Differences in egg deposition of corticosterone and embryonic expression of corticosterone metabolic enzymes between slow and fast growing broiler chickens

Comparative Biochemistry and Physiology, Part A 164 (2013) 200–206

Contents lists available at SciVerse ScienceDirect

Comparative Biochemistry and Physiology, Part A journal homepage: www.elsevier.com/locate/cbpa

Differences in egg deposition of corticosterone and embryonic expression of corticosterone metabolic enzymes between slow and fast growing broiler chickens Abdelkareem A. Ahmed a, Wenqiang Ma a, Feng Guo a, Yingdong Ni a, Roland Grossmann b, Ruqian Zhao a,⁎ a b

Key Laboratory of Animal Physiology and Biochemistry, Ministry of Agriculture, Nanjing Agricultural University, Nanjing, 210095, China Department of Functional Genomics and Bioregulation, Institute of Animal Genetics, FLI, Mariensee, 31535 Neustadt, Germany

a r t i c l e

i n f o

Article history: Received 27 June 2012 Received in revised form 9 September 2012 Accepted 10 September 2012 Available online 14 September 2012 Keywords: Corticosterone Egg Fast and slow growing broiler chicken 11β-HSD1 11β-HSD2 20-HSD

a b s t r a c t Glucocorticoids (GCs) are vital for embryonic development and their bioactivity is regulated by the intracellular metabolism involving 11β-hydroxysteroid dehydrogenases (11β-HSDs) and 20-hydroxysteroid dehydrogenase (20-HSD). Here we sought to reveal the differences in egg deposition of corticosterone and embryonic expression of corticosterone metabolic enzymes between slow and fast growing broiler chickens (Gallus gallus). Eggs of fast-growing breed contained significantly higher (P b 0.05) corticosterone in the yolk and albumen, compared with that of a slow-growing breed. 11β-HSD1 and 11β-HSD2 were expressed in relatively higher abundance in the liver, kidney and intestine, following similar tissue-specific ontogenic patterns. In the liver, expression of both 11β-HSD1 and 11β-HSD2 was upregulated (P b 0.05) towards hatching, yet 20-HSD displayed distinct pattern showing a significant decrease (P b 0.05) on posthatch day 1 (D1). Hepatic mRNA expression of 11β-HSD1 and 11β-HSD2 was significantly higher in fast-growing chicken embryos at all the embryonic stages investigated and so was the hepatic protein content on embryonic day of 14 (E14) for 11β-HSD1 and on E14 and D1 for 11β-HSD2. 20-HSD mRNA was higher in fast-growing chicken embryos only on E14. Our data provide the first evidence that egg deposition of corticosterone, as well as the hepatic expression of glucocorticoid metabolic enzymes, differs between fast-growing and slow-growing chickens, which may account, to some extent, for the breed disparities in embryonic development. © 2012 Elsevier Inc. All rights reserved.

1. Introduction Glucocorticoids (GCs) are known to play critical roles in embryonic development and maternal programming in mammals (Gmelin et al., 1985) and birds (Spencer et al., 2009). Embryonic exposure to maternal GCs is known to have both short- and long-term consequences (Seckl, 2004; Love and Williams, 2008a), such as decreased birth or hatch weight, retarded growth rate, compromised immunity and even reduced survival (Rubolini et al., 2005; Saino et al., 2005; Love and Williams, 2008b). Chicken eggs contain a variety of hormones, which cause maternal influences on offspring phenotype (Groothuis et al., 2005; Gil, 2008). Up to now, androgens (Schwabl, 1993; Eising et al., 2003), gestagen (Möstl et al., 2001), thyroid hormones (Wilson and McNabb, 1997; Tona et al., 2003), insulin (De Pablo et al., 1982) and leptin-like immunoreactive substance (Hu et al., 2008) are reported to be present in the egg. Maternal corticosterone has also been found in chicken eggs (Groothuis and von Engelhardt, 2005; Rettenbacher et al., 2005). Significant breed difference (>2 folds) in yolk corticosterone concentration was found between White Leghorn and Hy-Line Brown eggs (Navara and Pinson, 2010). It was reported that meat-type chicks demonstrate ⁎ Corresponding author. Tel.: +86 2584395047; fax: +86 2584398669. E-mail address: [email protected] (R. Zhao). 1095-6433/$ – see front matter © 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.cbpa.2012.09.004

blunted HPA response to novel environment compared with layer-type chicks (Saito et al., 2005) and the striking growth difference between broiler and layer chickens is associated with hypothalamic expression of genes related to HPA axis (Yuan et al., 2009). However, it is unknown whether egg deposition of corticosterone differs between slow- and fast-growing chickens. The intracellular level of active GC is regulated by a number of GC metabolizing enzymes (Edwards et al., 1996). 11β-Hydroxysteroid dehydrogenase type 1 (11β-HSD1) activates, whereas 11β-HSD2 inactivates GCs (Diederich et al., 1998; Stewart and Krozowski, 1999; Harris et al., 2001; Holmes et al., 2003; Holmes and Seckl, 2006). In mammals, 11β-HSD1 is expressed predominantly in the liver, kidney and lung (Rajan et al., 1995), while 11β-HSD2 mainly exists in the kidney, colon and placenta (Albiston et al., 1994). In birds, 20α-hydroxystreroid dehydrogenase (20-HSD) is an abundantly and ubiquitously expressed enzyme, which transforms GCs to inactive 20-dihydrocorticosterone (Kucka et al., 2006). The tissue distribution and ontogenic pattern of 11β-HSDs have been well established in mammals (Tannin et al., 1991; Walker et al., 1992; Yang et al., 1992; Thompson et al., 2004), while relevant information in avian species is scarce. Partial or complete cDNA sequences encoding chicken 11β-HSD1 (Klusonova et al., 2008a), 11β-HSD2 (Klusonova et al., 2008b) and 20-HSD (Bryndova et al., 2006) have been cloned and the patterns of tissue-specific expression of these three genes are described for 5–7-week-old Brown Leghorn

A.A. Ahmed et al. / Comparative Biochemistry and Physiology, Part A 164 (2013) 200–206

201

chickens. The ontogeny and tissue distribution of 11β-HSD1, 11βHSD2 and 20-HSD expression during chicken embryonic development have not been reported. Moreover, it remains unknown whether differences in egg corticosterone deposition are associated with different ontogenic expression patterns of corticosterone metabolic enzymes in the chicken. Therefore, the objectives of this study were (1) to determine the yolk and albumen corticosterone contents in the eggs laid by slow and fast growing broiler chickens; (2) to elaborate the ontogenic and tissue distribution pattern of 11β-HSD1/2 and 20-HSD in developing embryos of fast growing chickens; and (3) to compare the embryonic expression of 11β-HSD1/2 and 20-HSD in the liver of slow and fast growing broiler chickens.

according to our previous publication (Li et al., 2011). Mock RT and No Template Controls (NTC) were included to monitor the possible contamination of genomic and environmental DNA at both RT and PCR steps. The pooled sample made by mixing equal quantity of RT products (cDNA) from all samples was used for optimizing the PCR condition and tailoring the standard curves for each target gene, and melting curves were performed to ensure a single specific PCR product for each gene. The PCR products were sequenced to validate the identity of the amplicons. Primers specific for 11β-HSD1, 11β-HSD2 and 20-HSD (Table 2) were synthesized by Invitrogen (Shanghai, China). Chicken 18S was used as a reference gene for normalization purposes. The 2−ΔΔCt method (Livak and Schmittgen, 2001) was used to analyze the real-time RT-PCR data.

2. Materials and methods

2.4. Protein extraction and Western blot analysis

2.1. Breeder eggs, incubation and tissue sampling

Protein extracts from 50 mg frozen liver tissue were prepared as previously described (Yuan et al., 2009). The protein concentration was determined with Pierce BCA Protein Assay Kit (Thermo Scientific, USA). Western blot analysis for 11β-HSD1 (10004303, Cayman Chemical Company, USA, diluted 1:200) and 11β-HSD2 (sc-20176, Santa Cruz Biotechnology, CA, USA, diluted 1:200) were carried out according to the recommended protocols provided by the manufacturers. GAPDH (AP0066, Bioworlde, MN, USA, diluted 1:10,000) was used as a reference in the Western blot analysis.

Fertile eggs laid by the slow-growing WENs Yellow Feathered Chicken and the fast-growing White Recessive Rock Chicken (Gallus gallus) were obtained from Southern Poultry Breeding Company of WENS Co. Ltd., Guangdong, China. For egg phenotype measurement and corticosterone analysis, egg shell, albumen and yolk were separated manually and the yolk and albumen samples were frozen at − 20 °C until extraction. The remaining eggs were incubated at 37.5 ± 0.5 °C and 60% relative humidity following standard settings for automatic turning and ventilation. The eggs of two breeds were placed side by side and distributed equally on different shelves in the incubator to minimize possible variations in the incubation condition. The first day of incubation was defined as embryonic day 1 (E1) and the day of hatching was defined as posthatch day 1 (D1). On E10, E14, E18 and D1, the egg weight and embryo weight were recorded, and liver, kidney, intestine, hypothalamus and muscle samples were collected. All the tissue samples were snap frozen in liquid nitrogen and stored at −80 °C prior to RNA and protein extraction. The experimental protocol was approved by the Animal Ethics Committee of Nanjing Agricultural University.

2.5. Statistical analysis Embryo weights, as well as mRNA and protein expression of glucocorticoid metabolizing enzymes were analyzed by two-way ANOVA using SPSS 16.0 for Windows followed by a least-significant difference (LSD) test for individual comparisons. Values of mRNA abundance and protein content are expressed as the fold change relative to the average value of one group. Phenotypic parameters of eggs, as well as yolk and albumen corticosterone concentrations were analyzed using T test for independent-samples. The data were expressed as mean± SEM. A P-value b 0.05 was considered significant.

2.2. Yolk and albumen extraction and corticosterone assay

3. Results

Yolk and albumen samples were extracted before assay following the procedure described previously (Okuliarova et al., 2010). The corticosterone concentrations were determined with a commercial enzyme immunoassay kit (Cayman Chemical Company, Ann Arbor, MI, USA). The detection limit of the kit was 30 pg/mL and all the determinations fell within the detection range of 8.2–5000 pg/mL. The intra-assay coefficient of variation calculated was 5%. The cross-reactivity of the antibody was 11% with 11-dehydrocorticosterone, 7% with 11-deoxycorticosterone, 0.31% with progesterone, 0.17% with cortisol, 0.06% with aldosterone, 0.03% with testosterone, 0.02% with pregnenolone, 0.01% with 5α-DHT and less than 0.01% with other steroids.

3.1. Phenotypic parameters of eggs and embryo growth

2.3. RNA extraction and mRNA quantification Total RNA was extracted from the tissue samples with single-step method of RNA extraction by acid guanidinium thiocyanate–phenol– chloroform (Chomczynski and Sacchi, 1987). Two approaches were taken to ensure that all the total RNA preparations are free of genomic DNA contamination. Firstly, total RNAs were treated with 10 U DNase I (RNase Free, D2215, Takara, Japan) for 30 min at 37 °C, and purified according to the manufacturer's protocol. Secondly, the primers for the reference gene (18S rRNA) were designed to span an intron, so any genomic DNA contamination can be determined easily with an extra product in the melting curves for real-time qRT-PCR. For establishing the patterns of ontogeny and tissue distribution and breed comparative study, real-time qRT-PCR was performed in Mx3000P (Stratagene, USA)

Eggs from fast growing broiler breeders had significantly higher egg weight (Pb 0.01), as well as shell, albumen and yolk weight (Pb 0.01). Embryos from fast growing breed were also significantly heavier (Pb 0.01) at all embryonic stages investigated, compared to the slow growing breed (Table 1). The growth rate of fast-growing chickens was 3.3 g/day from E14 to E18 and 3.7 g/day from E18 to D1. In average, the growth rate was 3.5 g/day from E14 to D1. For the slow-growing chickens, the average growth rates were 2.6 g/day from E14 to E18 and 3.0 g/day from E18 to D1. On average, the growth rate was 2.8 g/day Table 1 Phenotypic parameters of eggs and embryo growth. Parameters

Egg mass (g) Shell mass (g) Albumen mass (g) Yolk mass (g) Embryo mass at E14 (g) Embryo mass at E18 (g) Embryo mass at D1 (g)

Fast-growing chickens

Slow-growing chickens

(n = 26)

(n = 26)b a

55.2 ± 3.0 7.70 ± 0.7a 25.2 ± 3.0a 22.3 ± 3.1a 12.3 ± 0.1a 25.4 ± 0.2a 36.5 ± 0.4a

47.4 ± 4.1b 6.42 ± 0.8b 21.9 ± 3.0b 18.7 ± 2.4b 10.7 ± 0.1b 21.0 ± 0.2b 30.0 ± 0.3b

P value

b0.001 b0.001 b0.001 b0.001 b0.001 b0.001 b0.001

Data were expressed as means ± S.E.M. of 25–30 eggs or embryos. Different letters in the rows indicate significantly different mean values at P b 0.05.

202

A.A. Ahmed et al. / Comparative Biochemistry and Physiology, Part A 164 (2013) 200–206

and intestine expressed significantly more abundant 20-HSD mRNA compared to the liver on D1 (P b 0.05).

Table 2 Nucleotide sequences of specific primers. Target genes

GenBank accession number

Primer sequences PCR products (bp)

18S

AF173612

237

11β-HSD1 XM_417988.2

229

11β-HSD2 XM_003209680.1 229 20-HSD

NM_001030795.1 220

3.4. Breed differences in mRNA and protein expression of 11β-HSD1, 11β-HSD2 and 20-HSD

F: 5′-CACGCCTCACAGACCAAGTA-3′ R: 5′-CCAGTCAAACGGCACATCTA‐3′ F: 5′-GGTGGTGAAAGAGGCTGAGAAC-3′ R: 5′-GGAGGCGACTTTACCTGAAACAG-3′ F: 5′-GGTGGTGAAAGAGGCTGAGAACA-3′ R: 5′-GGAGGCGACTTTACCTGAAACAG-3′ F: 5′- CATCCTGAGAAGATAATGTCCAACG‐3′ R: 5′- TGCTTTGCAGATCATCAATATCCAG‐3′

from E14 to D1. The average growth rate of the fast-growing chickens was 25.4% higher over the period of investigation from E14 to D1 compared to the slow-growing chickens.

Fast growing chicken embryos expressed significantly higher (P b 0.05) 11β-HSD1 (Fig. 3A) and 11β-HSD2 (Fig. 3B) mRNA in liver at all the embryonic stages investigated compared to the slow growing chicken embryos at the same stage. However, hepatic expression of 20-HSD mRNA (Fig. 3C) was significantly higher (P b 0.05) in fast growing chicken embryos on E14. The protein content was not exactly matching the mRNA abundance. Fast growing chicken embryos expressed significantly higher (P b 0.05) 11β-HSD1 (Fig. 4A) on E14, and 11β-HSD2 (Fig. 4B) on E14 and D1. The protein content of 20-HSD was not determined due to a lack of specific antibody. 4. Discussion

3.2. Corticosterone content in yolk and albumen of the eggs Fast-growing chicken breeder hens deposited significantly higher corticosterone content in yolk (Pb 0.05) and albumen (Pb 0.05) compared to slow growing breeder hens (Fig. 1). The corticosterone concentration in the yolk was 60% higher in fast-growing breed than in slow-growing breed, whereas the corticosterone concentration in the albumen was 46.7% higher in fast-growing breed than in slow-growing breed. 3.3. Ontogeny and tissue distribution of 11β-HSD1, 11β-HSD2 and 20-HSD in fast growing chicken embryos We used fast growing chicken embryos to establish the ontogeny and tissue distribution patterns of 11β-HSD1, 11β-HSD2 and 20-HSD. 11β-HSD1, 11β-HSD2 and 20-HSD were widely expressed in various tissues investigated. 11β-HSD1, 11β-HSD2 expressed more abundantly in the liver, kidney and intestine, with relatively lower expression in the hypothalamus and muscle. 11β-HSD1 (Fig. 2A) and 11β-HSD2 (Fig. 2B) showed similar tissue-specific ontogenic patterns. In the liver, 11β-HSD1 and 11β-HSD2 expression was relatively low on E10 and E14, followed by a rapid upregulation on E18 and D1. In the kidney, 11β-HSD1 and 11β-HSD2 expression demonstrated a biphasic pattern with a down-regulation in mid-stage of incubation (E14 or E18) followed by an upregulation towards D1. In the intestine, the highest expression of both 11β-HSD1 and 11β-HSD2 was observed on D1. In contrast, 20-HSD displayed distinct tissue-specific patterns (Fig. 2C). In the liver, expression of 20-HSD was stabilized at a relatively high level from E10 to E18, followed by a significant decrease on D1. In the kidney, intestine and hypothalamus, however, 20-HSD exhibited similar age dependent upregulation from E10 to D1. As a result, the kidney

Corticosterone (ng/g)

6.0 5.0

a

4.0

b

Yolk p<0.01 Albumen p<0.01 Yolk x Albumen p<0.01

3.0 2.0 a

1.0 0.0

b

Yolk

Albumen

Fig. 1. Mean (±SE) yolk and albumen corticosterone concentrations for eggs collected from fast (□) and slow (■) growing broiler breeder hens. Different letters above bars indicate significantly different mean values at P b 0.05.

Corticosterone is the dominant adrenal glucocorticoid in the plasma of birds, yet its presence in the egg has been an issue of debate. Corticosterone has been reported to be present in the egg of chickens (Eriksen et al., 2003), Japanese quails (Hayward et al., 2006), canary (Schwabl, 1993), European starling (Love et al., 2008) and yellow legged gull (Rubolini et al., 2005). However, the specificity of the antibody used in corticosterone determination was questioned and the measured corticosterone was suspected to be the cross-reactivity with progesterone and its precursors (Rettenbacher et al., 2009). It is acknowledged that antibody-based radioimmunoassay and enzyme immunoassay are more sensitive compared to HPLC, but the specificity of the antibody is critical for the accurate measurement. For instance, in a recent study in which the assay specificity issue was raised (Quillfeldt et al., 2011), the corticosterone radioimmunoassay showed high cross-reactivity with progesterone (15.7%) and testosterone (7.9%). Recently, using a specific enzyme immunoassay, corticosterone was detected in the egg of Japanese quail (Okuliarova et al., 2010). The yolk content of corticosterone demonstrated distinct pattern of stress response compared to that of testosterone and gestagens, indicating the specificity of the assay. We used the same corticosterone enzyme immunoassay kit which was validated to have very low cross-reactivity with progesterone (0.31%) and testosterone (0.03%). We detected significant strain differences in yolk and albumen deposition of corticosterone between fast and slow growing broiler breeder eggs. Fast growing broiler breeder hens deposited higher corticosterone in the yolk and albumen compared to the slow growing broilers. Our results agree with previous reports showing significant differences in yolk and albumen corticosterone concentrations in laying hens kept in conventional cages and in floor pens (Singh et al., 2009; Navara and Pinson, 2010), and in eggs laid by white versus brown caged laying hens (Navara and Pinson, 2010), as well as between layer and broiler breeder eggs (Yuan et al., 2009). The differences in egg deposition of corticosterone may be attributed to genotypes (Bayyari et al., 1997; Nestor et al., 2000), housing conditions (Gibson et al., 1986; Franciosini et al., 2010; Lay et al., 2011), feeding systems (March and Macmillan, 1987) and/or nutritional resources (Love et al., 2005). Japanese quails selected for high plasma corticosterone deposit higher corticosterone in the yolk (Hayward et al., 2005). Long-term restraint stress significantly increased corticosterone deposition in hierarchical follicles and laid eggs (Quillfeldt et al., 2011). Plasma corticosterone levels were reported to be higher in broiler breeders fed on a skip-a-day regimen compared to those fed everyday (Ekmay et al., 2010). Therefore, we speculate that fast growing broiler breeder hens subjected to more severe feed restriction may have elevated plasma concentration of corticosterone, which subsequently cause higher corticosterone deposition in eggs.

A

11β-HSD1 mRNA (Fold change of liver at E10)

A.A. Ahmed et al. / Comparative Biochemistry and Physiology, Part A 164 (2013) 200–206

2.0

a

1.0

b b

b b

11β-HSD2 mRNA (Fold change of liver at E10) 20-HSD mRNA (Fold change of liver at E10)

edc

e

c ed c

c e

e e

0.0 2.5

Intestine

a b

Hypothalamus

Muscle

Tissue p > 0.1 Stagep < 0.01 Tissue x stage p < 0.01 a

a

2.0 1.5

Kidney

a ab

ab b

1.0

c c

c

0.5

c

c ed d

0.0 Liver

C

c e

0.5

Liver

B

a

a

E10 E14 E18 D1

Tissue p < 0.01 Stage p < 0.01 Tissue x Stage p = 0.08 a

a

1.5

203

Kidney

Intestine

5.0 4.0

d

Hypothalamus

d d d e

Muscle

Tissue p < 0.01 Stage p < 0.01 Tissue x stage p < 0.01

a

3.0 a

2.0 1.0

c

c

b

c

b d

ed

Kidney

c

d

0.0 Liver

c

c d

Intestine

e

ed

Hypothalamus

e

e

ed e

Muscle

Fig. 2. Ontogeny and tissue distribution of chicken embryonic 11β-HSD1 (A), 11β-HSD2 (B) and 20-HSD mRNA (C). Values are means (±SE) of 3–6 animals. Different letters above bars indicate significantly different mean values at P b 0.05.

It is noted that eggs from fast growing breed are significantly bigger than those from slow growing breed. To test whether the egg corticosterone concentration may be affected by the egg size, we performed a statistic analysis for the corticosterone concentration using egg weight as a covariate. The effect of egg size was not significant for either yolk corticosterone (P = 0.316) or albumen corticosterone (P = 0.801). Therefore, the differences in yolk and albumen corticosterone concentrations between breeds are not directly affected by egg size, but rather reflect the breed differences in the blood corticosterone levels and/or the egg deposition rate of corticosterone in breeder hens during egg formation. Moreover, corticosterone concentration in yolk is much higher than in albumen. This is because of the fact that steroid hormones accumulate predominantly in yolk during egg formation (Rettenbacher et al., 2009). Approximately 80% of egg corticosterone was found in the yolk and 20% in albumen (Royo et al., 2008). In addition, during egg formation, yolk accumulation occurs over 7–12 days before ovulation (Johnson, 1986) whereas the albumen accumulated over 4–6 h before egg deposition. In the present study, the average growth rate of the fast-growing chickens was 25.4% higher over the period of investigation from E14 to D1 compared to the slow-growing chickens. Using the same slow-growing (WENs Yellow Feathered) and the fast-growing (White Recessive Rock) chickens, Zeng et al. (2011) also reported that slow growing breed showed significantly lower embryo weight from E9 to the day of hatch, which is in agreement with other earlier reports showing that fast growing breed eggs and embryos are heavier than slow

growing breeds throughout the incubation period and the fast growing chicks grew almost twice as quickly as the slow growing chicks to 8 weeks of age (Tullett and Burton, 1983; Porter, 1998). In the present study, faster embryonic growth rate in fast-growing chickens is associated with higher corticosterone deposition in the egg. It would be interesting to link the egg corticosterone concentration with embryonic growth rate; however, the biological activity of maternal corticosterone in the egg on embryo development depends on multiple factors including corticosterone metabolism, the glucocorticoid receptors on the fetal tissues, as well as the interaction of maternal and fetal corticosterone. Numerous publications have described the effects of maternal corticosterone on offspring performance, yet the mechanisms underlying such effects remain elusive. Different pathways have been proposed (Henriksen et al., 2011), and reprogramming of HPA axes seems to be the major cause for the long-term phenotypic changes in offspring. The biological function of corticosterone is determined, to a large extent, by the activity of corticosterone metabolizing enzymes expressed in different tissues. Our results show that 11β-HSD1 and 11β-HSD2 mRNA are highly expressed in the liver, kidney and intestine, and weakly expressed in the hypothalamus and muscle. Our findings are in agreement with the previous reports for 11β-HSD1 mRNA (Klusonova et al., 2008a) and 11β-HSD2 mRNA (Klusonova et al., 2008b) in 5–7 weeks old Brown Leghorn chickens. Moreover, the tissue distribution pattern of 11β-HSD1 mRNA in chicken is similar to that reported in mouse showing high expression in the liver and low expression in the brain and muscle during embryonic development (Speirs et al., 2004).

A 2

a

1.5 1

b c

c c

0.5 0

E14

E18

D1

11β-HSD1 protein (Fold change)

2 Stage p < 0.01 Breed p < 0.01 Stage x Breed p=0.25 ab

E14

3

Stage p < 0.01 Breed p < 0.01 Stage x Breed p=0.06

a

2.5 2 1.5

b c c

1 0

E14

E18

2 1.5

c

d

0.5

ab a

b

1

c

D1

Stage p < 0.01 Breed p <0.01 Stage x Breed p=0.27

c

E14

E18

D1

Fast Slow Fast Slow Fast Slow

1.5

Stage p=82 Breed p<0.01 Stage x Breed p<0.01 11β-HSD1 GAPDH

b

b bc

1

bc

c

0.5

E14 E14

2 1.5

E18 E18

D1

D1 Stage p=.94

Breed p<0.01 Fast Slow Fast Slow Fast Slow Stage x Breed p<0.01 11β-HSD2 a GAPDH

a

ab

1

ab

b b

0.5 0

E14

E18

D1

Fig. 4. Breed differences of 11β-HSD1 (A) and 11β-HSD2 (B) protein expression in the liver of fast (□) and slow (■) growing embryos during embryonic development. Values are means (±SE) of 6 animals. Different letters above bars indicate significantly different mean values at P b 0.05.

cd

0.5 0

B

E18

a

0

11β-HSD2 Protein (Fold change)

C

11β-HSD2 (tmRNA Fold Change)

B

20-HSD mRNA (Fold Change)

A

A.A. Ahmed et al. / Comparative Biochemistry and Physiology, Part A 164 (2013) 200–206

11β-HSD1 mRNA (Fold Change)

204

D1

Fig. 3. Breed differences of chicken embryonic 11β-HSD1 (A), 11β-HSD2 (B) and 20-HSD (C) mRNA expression in the liver of two fast (□) and slow (■) growing embryos during embryonic development. Values are means (±SE) of 6 animals. Different letters above bars indicate significantly different mean values at P b 0.05.

11β-HSD1 and 11β-HSD2 are expressed in a similar ontogenetic pattern in the liver, being upregulated towards hatching. The results are similar to what was reported in mouse embryo in which 11β-HSD1 mRNA increased towards the term (Thompson et al., 2004). This may imply critical roles of glucocorticoid in fetal liver shortly before hatching or parturition (Ballard, 1979). In the kidney, a transient down-regulation of 11β-HSD1 and 11β-HSD2 was observed in E14 or E18, yet the reasons for such developmental changes are presently unknown. In the intestine, both 11β-HSD1 and 11β-HSD2 demonstrated consistent upregulation from E10 up to D1. In general, 11β-HSD1 and 11β-HSD2 share similar tissue distribution and ontogenic patterns, suggesting the coordinated action of activating and inactivating enzymes for glucocorticoids during chicken embryonic development. In contrast, 20-HSD mRNA demonstrated different tissue distribution and ontogenic patterns from 11β-HSD1/2, which was consistent with a previous report on Brown Leghorn chickens (Bryndova et al., 2006). In newly hatched chicks, 20-HSD mRNA was highly expressed in the kidney and intestine. Presently, the role of 20-HSD in these tissues is unknown during chicken embryonic development. However, it is suggested that 20-HSD together with 11β-HSD2 plays a critical role in chicken kidney and intestine to regulate water and NaCl reabsorption during urine formation (Mazancova et al., 2005). Here we show, for the first time, the breed disparities in the hepatic expression of both 11β-HSD1 and 11β-HSD2 mRNA during embryonic

development. This finding is in line with a previous report that pigs showing different stress coping characteristics displayed distinct patterns of hippocampal 11β-HSD1 and 11β-HSD2 expression under both basal and stressed conditions (Wei et al., 2010). The higher hepatic expression of 11β-HSD1 and 11β-HSD2 mRNA and protein in fast-growing broiler chicken embryos may implicate higher metabolic rate or turnover rate of corticosterone in the liver. However, how differences in corticosterone metabolism link to liver metabolic function awaits further investigation. In conclusion, we describe the patterns of tissue distribution, ontogeny and breed disparity of corticosterone metabolic enzymes in developing chicken embryos. These data may provide a basis for further investigations into tissue-specific glucocorticoid activities in chicken embryos. Also, the breed differences in egg deposition of corticosterone, as well as the hepatic expression of glucocorticoid metabolic enzymes, suggest an important role of corticosterone in the regulation of growth and development in the chicken. Acknowledgments This work was supported by the NSFC-Guangdong Joint Fund (project no. U0931004), the Sino-German Cooperation in Agriculture, project no. 28/04-05CHN7 (2010–2011), the Special Fund for Agroscientific Research in the Public Interest (201003011), and the Priority Academic Program Development of Jiangsu Higher Education Institutions. References Albiston, A.L., Obeyesekere, V.R., Smith, R.E., Krozowski, Z.S., 1994. Cloning and tissue distribution of the human 11 beta-hydroxysteroid dehydrogenase type 2 enzyme. Mol. Cell. Endocrinol. 105, R11–R17. Ballard, P.L., 1979. Glucocorticoid and differentiation. In: Baxter, J.D., Rousseau, G.G. (Eds.), Glucocorticoid Hormone Action. Springer-Verlag, New York, pp. 493–497.

A.A. Ahmed et al. / Comparative Biochemistry and Physiology, Part A 164 (2013) 200–206 Bayyari, G.R., Huff, W.E., Rath, N.C., Balog, J.M., Newberry, L.A., Villines, J.D., Skeeles, J.K., Anthony, N.B., Nestor, K.E., 1997. Effect of the genetic selection of turkeys for increased body weight and egg production on immune and physiological responses. Poult. Sci. 76, 289–296. Bryndova, J., Klusonova, P., Kucka, M., Mazancova-Vagnerova, K., Miksik, I., Pacha, J., 2006. Cloning and expression of chicken 20-hydroxysteroid dehydrogenase. J. Mol. Endocrinol. 37, 453–462. Chomczynski, P., Sacchi, N., 1987. Single step method of RNA isolation by acid guanidium thiocyanate–phenol–chloroform extraction. Anal. Biochem. 162, 156–159. De Pablo, F., Roth, J., Hernandez, E., Pruss, R.M., 1982. Insulin is present in chicken eggs and early chick embryos. Endocrinology 111, 1909–1916. Diederich, S., Hanke, B., Burkhardt, P., Muller, M., Schoneshofer, M., Bahr, V., Oelkers, W., 1998. Metabolism of synthetic corticosteroids by 11 beta-hydroxysteroiddehydrogenases in man. Steroids 63, 271–277. Edwards, C.R., Benediktsson, R., Lindsay, R.S., Seckl, J.R., 1996. 11 beta-Hydroxysteroid dehydrogenases: key enzymes in determining tissue-specific glucocorticoid effects. Steroids 61, 263–269. Eising, C.M., Muller, W., Dijkstra, C., Groothuis, T.G., 2003. Maternal androgens in egg yolks: relation with sex, incubation time and embryonic growth. Gen. Comp. Endocrinol. 132, 241–247. Ekmay, R.D., de Beer, M., Rosebrough, R.W., Richards, M.P., McMurtry, J.P., Coon, C.N., 2010. The role of feeding regimens in regulating metabolism of sexually mature broiler breeders. Poult. Sci. 89, 1171–1181. Eriksen, M.S., Haug, A., Torjesen, P.A., Bakken, M., 2003. Prenatal exposure to corticosterone impairs embryonic development and increases fluctuating asymmetry in chickens (Gallus gallus domesticus). Br. Poult. Sci. 44, 690–697. Franciosini, M.P., Canali, C., Casagrande Proietti, P., Tarhuni, O., Fringuelli, E., Asdrubali, G., 2010. Plasma corticosterone levels in laying hens from three different housing systems: Preliminary results. Gibson, S.W., Hughes, B.O., Harvey, S., Dun, P., 1986. Plasma concentrations of corticosterone and thyroid hormones in laying fowls from different housing systems. Br. Poult. Sci. 27, 621–628. Gil, D., 2008. Hormones in avian eggs: physiology, ecology and behavior. Adv. Stud. Behav. 38, 337–398. Gmelin, E., Draude, K., Leichle, P., 1985. ECG-directed DSA of the pulmonary arteries— technic and initial clinical experiences. Rontgenblatter 38, 17–21. Groothuis, T.G., von Engelhardt, N., 2005. Investigating maternal hormones in avian eggs: measurement, manipulation, and interpretation. Ann. N. Y. Acad. Sci. 1046, 168–180. Groothuis, T.G., Muller, W., von Engelhardt, N., Carere, C., Eising, C., 2005. Maternal hormones as a tool to adjust offspring phenotype in avian species. Neurosci. Biobehav. Rev. 29, 329–352. Harris, H.J., Kotelevtsev, Y., Mullins, J.J., Seckl, J.R., Holmes, M.C., 2001. Intracellular regeneration of glucocorticoids by 11beta-hydroxysteroid dehydrogenase (11betaHSD)-1 plays a key role in regulation of the hypothalamic–pituitary–adrenal axis: analysis of 11beta-HSD-1-deficient mice. Endocrinology 142, 114–120. Hayward, L.S., Satterlee, D.G., Wingfield, J.C., 2005. Japanese quail selected for high plasma corticosterone response deposit high levels of corticosterone in their eggs. Physiol. Biochem. Zool. 78, 1026–1031. Hayward, L.S., Richardson, J.B., Grogan, M.N., Wingfield, J.C., 2006. Sex differences in the organizational effects of corticosterone in the egg yolk of quail. Gen. Comp. Endocrinol. 146, 144–148. Henriksen, R., Rettenbacher, S., Groothuis, T.G., 2011. Prenatal stress in birds: pathways, effects, function and perspectives. Neurosci. Biobehav. Rev. 35, 1484–1501. Holmes, M.C., Seckl, J.R., 2006. The role of 11beta-hydroxysteroid dehydrogenases in the brain. Mol. Cell. Endocrinol. 248, 9–14. Holmes, M.C., Yau, J.L., Kotelevtsev, Y., Mullins, J.J., Seckl, J.R., 2003. 11 Betahydroxysteroid dehydrogenases in the brain: two enzymes two roles. Ann. N. Y. Acad. Sci. 1007, 357–366. Hu, Y., Ni, Y., Ren, L., Dai, J., Zhao, R., 2008. Leptin is involved in the effects of cysteamine on egg laying of hens, characteristics of eggs, and posthatch growth of broiler offspring. Poult. Sci. 87, 1810–1817. Johnson, A.L., 1986. Reproduction in the female, Avian Physiology 4th ed. pp. 403. Klusonova, P., Kucka, M., Ergang, P., Miksik, I., Bryndova, J., Pacha, J., 2008a. Cloning of chicken 11beta-hydroxysteroid dehydrogenase type 1 and its tissue distribution. J. Steroid Biochem. Mol. Biol. 111, 217–224. Klusonova, P., Kucka, M., Miksik, I., Bryndova, J., Pacha, J., 2008b. Chicken 11beta-hydroxysteroid dehydrogenase type 2: partial cloning and tissue distribution. Steroids 73, 348–355. Kucka, M., Vagnerova, K., Klusonova, P., Miksik, I., Pacha, J., 2006. Corticosterone metabolism in chicken tissues: evidence for tissue-specific distribution of steroid dehydrogenases. Gen. Comp. Endocrinol. 147, 377–383. Lay Jr., D.C., Fulton, R.M., Hester, P.Y., Karcher, D.M., Kjaer, J.B., Mench, J.A., Mullens, B.A., Newberry, R.C., Nicol, C.J., O'Sullivan, N.P., Porter, R.E., 2011. Hen welfare in different housing systems. Poult. Sci. 90, 278–294. Li, R., Hu, Y., Ni, Y., Xia, D., Grossmann, R., Zhao, R., 2011. Leptin stimulates hepatic activation of thyroid hormones and promotes early posthatch growth in the chicken. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 160, 200–206. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(− delta delta C(T) method. Methods 25, 402–408. Love, O.P., Williams, T.D., 2008a. Plasticity in the adrenocortical response of a freeliving vertebrate: the role of pre- and post-natal developmental stress. Horm. Behav. 54, 496–505. Love, O.P., Williams, T.D., 2008b. The adaptive value of stress-induced phenotypes: effects of maternally derived corticosterone on sex-biased investment, cost of reproduction, and maternal fitness. Am. Nat. 172, E135–E149.

205

Love, O.P., Chin, E.H., Wynne-Edwards, K.E., Williams, T.D., 2005. Stress hormones: a link between maternal condition and sex-biased reproductive investment. Am. Nat. 166, 751–766. Love, O.P., Wynne-Edwards, K.E., Bond, L., Williams, T.D., 2008. Determinants of within- and among-clutch variation in yolk corticosterone in the European starling. Horm. Behav. 53, 104–111. March, B.E., Macmillan, C., 1987. Plasma corticosterone concentrations in growing chickens fed diets formulated to promote different rates of growth. Poult. Sci. 66, 1358–1366. Mazancova, K., Kucka, M., Miksik, I., Pacha, J., 2005. Glucocorticoid metabolism and Na+ transport in chicken intestine. J. Exp. Zool. A Comp. Exp. Biol. 303, 113–122. Möstl, E., Spendier, H., Kotrschal, K., 2001. Concentration of immunoreactive progesterone and androgens in the yolk of hen's eggs (Gallus domesticus). Vet. Med. Austria/ Wien Tierärztl. Mschr. 88, 62–65. Navara, K.J., Pinson, S.E., 2010. Yolk and albumen corticosterone concentrations in eggs laid by white versus brown caged laying hens. Poult. Sci. 89, 1509–1513. Nestor, K.E., Anderson, J.W., Patterson, R.A., 2000. Genetics of growth and reproduction in the turkey. 14. Changes in genetic parameters over thirty generations of selection for increased body weight. Poult. Sci. 79, 445–452. Okuliarova, M., Sarnikova, B., Rettenbacher, S., Skrobanek, P., Zeman, M., 2010. Yolk testosterone and corticosterone in hierarchical follicles and laid eggs of Japanese quail exposed to long-term restraint stress. Gen. Comp. Endocrinol. 165, 91–96. Porter, T.E., 1998. Differences in embryonic growth hormone secretion between slow and fast growing chicken strains. Growth Hormon. IGF Res. 8, 133–139. Quillfeldt, P., Poisbleau, M., Parenteau, C., Trouve, C., Demongin, L., van Noordwijk, H.J., Mostl, E., 2011. Measuring corticosterone in seabird egg yolk and the presence of high yolk gestagen concentrations. Gen. Comp. Endocrinol. 173, 11–14. Rajan, V., Chapman, K.E., Lyons, V., Jamieson, P., Mullins, J.J., Edwards, C.R., Seckl, J.R., 1995. Cloning, sequencing and tissue-distribution of mouse 11 beta-hydroxysteroid dehydrogenase-1 cDNA. J. Steroid Biochem. Mol. Biol. 52, 141–147. Rettenbacher, S., Mostl, E., Hackl, R., Palme, R., 2005. Corticosterone in chicken eggs. Ann. N. Y. Acad. Sci. 1046, 193–203. Rettenbacher, S., Mostl, E., Groothuis, T.G., 2009. Gestagens and glucocorticoids in chicken eggs. Gen. Comp. Endocrinol. 164, 125–129. Royo, F., Mayo, S., Carlsson, H.E., Hau, J., 2008. Egg corticosterone: a noninvasive measure of stress in egg-laying birds. J. Avian Med. Surg. 22, 310–314. Rubolini, D., Romano, M., Boncoraglio, G., Ferrari, R.P., Martinelli, R., Galeotti, P., Fasola, M., Saino, N., 2005. Effects of elevated egg corticosterone levels on behavior, growth, and immunity of yellow-legged gull (Larus michahellis) chicks. Horm. Behav. 47, 592–605. Saino, N., Romano, M., Ferrari, R.P., Martinelli, R., Møller, A.P., 2005. Stressed mothers lay eggs with high corticosterone levels which produce low-quality offspring. J. Exp. Zool. A Comp. Exp. Biol. 303, 998–1006. Saito, S., Tachibana, T., Choi, Y.H., Denbow, D.M., Furuse, M., 2005. ICV CRF and isolation stress differentially enhance plasma corticosterone concentrations in layer- and meat-type neonatal chicks. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 141, 305–309. Schwabl, H., 1993. Yolk is a source of maternal testosterone for developing birds. Proc Natl Acad Sci U S A 90, 11446–11450. Seckl, J.R., 2004. Prenatal glucocorticoids and long-term programming. Eur. J. Endocrinol. 151 (Suppl. 3), U49–U62. Singh, R., Cook, N., Cheng, K.M., Silversides, F.G., 2009. Invasive and noninvasive measurement of stress in laying hens kept in conventional cages and in floor pens. Poult. Sci. 88, 1346–1351. Speirs, H.J., Seckl, J.R., Brown, R.W., 2004. Ontogeny of glucocorticoid receptor and 11beta-hydroxysteroid dehydrogenase type-1 gene expression identifies potential critical periods of glucocorticoid susceptibility during development. J. Endocrinol. 181, 105–116. Spencer, K.A., Evans, N.P., Monaghan, P., 2009. Postnatal stress in birds: a novel model of glucocorticoid programming of the hypothalamic–pituitary–adrenal axis. Endocrinology 150, 1931–1934. Stewart, P.M., Krozowski, Z.S., 1999. 11 beta-Hydroxysteroid dehydrogenase. Vitam. Horm. 57, 249–324. Tannin, G.M., Agarwal, A.K., Monder, C., New, M.I., White, P.C., 1991. The human gene for 11 beta-hydroxysteroid dehydrogenase. Structure, tissue distribution, and chromosomal localization. J. Biol. Chem. 266, 16653–16658. Thompson, A., Han, V.K., Yang, K., 2004. Differential expression of 11beta-hydroxysteroid dehydrogenase types 1 and 2 mRNA and glucocorticoid receptor protein during mouse embryonic development. J. Steroid Biochem. Mol. Biol. 88, 367–375. Tona, K., Onagbesan, O., De Ketelaere, B., Decuypere, E., Bruggeman, V., 2003. Effects of turning duration during incubation on corticosterone and thyroid hormone levels, gas pressures in air cell, chick quality, and juvenile growth. Poult. Sci. 82, 1974–1979. Tullett, S.G., Burton, F.G., 1983. An investigation within a species (Gallus domesticus) of the hypothesis that embryonic and juvenile growth rates in birds are correlated. Reprod. Nutr. Dev. 23, 525–535. Walker, B.R., Campbell, J.C., Williams, B.C., Edwards, C.R., 1992. Tissue-specific distribution of the NAD(+)-dependent isoform of 11 beta-hydroxysteroid dehydrogenase. Endocrinology 131, 970–972. Wei, S., Xia, D., Li, L., Xiao, J., Bao, J., Parvizi, N., Zhao, R., 2010. Breed-specific expression of hippocampal 11β-hydroxysteroid dehydrogenases and glucocorticoid receptors in Erhualian and Pietrain pigs exhibiting distinct stress coping characteristics. Livest. Sci. 131, 240–244. Wilson, C.M., McNabb, F.M., 1997. Maternal thyroid hormones in Japanese quail eggs and their influence on embryonic development. Gen. Comp. Endocrinol. 107, 153–165.

206

A.A. Ahmed et al. / Comparative Biochemistry and Physiology, Part A 164 (2013) 200–206

Yang, K., Smith, C.L., Dales, D., Hammond, G.L., Challis, J.R., 1992. Cloning of an ovine 11 beta-hydroxysteroid dehydrogenase complementary deoxyribonucleic acid: tissue and temporal distribution of its messenger ribonucleic acid during fetal and neonatal development. Endocrinology 131, 2120–2126. Yuan, L., Ni, Y., Barth, S., Wang, Y., Grossmann, R., Zhao, R., 2009. Layer and broiler chicks exhibit similar hypothalamic expression of orexigenic neuropeptides but distinct expression of genes related to energy homeostasis and obesity. Brain Res. 1273, 18–28.

Zeng, P.L., Li, X.G., Wang, X.Q., Zhang, D.X., Shu, G., Luo, Q.B., 2011. The relationship between gene expression of cationic and neutral amino acid transporters in the small intestine of chick embryos and chick breed, development, sex, and egg amino acid concentration. Poult. Sci. 90, 2548–2556.