Differences in stearoyl-CoA desaturase mRNA levels between Japanese Black and Holstein cattle

Livestock Production Science 87 (2004) 215 – 220 www.elsevier.com/locate/livprodsci

Differences in stearoyl-CoA desaturase mRNA levels between Japanese Black and Holstein cattle M. Taniguchi a, H. Mannen b, K. Oyama b, Y. Shimakura c, A. Oka d, H. Watanabe e, T. Kojima e, M. Komatsu e, G.S. Harper f, S. Tsuji b,* a

Graduate School of Science & Technology, Kobe University, 1-1, Rokkodai, 657-8501 Kobe, Japan b Faculty of agriculture, Kobe University, 1-1, Rokkoudai, 657-8501 Kobe, Japan c Gifu City Meat Inspection Office, 5-148, 500-8266 Gifu, Japan d Livestock Research Center, Hyogo Prefectural Institute of Agriculture, Forestry, and Fisheries, 1533, 679-0198 Kasai, Japan e Department of Livestock and Grassland Science, National Agricultural Research Center for Western Region, 60, 694-0013 Oda, Japan f Cattle and Beef Quality Cooperative Research Centre, CSIRO Livestock Industries, Long Pocket Laboratories, Indooroopilly, Queensland, 4068, Australia Received 24 September 2002; received in revised form 21 July 2003; accepted 29 July 2003

Abstract The effect of cattle breed on stearoyl-CoA desaturase (SCD) gene expression was investigated in this study. Detailed comparisons of SCD mRNA level were made among three steers each of Japanese Black, Holstein and their crossbreed which were age-matched had been fed the same diet and were sampled by biopsy of the longissimus dorsi (LD) muscle and subcutaneous fat. The levels of SCD mRNA were measured in samples of muscle and subcutaneous fat. The levels of SCD mRNA demonstrated a breed effect in each tissue, though the relative expression was higher ( P < 0.05) in subcutaneous fat. The ratio of SCD mRNA to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA for Japanese Black, crossbreed and Holstein were 132.1 F 34.1, 73.5 F 22.7 and 39.5 F 12.9, respectively, and significant ( P < 0.05) differences existed between Japanese Black and Holstein cattle. Japanese Black subcutaneous fat had consistently higher ( P < 0.05) monounsaturated fatty acids (MUFA) percentage than Holstein subcutaneous fat. These results suggest that differences in SCD gene expression may contribute to the fatty acid compositional differences seen between subcutaneous adipose tissue of Japanese Black cattle and Holstein. D 2003 Elsevier B.V. All rights reserved. Keywords: Fatty acids; Cattle; RNA; Acyl-CoA desaturase

1. Introduction The Japanese Black breed of cattle is valued for its highly marbled meat and its lower melting properties of the fat compared with other breeds (Zembayashi et

* Corresponding author. Tel./fax: +81-78-803-5801. E-mail address: [email protected] (S. Tsuji). 0301-6226/$ - see front matter D 2003 Elsevier B.V. All rights reserved. doi:10.1016/j.livprodsci.2003.07.008

al., 1995). The lower melting points reflect the higher content of unsaturated fatty acids in fat (Yang et al., 1999a). As well as contributing to the softness of bovine fat, such fatty acid profiles may also contribute positively to beef flavour (Melton et al., 1982). Stearoyl-CoA desaturase (SCD) is the enzyme responsible for conversion of saturated fatty acids into monounsaturated fatty acids (MUFA) in mammalian tissues. In the case of ruminants, fatty acids in

216

M. Taniguchi et al. / Livestock Production Science 87 (2004) 215–220

the feed are chemically reduced by microorganisms in the rumen and absorbed as almost saturated fatty acids. The composition of fatty acids stored in the fat depots reflects the previous action of SCD on substrates such as stearic acid or palmitic acid (Kim and Ntambi, 1999). Whilst nutrition can be clearly shown to contribute to the fatty acid profile of subcutaneous fat and intramuscular fat, the genetic factors in determining the fatty acid profile of beef fat is being defined (Yang et al., 1999b; Oka et al., 2002). Given its determinant role in desaturation of monounsaturated fatty acid, SCD is a candidate for genetic variation in fatty acid composition (Enoch et al., 1976). There are relatively few studies that describe either its genetic variation or its relationship to fatty acid composition in cattle, though Yang et al. (1999b) have presented interesting correlations in a survey of bovine adipose tissues. Messenger RNA quantification is now technically routine and is readily applicable to breed comparison experiments, though interpretation of the results assumes transcriptional regulation of the target gene. Again, there have been few studies on SCD mRNA quantification in farm animals (Cameron et al., 1994; Barber et al., 2000; Chung et al., 2000). In this study, we firstly determined full-length bovine SCD cDNA sequence, and then, we sought to demonstrate genetic variance in SCD at the expression level of the mRNA and to associate it with the fatty acid composition of subcutaneous fat. To account for the effects of animal age and sex on SCD mRNA levels, age-matched animals fed identical diets were sampled under surgical conditions for both fat and muscle.

2. Materials and methods 2.1. Animals The breed comparison experiments were carried out using three 10-month-old steers from both the Japanese Black and Holstein breeds as well as three 10-month-old Japanese Black and Holstein crossbred steers. The animals were housed in three adjacent pens in each breed group and fed the same diets for the fattening period of 16 months. Longissimus dorsi (LD) muscle and subcutaneous adipose tissue

samples were collected by biopsy at 26 months of age. The average with standard error of live weight of Japanese Black, Holstein and crossbred steers was 564.0 F 8.3, 670.7 F 32.2 and 677.3 F 10.9, respectively. Biopsy sampling was achieved with an instrument manufactured by Biotech (Slovak Republic). To achieve local anesthesia, a total 10 ml of 2% lidocaine (Fujisawa Pharmaceutical, Japan) was injected on the both sides of vertebral column around the third lumber vertebrae. The anesthesia treatment was done at 10 min before sampling. Samples of LD and subcutaneous fat were taken alternately from the both sides of the third lumber vertebrae. The sample weight was approximately 1 g. Postoperative care included application of a broad-spectrum antibiotic Mycilin Sol (Meiji, Japan), though stitching was not required to close the wound. All tissue samples excised from the animals were immediately transferred and soaked into liquid nitrogen for more than 5 min and then stored at 80 jC prior to RNA preparation. This experiment was conducted under the Guidelines for the Care and Use of Experimental Animals, in Rokkodai Campus, Kobe University. 2.2. Fatty acid analysis Total lipids were extracted from approximately 500 mg of subcutaneous adipose tissue using 10 ml of chloroform/methanol (2:1, vol/vol) according to the method of Folch et al. (1957). The lipids were methylated by incubation at 60 jC for 5 min with 0.5N of sodium methylate by the method of O’Keefe et al. (1968). Methylated lipid samples were analyzed using a flame ionization detector on a gas chromatograph (GC14A Shimadzu, Japan) equipped with a 30m  0.32-mm capillary column coated with HR-SS10 (Shinwa Chemical Industries, Japan). The column was programmed to warm from 150 to 220 jC at 3 jC/ min followed by 3 min at 220 jC. The injector and detector temperature were 250 jC. The pressures of the gases were 0.6 kg/cm2 for the carrier gas (helium), 0.6 kg/cm2 for the hydrogen, 0.6 kg/cm2 for make-up gas (helium) and 0.5 kg/cm2 for the combustion air. Chromatograms were recorded with a computing integrator (Chromatopac C-R6A; Shimadzu). Identification of sample fatty acids was made by comparing the relative

M. Taniguchi et al. / Livestock Production Science 87 (2004) 215–220

retention times of standard fatty acid methyl-esters (Funakoshi, Japan), and the relative proportions were determined as percentages of summed peak areas. The MUFAs included C16:1 and C18:1. 2.3. RNA extraction and cDNA synthesis RNA was extracted from approximately 500 mg of the muscle or adipose tissue using 10 ml of Sepazol RNA I (Nacalai Tesque, Japan), which essentially employs the method of Chomczynski and Sacchi (1987). Single-stranded cDNA was synthesized from 300 ng total RNA by incubation at 42 jC for 50 min with oligo-dT primer and SuperScript II reverse transcriptase (Gibco Life Technologies, NY, USA).

217

2.4. Sequencing of full-length bovine SCD cDNA The full-length bovine SCD cDNA sequence was determined by the method of rapid amplification of cDNA ends (RACE). Double-stranded cDNA was prepared using a Marathon cDNA amplification kit (Clontech, CA, USA) and 1 Ag of purified poly(A) RNA prepared from total RNA of one Japanese Black steer. After blunt-ending the cDNA fragments, adaptors were ligated to the fragments. With two specific primers for bovine SCD and two adaptor-specific primers, the 3Vuntranslated region (UTR) and 5Vnoncoding region of bovine SCD were amplified using nested PCR. PCR products were sequenced using SequiTherm Excel II DNA sequencing kit-LC (Epi-

Fig. 1. Sequence of ORF of bovine SCD cDNA. The open box shows the ORF of bovine SCD cDNA. The shaded boxes show 5Vnoncoding region and 3VUTR. Single underlines show primers, and double underline shows the probe for the real-time PCR experiments.

218

M. Taniguchi et al. / Livestock Production Science 87 (2004) 215–220

centre Technologies, WI, USA) and an automated sequencer DNA 4200 (Licor, NE, USA). 2.5. Real-time polymerase chain reaction analysis TaqManR system was applied to mRNA quantification (Applied Biosystems, CA, USA). According to the bovine SCD cDNA sequence, primers and probes for bovine SCD cDNA (target) and bovine glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene (internal control) were designed using the Primer Expressed software (Applied Biosystems). The sequences of primers and TaqManR probes were as follows: for SCD, 5V primer was GTGATGTTCCAGAGGAGGTACTACAA, 3Vprimer was AACGTTTCATCCCACAGCATAGGA and the TaqManR probe was CCTGGTGTCCTGTTGTTGTGCTTCATCC; for GAPDH, 5Vprimer was TGACCCCTTCATTGACCTTCA, 3Vprimer was ACCCCAGTGGACTCC A C TA C AT, a n d t h e Ta q Ma n R p r o b e w a s AGCGAGATCCTGCCAACATCAAGTG. The increase in reporter fluorescent dye emission during the PCR reaction was monitored in real-time using the ABI PRISM 7700 sequence detection system (Applied Biosystems). The PCR conditions were one cycle at 50 jC for 2 min, one cycle at 95 jC for 10 min, 50 cycles at 95 jC for 15 s and 60 jC for 1 min. The standard curves for each gene were generated by serial dilution of the total RNA isolated from a Japanese Black steer. The measurement of mRNA was repeated three times. 2.6. Statistical analysis

protein is coded. Bovine SCD cDNA has a long 3VUTR sequence of 3884 bp containing two poly(A) signals and four ‘‘ATTTA’’ motifs that may affect on mRNA stability in mouse and human (Sessler et al., 1996; Zhang et al., 1999). The data of the full-length cDNA sequence have been deposited into GenBank (accession number AB075020). As far as we can ascertain, this is the first time the bovine full-length SCD sequence has been presented. We established an experimental herd in order to address genetic factor affecting on MUFA percentage. Three Japanese Black, three Holstein and three crossbred steers were maintained together under identical conditions. Table 1 shows the average, relative levels of SCD mRNA in two tissues from the three groups. The SCD mRNA level in subcutaneous adipose tissue of Japanese Black was 3.3-fold higher ( P < 0.05) than that of Holstein, and the level for the crossbreed was intermediate: 1.8-fold higher ( P>0.05) than Holstein (Table 1). The SCD mRNA level in Japanese Black LD muscle was 4.1-fold higher ( P < 0.05) than that of Holstein, and again the level for the crossbreed was 1.4-fold higher than Holstein ( P>0.05). The difference of fat content in muscle between breeds could not be compared, because there was not enough volume of muscle sample obtained by biopsy. At the slaughter period (31-month-old in each breed), mean value with standard error of BMS number of Japanese Black, crossbreed and Holstein steers indicated 4.0 F 0.6, 3.7 F 1.2 and 3.0 F 0.6, respectively. There were no significant differences of BMS number ( P>0.05) between breeds.

Differences of MUFA in subcutaneous adipose tissue, mRNA in LD muscle and subcutaneous adipose tissue, and beef marbling standard (BMS) number between breeds were compared with Fisher’s least significant difference (LSD). Real-time PCR was repeated three times, and the three assays were averaged to obtain mRNA values for each individual.

Table 1 Comparison of SCD mRNA level and MUFA percentage in subcutaneous adipose tissues between Japanese Black, Holstein and crossbreed

3. Results

Values were means with their standard errors. Means in columns without a common superscript letter differ ( P < 0.05). * The values of SCD mRNA were quantified relative to GAPDH mRNA. ** The values indicated MUFA percentages of total fatty acids in subcutaneous adipose tissue.

Fig. 1 illustrates the ORF sequence and structure of bovine SCD cDNA. The cDNA is 5351 bp long, the ORF, 1080 bp long, and hence, a 359-amino acid

Breed

n

SCD mRNA* Muscle

Adipose tissue

Japanese Black Crossbreed Holstein

3 3 3

3.3 F 1.0a 1.1 F 0.3b 0.8 F 0.2b

132.1 F 34.1a 73.5 F 22.7a,b 39.5 F 12.9b

MUFA (%)** 57.3 F 0.6a 54.0 F 0.4a,b 53.4 F 1.6b

M. Taniguchi et al. / Livestock Production Science 87 (2004) 215–220

4. Discussion In previous studies, Chung et al. (2000) determined the partial ORF of SCD gene, and Glimm et al. (2002) determined the genomic sequences of six exons including partial UTR sequences of cattle SCD gene. In this study, we determined full-length bovine SCD cDNA sequence, including full length of 5V and 3V UTR. There were several motif sequences in 3VUTR affecting mRNA stability such as ‘‘ATTTA’’ motifs and poly(A) signal. The full-length SCD cDNA sequence, obtained in present study, will contribute to investigate these motif sequences effect on the level of SCD mRNA expression. Stearoyl-CoA desaturase is the enzyme responsible for conversion of the saturated fatty acids, stearic and palmitic, into oleic and palmitoleic acids via the introduction of a double bond at the D9 position of the saturated acids. There are relatively few studies that describe either SCD enzyme activity or SCD mRNA levels in bovine tissues, though effects of diet, age and climatic conditions on SCD activity have each been described (Cameron et al., 1994; Martin et al., 1999; Yang et al., 1999b; Chung et al., 2000). Cameron et al. (1994) attempted to elucidate the SCDbased breed differences between Angus and American Wagyu steers, using Northern blot hybridization assays. However, they were not able to demonstrate breed differences and concluded that differences in fatty acid composition between these breeds could not be attributed to SCD enzyme activity or mRNA concentration. This study demonstrated for the first time the genetic variance in SCD at the level of the mRNA that may account for some of the observed genetic variance in fatty acid composition of subcutaneous adipose tissue. The MUFA percentage of Japanese Black was significantly higher ( P < 0.05) than that of Holstein cattle. The differences shown in MUFA percentage were similar to the result obtained by Yoshimura and Namikawa (1983) and Zembayashi et al. (1995). This experiment indicated that SCD mRNA levels differed significantly between agematched Japanese Black and Holstein steers in both subcutaneous fat and LD muscle samples (Table 1). The present results suggest that SCD mRNA expression level is one of contributing factors controlling fatty acid composition in subcutaneous adipose tissue.

219

Comparing the expression level in LD muscle between breeds, Japanese Black, which is known by a high marbling level beef, showed higher amounts of SCD mRNA level than that of Holstein (Table 1). The difference of intramuscular fat content between breeds may affect on the expression of SCD mRNA; however, the BMS number of Japanese Black (4.0 F 0.6) was only slightly higher ( P>0.05) than that of Holstein cattle (3.0 F 0.6). Furthermore, the level of SCD mRNA in subcutaneous adipose tissue in Japanese Black was clearly higher than the level in Holstein cattle (Table 1). Therefore, it is suggested that the difference of fat content in LD muscle did not substantially affect on SCD mRNA level in LD muscle. These suggest that Japanese Black cattle may contain more unsaturated adipose tissue in intramuscular fat in LD muscle than Holstein cattle as well as shown in subcutaneous adipose tissue. In this study, we determined full-length of bovine SCD cDNA and subsequently indicated that Japanese Black showed higher SCD mRNA level and MUFA percentage in subcutaneous adipose tissue than Holstein cattle. Hence, it suggests that Japanese Black cattle would produce favorable flavoured beef due to develop unsaturated adipose tissue. The ongoing search of the transcriptional factors of SCD gene may provide further definition to the regulation of SCD gene expression.

References Barber, M.C., Ward, R.J., Richards, S.E., Salter, A.M., Buttery, P.J., Vermon, R.G., Travers, M.T., 2000. Ovine adipose tissue monounsaturated fat content is correlated to depot-specific expression of the stearoyl-CoA desaturase gene. J. Anim. Sci. 78, 62 – 68. Cameron, P.J., Rogers, M., Oman, J., May, S.G., Lunt, D.K., Smith, S.B., 1994. Stearoyl coenzyme A desaturase enzyme activity and mRNA levels are not different in subcutaneous adipose tissue from Angus and Wagyu steers. J. Anim. Sci. 72, 2624 – 2628. Chomczynski, P., Saachi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate – phenol – chloroform extraction. Anal. Biochem. 162, 156 – 159. Chung, M., Seckho, H., Soonseog, J., Jinduck, B., Kwangkeun, C., Myunggi, B., Yunjaie, C., 2000. Cloning and characterization of bovine stearoyl CoA desaturase 1 cDNA from adipose tissue. Biosci. Biotechnol. Biochem. 64, 1526 – 1530. Enoch, H.G., Catala, A., Strittmatter, P., 1976. Mechanism of rat liver microsomal stearoyl-CoA desaturase. J. Biol. Chem. 25, 5095 – 5103. Folch, J., Lees, M., Stanley, G.H.S., 1957. A simple method for

220

M. Taniguchi et al. / Livestock Production Science 87 (2004) 215–220

the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 226, 487 – 509. Glimm, D., Dong, F., Kennelly, J., 2002. Bovine stearoyl-CoA desaturase gene structure and large scale SNP analysis. Unpublished. Kim, Y.C., Ntambi, J.M., 1999. Regulation of stearoyl-CoA desaturase genes: role in cellular metabolism and preadipocyte differentiation. Biochem. Biophys. Res. Commun. 266, 1 – 4. Martin, G.S., Lunt, D.K., Britain, K.G., Smith, S.B., 1999. Postnatal development of stearoyl coenzyme A desaturase gene expression and adiposity in bovine subcutaneous adipose tissue. J. Anim. Sci. 77, 630 – 636. Melton, S.L., Amiri, M., Davis, G.W., Backus, W.R., 1982. Flavor and chemical characteristics of ground beef from grass-, forage-, grain- and grain-finished steers. J. Anim. Sci. 55, 77 – 87. Oka, A., Iwaki, F., Dohgo, T., Ohtagaki, S., Noda, M., Shiozaki, T., Endoh, O., Ozaki, M., 2002. Genetic effects on fatty acid composition of carcass fat of Japanese Black Wagyu steers. J. Anim. Sci. 80, 1005 – 1011. O’Keefe, P.W., Wellington, G.H., Mattick, L.R., Stouffer, J.R., 1968. Composition of bovine muscle lipids at various carcass locations. J. Food Sci. 33, 188 – 192.

Sessler, A.M., Kaur, N., Palta, J.P., Ntambi, J.M., 1996. Regulation of stearoyl-CoA desaturase 1 mRNA stability by polyunsaturated fatty acid in 373-L1 adipocytes. J. Biol. Chem. 271, 29854 – 29858. Yang, A., Larsen, T.W., Powell, V.H., Tume, R.K., 1999a. A comparison of fat composition of Japanese and long-term grain-fed Australian steers. Meat Sci. 51, 1 – 9. Yang, A., Larsen, T.W., Smith, S.B., Tume, R.K., 1999b. D9 desaturase activity in bovine subcutaneous adipose tissue of different fatty acid composition. Lipids 34, 971 – 978. Yoshimura, T., Namikawa, K., 1983. Influence of breed, sex and anatomical location on lipid and fatty acid composition of bovine subcutaneous fat. Jpn. J. Zootech. Sci. 54, 97 – 105. Zembayashi, M., Nishimura, K., Lunt, D.K., Smith, S.B., 1995. Effect of breed type and sex on the fatty acid composition of subcutaneous and intramuscular lipids of finishing steers and heifers. J. Anim. Sci. 73, 3325 – 3332. Zhang, L., Lan, G.E., Parimoo, S., Stenn, K., Prouty, S.M., 1999. Human stearoyl-CoA desaturase: alternative transcripts generated from a single gene by usage of tandem polyadenylation sites. BioChem. J. 340, 255 – 264.