stratagene (Kirkland, WA, USA). Plasmid pET11cjoe kindly provided by Prof. A. Patel from Institute for Virology, Medical Research Centre (Glasgow, UK) was used for cloning and expression of carbohydrate-binding MLIII subunit. Native toxic lectins MLI, MLII and MLIII were obtained from leaves of V. album as described earlier [7]. The purified proteins were detected by SDS-PAGE and ELISA methods. All other reagents were of analytical grade and obtained from Sigma (St. Louis, MO, USA). 2.2. Cloning and sequence analysis of MLIII B-subunit DNA fragment Based on the sequence of full-length toxic mistletoe lectin III gene cloned in previous work [13] the next oligonucleotides were created, which contain the NdeI and BamHI restriction sites (shown in bold) for amplification of the DNA fragment encoding MLIII B-subunit and for cloning it into the expression plasmid pET11cjoe: DirML3B: 5V AAAAAGCTAGCCATATGGACGATGTTACCTGCACTG 3V; Rev-ML3B : 5V AAAAAGGATCCTTATCATGGCACGGGAAGCCACATTT 3V . The scheme of rMLIIIB DNA fragment cloning is presented on Fig. 1. The DNA fragment encoding the MLIII B-subunit was amplified from the pUC19 plasmid carrying the full-length gene of mistletoe preprolectin MLIII (pMLg2) as a template by PCR with the Taq-polymerase. PCR was conducted in 30 Al of standard reaction mix with 1.5 mM MgCl2; 10 pM dirML3B and rev-ML3B primers and 2 ng of pMLg2 plasmid. The amplification was performed on thermocycler bEppendorfQ 5370 (Hamburg, Germany) using the following parameters: the first denaturation at 94 8C–4 min; the cycling conditions of denaturation at 94 8C–30 s, annealing

I.B. Pevzner et al. / Biochimica et Biophysica Acta 1675 (2004) 155–164

157

Fig. 1. Scheme of recombinant MLIII B-subunit (rMLIIIB) cloning. The plasmid pMLg2 carrying the insertion of full-length preprolectin MLIII gene was used as a template for amplification. PCR product was cloned into pET11cjoe expression vector.

at 58 8C–30 s, elongation at 72 8C–1 min for a total of 35 cycles. PCR products were analyzed by 1% agarose phoresis. A fragment of about 800 bp was purified from the PCR mixture by QIAquick spin kit. The PCR product and pET11cjoe vector were restricted by NdeI and BamHI endonucleases and ligated by T4-DNA ligase. The construct obtained was transformed into E. coli strain BL21(DE3). The restriction analysis of plasmids from resulting clones revealed the nucleotide fragment of expected length. The nucleotide sequence of cloned MLIII B-chain DNA fragment was determined by MWG Biotech (Ebersberg, Germany). The deduced amino acid sequence of rMLIIIB was compared with MLI (GenBank accession no.A58957), ricin (CAA26230), abrin-a (AAA32624) and nigrin b (2210286A) B-chains sequences by the ClustalX (v. 1.81) program. We used the methods of Hopp and Woods [20] and of Jameson and Wolf [21] for prediction of antigen epitopes in MLI and MLIII B-chain structure. 2.3. Expression and purification of recombinant MLIII B-subunit The transformed E. coli cells were incubated at 37 8C with shaking in 5 ml of LB (Luria–Bertani) broth with ampicillin (50 Ag/ml). When OD600 was 0.6–1.0, IPTG was

added to the culture medium to final concentration 1 mM. Cells were further grown for 4 h at 28 8C and harvested by sedimentation at 4000g for 10 min. The lysates of clones after the expression were analyzed by 12.5% SDS-PAGE at reducing conditions, and the clones which expressed the recombinant protein with a molecular mass of about 30 kDa were chosen. Inclusion bodies that contained the recombinant protein rMLIIIB were isolated by lysing of E. coli cells with lysozyme, DNAse I, RNAse A and Triton X-100 and subsequent sedimentation, then the obtained pellet of protein was washed twice with STET buffer (8% sucrose, 5% Triton X100, 50 mM EDTA, 50 mM Tris, pH 8.0). The concentration and homogeneity of protein were controlled by SDS-PAGE. 2.4. Western blot analysis The specificity of expressed protein was confirmed by immunoblotting with anti-MLIII serum obtained during the immunization of mice with mistletoe lectin III, with monAB TA7 [22] developed against denatured A-subunits of all three mistletoe lectins and monAb TB33 [23] against denatured MLI B-subunit. The nitrocellulose membranes with transferred proteins were blocked with 4% solution of powder milk in PBS contained 0.05% Tween-20 overnight, then incubated with anti-MLIII serum (dilution 1:1000) or

158

I.B. Pevzner et al. / Biochimica et Biophysica Acta 1675 (2004) 155–164

monAb TA7 in a concentration of 10 Ag/ml for 1 h at 37 8C. Goat-anti-mouse immunoglobulin labeled with peroxidase (dilution 1:10 000) was used as secondary antibody. The developing solution based on PBS contained 10-mg 4chloro-1-naphtol, 3-mg 3,3V-diaminobenzidine, 32% ethanol and 0.06% H2O2.

monAb (1 Ag/ml in BS) labeled with biotin for 1 h at 37 8C; washing three times. Incubation of 100-Al streptavidinperoxidase (IMTEK, Russia) diluted (1:5000) in BS for 1 h at 37 8C; washing three times. The developing solution contained 0.4 mg/ml o-phenylenediamine and 0.06% H2O2, in 50 mmol/L sodium citrate, 25 mmol/L Na2HPO4, pH 5.0;

2.5. Renaturation of recombinant MLIII A- and B-subunits The residue containing the recombinant MLIII B-chain was dissolved in next buffer: 7 M Gnd-HCl, 50 mM Tris– HCl, 2% 2-mercaptoethanol, pH 8.0, incubated for 1 h at room temperature and centrifuged at 12 000g for 15 min. The renaturation of protein was carried out in the following way: the rMLIIIB solution was added by drops to 130-fold volume of PBS pH 7.4 to a final protein concentration of 15 Ag/ml, and incubated 16 h at 4 8C. Similarly, the cofolding of recombinant MLIII A-subunit obtained earlier [24] and B-subunit was conducted with equal amounts of protein (15 Ag/ml of each in final solution). In order to control the renaturation procedure, the native MLIII toxin was denatured in Gnd-HCl buffer and then renatured under the same conditions as recombinant proteins. The protein aggregates were removed by centrifugation and protein solution was analysed by ELISA for antigenic epitopes of MLIII A- and B-subunits and for carbohydrate-binding activity of its B-chain. 2.6. Immunochemistry The concentration of renatured proteins was adjusted by ELISA with polyclonal anti-MLIII serum. Lectins were adsorbed on the plate, and then incubated with anti-MLIII serum and with goat-anti-mouse immunoglobulins labeled with horseradish peroxidase. For studying of immunochemical properties of recombinant proteins by sandwich ELISA, we used the monoclonal antibodies obtained and characterized earlier. The monAb used have the following specificity: H11—against the native MLIII A-subunit [25]; E12—against MLI and MLIII B-subunits [26]; and MTC12—against MLII and MLIII B-subunits [27,28]. The carbohydrate-binding activity of MLIII B-chain was studied in sandwich ELLA with glycosylated immunoglobulins 3F12 and biotinylated monAb MTC12 and H11. The glycosylated immunoglobulins 3F12 used for lectin assay were obtained earlier during the screening for specific carbohydrates for mistletoe toxins MLI, MLII and MLIII. A 96-well plate (bCostarQ, Corning Inc., USA) was first coated with primary monAb (10 Ag/ml in PBS, 100 Al) overnight at 4 8C and washed with 3 200 Al/well of PBS, containing 20 mmol/L lactose and 0.05% Tween-20. Incubation of 200 Al/well of blocking solution (BS)— 0.1% BSA in PBS/lactose/Tween for 1 h at 37 8C; washing three times. Incubation of 100 Al of the native MLIII toxin or the recombinant proteins diluted in BS for 1 h at 37 8C; washing three times. Incubation of 100 Al of the detector

Fig. 2. Recombinant protein rMLIIIA and rMLIIIB expressed in E. coli cells detected by 12.5% SDS-PAGE (A) and Western blot analysis with anti-MLIII serum (B) and monAb TA7 (C). The lanes are: lane 1, MLI; lane 2, MLII; lane 3, MLIII; lane 4, cell lysate rMLIIIB without IPTG induction; lane 5, cell lysate rMLIIIB with IPTG induction; lane 6, supernatant from cell lysate rMLIIIB with IPTG induction; lane 7, purified protein rMLIIIB; lane 8, cell lysate rMLIIIA with IPTG induction. Molecular weight of protein markers (ovalbumin 45.0 kDa, lactate dehydrogenase 35.0 kDa, E. coli restriction endonuclease Bsp98I 25.0 kDa) is shown.

I.B. Pevzner et al. / Biochimica et Biophysica Acta 1675 (2004) 155–164

incubation of 125 Al/well at 37 8C in the dark. Development was stopped by addition of 50 Al/well 50% H2SO4. Absorption was measured at 492 nm with Multiscan spectrophotometer (Labsystems, Finland).

3. Results 3.1. Cloning and expression of mistletoe lectin III B-subunit DNA fragment Based on the sequence of full-length toxic mistletoe lectin III gene cloned in previous work [13], we had created the primers for the amplification of MLIII B-subunit DNA fragment. The obtained 800-bp PCR-fragment was cloned into the expression vector pET11cjoe. The bacterial clones, carrying the plasmids with an insertion of the MLIII Bsubunit DNA fragment, were selected for expression analysis. The expression of recombinant proteins in E. coli cells was detected by 12,5% SDS-PAGE (Fig. 2A). Maximum protein production was achieved 4 h after the

159

induction with IPTG. The clones which expressed the recombinant proteins with a molecular mass of approximately 30 kDa were chosen for further work. The recombinant MLIII B-subunit was produced in the inclusion bodies of E. coli cells and constituted about 3% of the total amount of protein. The inclusion bodies containing the rMLIIIB were separated from other cell components by lysing the cells with detergents and sedimentation followed by washing the pellet with STET buffer. For quantitative determination of the abundance of the recombinant protein, we performed SDS-PAGE with a fixed concentration of native mistletoe toxin MLIII. The specificity of the recombinant products was confirmed by Western blot analysis. As we had no monAb that recognized the denatured MLIII B-chain in immunoblot, two-step immunoanalysis was performed: at the first stage with anti-MLIII serum we confirmed that our recombinant protein rMLIIIB belongs to ML-toxins (Fig. 2B); and at the second stage with monAb TA7 we proved that obtained protein was not the A-chain of any ML-toxin (Fig. 2C). Also we have found that monAb TB33 did not recognize

Fig. 3. Multiple amino acid alignment of type II RIP’s B-subunits: mistletoe lectin I (MLIB, GenBank accession no.A58957), recombinant MLIII (rMLIIIB), ricin (RTB,CAA26230), abrin-a (ABB,AAA32624) and nigrin b (SNAVB,2210286A). Identical residues are shaded; putative glycosylation sites (NxT/S) are double underlined; repetitive QxW sequences are single underlined; conservative residues in carbohydrate-binding sites of proteins are marked with arrows above the row. Different residues in rMLIIIB sequence in comparison with MLIB are in boldface.

160

I.B. Pevzner et al. / Biochimica et Biophysica Acta 1675 (2004) 155–164

rMLIIIB and the B-subunits of native MLII and MLIII in immunoblot (data not shown). 3.2. Sequence analysis of mistletoe lectin III B-subunit The obtained recombinant product rMLIIIB was compared in deduced amino acid sequence with the primary sequences of B-subunits of type II ribosome-inactivating proteins: viscumin (MLIB), ricin (RTB), abrin-a (ABB) and nigrin b (SNAVB) (Fig. 3). rMLIIIB has 86.3% identical conserved amino acid residues and 89.7% similar residues with MLIB, 64.3% and 74.9% with RTB, 53.6% and 66.3% with ABB, and 43.1% and 56.5% with SNAVB, respectively. It should be noted that the recombinant product rMLIIIB has a discrepancy of 36 amino acids compared to MLIB, and the majority of these changes is non-conservative and can thus determine the properties and affinity to GalNAc of MLIII B-subunit. There are crucial differences in charged amino acids between MLIB and rMLIIIB at two positions: Asp28 in MLIB and Lys28 in rMLIIIB; Lys170 in MLIB and Glu170 in rMLIIIB. We could also observe six changes of basic residues in MLIB to polar or aliphatic amino acids in rMLIIIB: Lys115 and Lys242YSer; Arg173, Lys229 and Lys254YAsn; Arg196YGly, but there are three additional positive residues in rMLIIIB: Lys28, Arg63 and Lys169. There are three substitutions of acidic amino acids in MLIB to aliphatic or polar residues in rMLIIIB: Asp27YGly; Asp31YAsn and Asp125YVal, and two additional negative residues in rMLIIIB: Asp18 and Glu170. Following all these differences, the obtained recombinant protein loses five basic and two acidic amino acids and this affects the value of isoelectric point of protein and its general charge at neutral pH. The different amino acid residues in MLIB and rMLIIIB at positions 27 and 38 could determine the structure and properties of N-terminal carbohydrate-binding sites, and at positions 239, 242 and 254 of C-terminal carbohydratebinding sites of proteins. The residues Gln34 and Ile114 are involved in the interaction between the B-subunits of two MLI molecules during heterotetramer formation, and their variants in rMLIIIB may turn MLIII to be unable to make such a tetramer. The change of Lys242 in MLIB to Ser in rMLIIIB in the C-terminal domain makes Asn240 of rMLIIIB to be a possible glycosylation site (as an N-x-T/S sequence). On the other hand, rMLIIIB has no glycosylation site at position Asn61 like MLIB has because of the change of Ser63 in MLIB to Arg in rMLIIIB. The total number of putative glycosylation sites in rMLIIIB is three, the same number as in MLIB. In the sequence of rMLIIIB protein we found 10 cysteine residues while MLIB has nine. There is one additional Cys at position 40 in rMLIIIB which enables this protein to form one more disulfide bond with Cys21. Other RIP B-chains,

apart from MLIB that has Ser40, form a disulfide bond here in the N-terminal domain. Also we compared the deduced primary structure of our recombinant protein rMLIIIB and the sequence of MLIII Bsubunit determined by Edman degradation of native MLIIIB by Wacker et al. (published in the Protein Data Bank in 2003; accession no.P87800). The differences between these sequences are only in three amino acids: Asn173 in rMLIIIB—Asp; Ala201—Thr; Ser255—Pro. 3.3. Prediction of antigenic epitopes of MLI and MLIII B-subunits For prediction of antigen epitopes in MLI and MLIII Bchain structure, we used the methods of Hopp and Woods [20] and of Jameson and Wolf [21]. There are a few areas with most pronounced antigenic properties both in MLI and MLIII B-chains (Fig. 4). The comparison of MLIB and MLIIIB antigenicity revealed that MLI B-chain has one domain with more pronounced antigenic peculiarities, which is absent in MLIII B-chain. This MLIB domain named 25RDDDFRDGNQ34 contains five out of ten amino acids that varied from residues in rMLIIIB: Asp27 in MLIB—Gly, Asp28—Lys, Arg30—His, Asp31—Asn and

Fig. 4. Prediction of antigen epitopes in the structure of MLI and MLIII Bchains. Solid line—method of Hopp and Woods [20]; discontinuous line— method of Jameson and Wolf [21].

I.B. Pevzner et al. / Biochimica et Biophysica Acta 1675 (2004) 155–164

161

after centrifuging (data not shown). In this ELISA with polyclonal anti-MLIII serum, the concentration of recombinant proteins was adjusted for the following sandwich ELISA and ELLA with monoclonal antibodies. Two systems of sandwich ELISA were performed for studying the immunochemical properties of rMLIIIB folded alone and associated with rMLIIIA, and two systems of sandwich ELLA for the carbohydrate-binding activity of renatured proteins. The antigenic epitopes of proteins were studied in E12–MTC12-biotin (anti-MLIIIB–anti-MLIIIB monAb) and E12–H11-biotin (anti-MLIIIB–anti-MLIIIA monAb) systems. It was found that antigenic epitopes of rMLIIIB and of heterodimer rMLIIIA+rMLIIIB were folded successfully, representing about 24% in E12–MTC12-biotin sandwich (Fig. 5A) and 27% in E12–H11-biotin sandwich (Fig. 5B) of folded denatured MLIII activity taken as 100%. For studies of the carbohydrate-binding activity of renatured proteins, the glycosylated immunoglobulins 3F12 were adsorbed on an immunological plate, and monAb

Fig. 5. Study of immunochemical activity of renatured proteins in sandwich ELISA. Denatured MLIII (dMLIII ren.), recombinant MLIII B-subunit (rMLIIIB) and recombinant heterodimer rMLIIIA+rMLIIIB interacted with anti-MLIIIA (H11) and anti-MLIIIB (E12, MTC12) monoclonal antibodies in E12–MTC12-biotin (A) and E12–H11-biotin (B) systems. The concentration of tested proteins is 1 Ag/ml. The activity of denatured/renatured MLIII (dMLIII ren.) is taken as control.

Gln34—Pro. These changes include the absence of three acidic and one basic residues in MLIIIB being compared to MLIB. This area is a loop involved in the N-terminal sugarbinding site of viscumin, exposed on the molecular surface of the protein [29]. 3.4. Immunochemical and sugar-binding activity of recombinant proteins The purified recombinant rMLIIIB protein was dissolved in the denaturing buffer containing Gnd-HCl. Folding of rMLIIIB alone and cofolding of it with rMLIIIA obtained earlier [24] were conducted by a gradual 130-fold dilution in PBS of denatured subunits to a final concentration of 15 Ag/ ml. As a control of the folding procedure the native MLIII toxin was denatured in Gnd-HCl buffer and then renatured using the same condition as for recombinant proteins. The polyclonal anti-MLIII serum was used for the primary immunochemical detection of the renatured rMLIIIB, rMLIIIA+rMLIIIB and MLIII amounts expected in solution

Fig. 6. Study of sugar-binding activity of renatured proteins in sandwich ELLA. Denatured MLIII (dMLIII ren.), recombinant MLIII B-subunit (rMLIIIB) and recombinant heterodimer rMLIIIA+rMLIIIB interacted with glycosylated immunoglobulins 3F12, anti-MLIIIA (H11) and anti-MLIIIB (MTC12) monoclonal antibodies in 3F12–MTC12-biotin (A) and 3F12– H11-biotin (B) systems. The concentration of tested proteins is 1 Ag/ml. The activity of denatured/renatured MLIII (dMLIII ren.) is taken as control.

162

I.B. Pevzner et al. / Biochimica et Biophysica Acta 1675 (2004) 155–164

MTC12 (anti-MLIIIB) and H11 (anti-MLIIIA) were used for the detection of lectins. The sandwich 3F12-MTC12biotin was used for study of recombinant MLIII B-subunit folded alone, and sandwich 3F12-H11-biotin for study of recombinant heterodimer rMLIIIA+rMLIIIB. The activity of rMLIIIB in 3F12-MTC12-biotin system represented 54% of control—folded denatured MLIII (Fig. 6A), and the activity of heterodimer rMLIIIA+rMLIIIB in 3F12-H11biotin system was 95% of control (Fig. 6B).

4. Discussion 4.1. Sequence analysis of mistletoe lectin B-subunit gene In the present work we amplified the gene fragment of the B-subunit of mistletoe toxic lectin from the earlier cloned full-length preprolectin gene [13]. Analysis of the deduced amino acid sequence of the recombinant protein rMLIIIB has revealed that it differs from the native MLI Bchain in its primary structure. Since MLI and MLIII have high sequence homology but different carbohydrate specificity, the comparison of the amino acids in sugar-binding sites of these proteins would provide a good example of how a slight change in the primary structure influences differences in carbohydrate affinity. A major difference in sugar specificity between MLIB and MLIIIB is that MLIB is Gal-specific, but MLIIIB has higher affinity for GalNAc [10,15–17]. The structure of MLI [29] showed that the N-acetyl group of GalNAc would cause steric hindrance with Asp27 and Lys41 in the N-terminal sugar-binding site of MLIB and with Asn45 that corresponds to Asn44 in RTB. Asp27 has variance of Gly in rMLIIIB and RTB; however, the lysine and asparagine are also conserved in these proteins, and therefore GalNAc binding to the Nterminal site of MLIIIB as well as of RTB would be sterically hindered. In the C-terminal site of MLIB the side chain of Lys254 would cause steric hindrance with the N-acetyl group, but rMLIIIB has Asn at this position. This is the same as in SNAVB, a GalNAc favored type-II RIP B-chain [30], and in terms of the side chain length it is the same as Asp in RTB of which C-terminal binding site is known to bind GalNAc [31]. Therefore, it is considered that the change of Lys254 in MLB to Asn in rMLIIIB will allow MLIIIB to accommodate GalNAc sterically. In addition, rMLIIIB has Ser239 that corresponds to Ser238 in RTB. It is speculated that this serine has a crucial role in GalNAc binding, because its side chain could form a hydrogen bond with the N-acetyl group, while MLIB that has Ala239 here cannot form a hydrogen bond with GalNAc. This is supported by the fact that SNAVB also has a serine at this position. The B-chain of abrin-a has a lysine and serine at corresponding positions, respectively, and it has more affinity for Gal than for GalNAc [32].

Another crucial discrepancy between MLIB and rMLIIIB is the change of Trp38 in MLI B-chain to Ser in rMLIIIB. This is in the N-terminal sugar-binding site and the tryptophan here is the residue that stacks to the hydrophobic plane of the binding galactose, and an aromatic-ring residue is conserved at this position for sugar-binding RIP B-chains. It is considered that the absence of Trp38 will result in a significant loss of sugar binding ability. Because MLIII is a monomer, the loss of binding ability in one of two sites will abolish the agglutination activity. Franz et al. [10] reported that the concentrations of MLII and MLIII necessary for hemagglutination are higher than that of MLI, and they agglutinate more slowly. The replacements of Lys242 and Ser63 in MLIB with Ser and Arg in rMLIIIB, respectively, add one possible glycosylation site in the C-terminal domain of the protein and remove one in the N-terminal domain. The glycosylation site at position Asn240 in MLIII is close to the sugarbinding site. However, nigrin b also has a possible glycosylation site here without losing lectin activity [30], and therefore, it is considered that glycosylation site will not hinder sugar-binding activity. The total number of putative glycosylation sites in MLI and MLIIIB is three. Zimmermann and Pfueller [33] showed that the B-subunits of native MLI and MLIII toxins both have only two glycan parts. rMLIIIB has two negatively charged and five positively charged less amino acid residues than MLIB, so it has a lower isoelectric point (5.43) than native MLIB (7.63), and such discrepancies affect the general charge of these proteins at neutral pH: 0.69 for MLIB and 2.23 for rMLIIIB. The nature of the heterogeneity of mistletoe lectins is a subject of discussion. It had been suggested that MLII and MLIII are isoforms of MLI and arise from it during posttranslational modifications [8]. On the other hand, some type II RIPs are encoded by several genes. Thus, ricin and ricinus agglutinin are encoded by a small multigene family composed of eight members, some of which are nonfunctional. Both proteins are products of distinct genes despite the high homology between their A- and B-subunits—93% and 81%, respectively [34]. The greatest distinction takes place between B-chains of ML-toxins because of differences in their affinity to Gal and to GalNAc. This fact denotes the dissimilarity in B-subunits binding site architecture and their amino acid compositions. Furthermore, we found that monAb TB33 against MLIB does not recognize the B-subunits of MLII and MLIII toxins. The antigenicity analysis of MLI and MLIII B-chain revealed one epitope 25RDDDFRDGNQ34 in MLIB that is absent in the MLIIIB sequence. This epitope could be crucial for the interaction of TB33 with MLIB only. The catalytic subunits of ML-toxins do not seem to be identical because monAb H11 against I`LIII A-chain did not react with I`LI [13], and vice versa, monAb TA5 directed to MLIA did not recognize MLIII [23]. Earlier, Soler et al. [35] showed the presence of at

I.B. Pevzner et al. / Biochimica et Biophysica Acta 1675 (2004) 155–164

least two distinct genes encoding the ML-toxins Achains. Park et al. [36] have simultaneously cloned three distinct genes of toxic lectins from Korean mistletoe V. album subsp. coloratum. All these observations mentioned above indicate the significant differences in the primary structures of A- and B-subunits of mistletoe lectins, which is a consequence of several distinct genes encoding ML-toxins. 4.2. Immunochemical and carbohydrate-binding activity of recombinant MLIII B-subunit From results of Western blot analysis (Fig. 2), we conclude that the recombinant protein we have prepared is a B-chain of some ML-toxin. Based on the specificity of our monAb E12 [26] and MTC12 [27,28], we have proved that this protein is MLIII B-subunit. In accordance with the results of the immunochemical properties analysis, we could say that about 25% of the renatured rMLIIIB and heterodimer rMLIIIA+rMLIIIB interacted in sandwich ELISA with specific monoclonal antibodies. In the case of lectin activity analysis the recombinant proteins—both rMLIIIB alone and associated with rMLIIIA—showed a higher degree of proper folding. We could affirm that recombinant protein rMLIIIB and heterodimer rMLIIIA+rMLIIIB are successfully renatured and all antigen epitopes are folded in a proper way, because the anti-MLIIIB monoclonal antibodies E12 and MTC12 do not recognize the denatured MLIII toxin in Western blot or ELISA (data not shown). One possible reason for the differences in immunochemical and lectin activity of renatured proteins is that monAb E12 used in assays probably has the conformational structural epitope as it recognizes only folded MLI and MLIII B-subunits. Also the simultaneous renaturation of the recombinant MLIII Aand B-subunits could give the incorrect heterodimer where the wrong folded A-chain impedes the rMLIIIB interaction with monAb MTC12. The mechanisms responsible for pharmacological effects of mistletoe lectins are not yet completely understood. It was supposed that the anti-tumor activity of ML toxins is due to their immunomodulating ability rather than to cytotoxicity [37]. Some investigators suppose that viscumin is the active component of the extracts from the point of view of immunomodulating ability. However, the contribution of toxic lectins MLII and MLIII and other compounds such as viscotoxins should not be ignored. The distinction in cytotoxicity found between ML-toxins [12,18] may be due to the differences in their carbohydrate specificity as well as to particularities in intracellular transport of enzymatic subunits. Earlier we showed that the potential presence of isolated mistletoe toxin’s chains might change the properties of preparation [38]. In the light of preceding observations, further investigations of recombinant MLIII B-subunit as an agent for anticancer and immunomodulating therapy are necessary.

163

Acknowledgements This work was supported partly by Ministry of Education and Research, WTZ RUS-237.

References [1] T. Hajto, K. Hostanska, H.-J. Gabius, Modulatory potency of the hgalactoside-specific lectin from mistletoe extract (iscador) on the host defence system in vivo in rabbits and patients, Cancer Res. 49 (1989) 4803 – 4808. [2] G. Ribereau-Gayon, S. Dumont, C. Muller, M.L. Jung, P. Poindron, R. Anton, Mistletoe lectins I, II and III induce the production of cytokines by cultured human monocytes, Cancer Lett. 109 (1996) 33 – 38. [3] U. Elsasser-Beile, M. Voss, R. Schuhle, U. Wetterauer, Biological effects of natural and recombinant mistletoe lectin and an aqueous mistletoe extract on human monocytes and lymphocytes in vitro, J. Clin. Lab. Anal. 14 (6) (2000) 255 – 259. [4] S. Kovacs, Serum levels of IL-12 and the production of IFN-gamma, IL-2 and IL-4 by peripheral blood mononuclear cells (PBMC) in cancer patients treated with Viscum album extract, Biomed. Pharmacother. 54 (6) (2000) 305 – 310. [5] S. Karkabounas, D. Assimakopoulos, M. Malamas, A.L. Skaltsounis, S. Leonce, J. Zelovitis, D. Stefanou, A. Evangelou, Antiproliferative and anticarcinogenic effects of an aqueous preparation of Abies alba and Viscum album se abies, on a L-1210 malignant cell line and tumor-bearing Wistar rats, Anticancer Res. 20 (2000) 4391 – 4395. [6] A.M. Burger, U. Mengs, J.B. Schuler, H.H. Fiebig, Anticancer activity of an aqueous mistletoe extract (AME) in syngeneic murine tumor models, Anticancer Res. 21 (2001) 1965 – 1968. [7] R. Eifler, K. Pfueller, W. Goeckeritz, U. Pfueller, Improved procedures for isolation of mistletoe lectins and their subunits: lectin pattern of the European mistletoe, in: J. Basu, M. Kundu, P. Chakrabarti (Eds.), Lectins: Biology, Biochemistry, Clinical Biochemistry, vol. 9, Wiley Eastern, India, 1993, pp. 144 – 151. [8] L. Barbieri, M.G. Battelli, F. Stirpe, Ribosome-inactivating proteins from plants, Biochim. Biophys. Acta 1154 (1993) 237 – 282. [9] Y. Endo, K. Tsurugi, H. Franz, The site of action of the A-chain of mistletoe lectin I on eukaryotic ribosomes. The RNA N-glycosidase activity of the protein, FEBS Lett. 2 (1988) 378 – 380. [10] H. Franz, P. Ziska, A. Kindt, Isolation and properties of three lectins from mistletoe (Viscum album L.), Biochem. J. 195 (1981) 481 – 484. [11] F. Stirpe, L. Barbieri, M.G. Batelli, M. Soria, D.A. Lappi, Ribosomeinactivating proteins from plants: present status and future prospects, Biotechnology 10 (1992) 124 – 405. [12] J.B. Dietrich, G. Ribereau-Gayon, M.L. Jung, H. Franz, J.P. Beck, R. Anton, Identity of the N-terminal sequences of the three A chains of mistletoe (Viscum album L.) lectins: homology with ricin-like plant toxins and single-chain ribosome-inhibiting proteins, Anti-Cancer Drugs 3 (1992) 507 – 511. [13] A.G. Tonevitsky, I.I. Agapov, I.B. Pevzner, N.V. Maluchenko, M.M. Mojsenovich, R. Palmer, M. Yurkova, U. Pfueller, Cloning and expressing of catalytic subunit of MLIII, ribosome-inactivating protein from Viscum album, Biochemistry 69 (6) (2004) 791 – 800 (in Russian), in press. [14] R.T. Lee, H.J. Gabius, Y.C. Lee, Ligand binding characteristics of the major mistletoe lectin, J. Biol. Chem. 267 (1992) 23722 – 23727. [15] P. Ziska, M. Gelbin, H. Franz, Interaction of mistletoe lectins MLI, ML-II and ML-III with carbohydrates, in: E. Van Driessche, H. Franz, S. Beeckmans (Eds.), Lectins: Biology, Biochemistry, Clinical Biochemistry, vol. 8, Textop, Hellerup, Denmark, 1993, pp. 10 – 13.

164

I.B. Pevzner et al. / Biochimica et Biophysica Acta 1675 (2004) 155–164

[16] A.M. Wu, L.-K. Chin, H. Franz, U. Pfueller, A. Herp, Carbohydrate specificity of the receptor sites of mistletoe toxic lectin I, Biochim. Biophys. Acta 1117 (1992) 232 – 234. [17] A. Buessing, K. Suzart, J. Bergmann, U. Pfuller, M. Schietzel, K. Schweizer, Induction of apoptosis in human lymphocytes treated with Viscum album L. is mediated by the mistletoe lectins, Cancer Lett. 99 (1996) 59 – 72. [18] J. Kopp, I.-J. Korner, U. Pfuller, W. Gockeritz, R. Eifler, K. Pfuller, H. Franz, Toxicity of mistletoe lectins I, II and III on normal and malignant cells, in: E. Van Driessche, H. Franz, S. Beeckmans (Eds.), Lectins: Biology, Biochemistry, Clinical Biochemistry, vol. 8, Textop, Hellerup, Denmark, 1993, pp. 41 – 47. [19] J. Eck, M. Langer, B. Moeckel, K. Witthohn, H. Zinke, H. Lentzen, Characterization of recombinant and plant-derived mistletoe lectin and their B-chains, Eur. J. Biochem. 265 (1999) 788 – 797. [20] T.P. Hopp, K.R. Woods, Prediction of protein antigenic determinants from amino acid sequences, Proc. Natl. Acad. Sci. U. S. A. 78 (6) (1981) 3824 – 3828. [21] B.A. Jameson, H. Wolf, The antigenic index: a novel algorithm for predicting antigenic determinants, Comput. Appl. Biosci. 4 (1988) 181. [22] I.I. Agapov, A.G. Tonevitsky, N.V. Maluchenko, M.M. Maluchenko, Y.A. Bulah, M.P. Kirpichnikov, Mistletoe lectin A-chain unfolds during the intracellular transport, FEBS Lett. 464 (1999) 63 – 66. [23] A.G. Tonevitsky, V.A. Rakhmanova, I.I. Agapov, A.T. Shamshiev, E.A. Usacheva, S.A. Prokof’ev, O.N. Denisenko, Yu.O. Alekseev, U. Pfueller, The interactions of anti-MLI monoclonal antibodies with isoforms of the lectin from Viscum album, Immunol. Lett. 44 (1995) 31 – 34. [24] A.G. Tonevitsky, I.I. Agapov, I.B. Pevzner, N.V. Maluchenko, M.M. Mojsenovich, U. Pfueller, M.P. Kirpichnikov, A new gene encoding the ribosome-inactivating protein from mistletoe extracts, Arzneim.Forsch./Drug Res. 54 (2004) 242 – 249. [25] G.V. Fattakhova, I.I. Agapov, O.N. Solopova, M.M. Moisenovich, A.G. Tonevitsky, The obtaining of monoclonal antibodies to the isoforms of a plant toxin viscumin, Biotechnology 3 (2001) 59 – 70 (in Russian). [26] M.M. Moisenovich, S.G. Egorova, O.V. Chelnokova, I.A. Demina, E.R. Polosukhina, N.V. Kozlovskaya, E.N. Popova, G.V. Fattakhova, O.N. Solopova, I.I. Agapov, Importance of protocol immunization in epitope selectivity of monoclonal antibodies interacting with binding subunit of viscumin, Russ. J. Immunol. 5 (4) (2000) 376 – 384. [27] A.G. Tonevitsky, I. Agapov, D. Temiakov, M.M. Moysenovich, N.V. Maluchenko, O.N. Solopova, G. Wuerzner, U. Pfueller, Study of

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

heterogeneity of lectins in mistletoe preparations by monoclonal antibodies to their A-subunits, Arzneim.-Forsch./Drug Res. 49 (11) (1999) 970 – 975. I.B. Pevzner, I.I. Agapov, H. Niwa, K. Pfueller, U. Pfueller, N.V. Maluchenko, M.M. Moisenovich, A.G. Tonevitsky, M.P. Kirpichnikov, Cloning and expression of mistletoe lectin III B-subunit, Biochemistry 69 (2004) 1657 – 1665 (in Russian). H. Niwa, A.G. Tonevitsky, I.I. Agapov, S. Saward, U. Pfueller, R.A. Palmer, Crystal structure at 3 2 of mistletoe lectin I, a dimeric type-II ribosome-inactivating protein, complexed with galactose, Eur. J. Biochem. 270 (2003) 2739 – 2749. E.J. Van Damme, A. Barre, P. Rouge, F. Van Leuven, W.J. Peumans, Characterization and molecular cloning of Sambucus nigra agglutinin V (nigrin b), a GalNAc-specific type-2 ribosome-inactivating protein from the bark of elderberry (Sambucus nigra), Eur. J. Biochem. 237 (1996) 505 – 513. T. Hatakeyama, N. Yamasaki, G. Funatsu, Identification of the tryptophan residue located at low-affinity saccharide binding site of ricin D, J. Biochem. 100 (1986) 781 – 788. A.M. Wu, J.H. Wu, A. Herp, L.-P. Chow, J.-Y. Lin, Carbohydrate specificity of a toxic lectin, abrin A, from the seeds of Abrus precatorius (jequirity bean), Life Sci. 69 (17) (2001) 2027 – 2038. R. Zimmermann, U. Pfueller, Glycosylation pattern of mistletoe lectins, in: S. Bardocz, U. Pfueller, A. Pustzai (Eds.), COST 98 bEffect of antinutrients on the nutritional value of legume dietsQ, vol. 5, European communities, Brussels, 1998, pp. 55 – 62. L.R. Roberts, J.W. Tregear, J.M. Lord, Cytotoxic proteins of plants, in: A.E. Frankel (Ed.), Immunotoxins, Kluwer Academic Publishers, Boston-Dordrecht, 1988, pp. 81 – 98. M.H. Soler, S. Stoeva, C. Schwamborn, S. Wilhelm, T. Stiefel, W. Voelter, Complete amino acid sequence of the A chain of mistletoe lectin I, FEBS Lett. 399 (1996) 153 – 157. C.-H. Park, D.-W. Lee, T.-B. Kang, T.-J. Yoon, J.-B. Kim, M.-S. Do, K. Song, cDNA cloning and sequence analysis of the lectin genes of the Korean mistletoe (Viscum album coloratum), Mol. Cells 12 (2001) 215 – 220. U. Pfueller, Toxic and immunostimulating effects of mistletoe and related toxic lectins, in: S. Bardocz, E. Gelencser, A. Pusztai (Eds.), Proceedings of the second scientific workshop of COST 98, Budapest, vol. 1, Office for Official Publications of the European Communities, Luxemburg, 1996, p. 46. A.G. Tonevitsky, U. Marx, I. Agapov, M. Moisenovich, Detection of isolated mistletoe lectin chains in plant extracts, Arzneim.-Forsch./ Drug Res. 52 (I) (2002) 67 – 71.