- Email: [email protected]
Different dietary fats impact on biochemical and histological parameters and gene expression of lipogenesis-related genes in rats
Food Bioscience 34 (2020) 100540
Contents lists available at ScienceDirect
Food Bioscience journal homepage: www.elsevier.com/locate/fbio
Different dietary fats impact on biochemical and histological parameters and gene expression of lipogenesis-related genes in rats
T
Fawzia H.R. Abd-Raboa, Fouad M.F. Elshaghabeea, Sally S. Sakra,b,∗, Nagwa I. El-Arabic, Shereen Abu El-Maatyc a
Dairy Science Department, Faculty of Agriculture, Cairo University, Giza, Egypt Department of Food Science and Human Nutrition, College of Agriculture and Veterinary Medicine, Qassim University, Qassim, Saudi Arabia c Genetics Department, Faculty of Agriculture, Cairo University, Giza, Egypt b
A R T I C LE I N FO
A B S T R A C T
Keywords: Dietary fats Bubalus bubalis milk Buffaloes' butter oil Shortening Margarine Lipogenesis-related genes
The effects of different types of dietary fats on some biochemical and histological parameters were investigated and gene expression of lipogenesis-related genes in rats was evaluated. Five groups of Wister rats were randomly selected. Rats in group 1 (control) were given only rodent chow. Rats in groups 2, 3, 4 and 5 were fed with rodent chow supplemented with 10% buffalo butter oil, buffalo butter oil solid fraction (S30), hydrogenated palm kernel oil shortening, and margarine, respectively. As a result of adding shortening (group 4), there was an increase in the rats’ weight and some of the serum biochemical parameters compared to the other experimental groups. Those increments were parallel to an increase in serum acetate of the same group. Histologically, photographs of the livers of rats in group 3 showed slight cytoplasmic vacuolization of centrilobular hepatocytes and asporadic cell necrosis. The livers of rats in group 4, however, showed activation of Kupffer cells, hydropic degeneration of hepatocytes and cytoplasmic vacuolization of centrilobular hepatocytes. The gene expression of sterol regulatory element-binding protein (SREBP) 1c and fatty acid synthase (FAS) showed that feeding rats with S30 and shortening led to an increase in SREBP-1c and FAS mRNA levels, thus indicating the activation of lipogenesis genes in the liver. Supplementing rat diets with margarine showed no changes in SREBP-1c and FAS mRNA levels compared with other treatments. In conclusion, diets with shortening or S30 resulted in an increase in weight gain, histopathological lesions, lipid profile levels changes and a significant up-regulation of SREBP-1c and FAS gene expression levels compared with butter oil and margarine.
1. Introduction Although dietary fat and oil are the main micronutrient sources that provide energy and fat-soluble vitamins for the human metabolic process (Sharma, Zhang, & Dwivedi, 2010), eating foods rich in saturated fat is directly related to hypercholesterolemia and obesity (Grunberger, 2011; WHO, 2013). Excessive consumption of high cholesterol foods also increases the risk of atherosclerosis and coronary heart diseases developments (Black, 1975). Many developing nations consume transrich partially hydrogenated vegetable fat or oil, which has been linked to metabolic and inflammatory risk factors and coronary heart diseases (Idris and Sundram, 2002). Many food companies prefer using trans fatty acids (FA) because of their palatability, stability and cost-effectiveness (Dias, Passos, Lopes, & Valente, 2015; Mensink, Zock, Kester, & Katan, 2003). On the other hand, oils rich in PUFA and MUFA may prevent cardiovascular diseases (Kris-Etherton, Hecker, Bonanome,
∗
Coval, Binkoski and Hilpert, 2002). The amount and type of fats in the diet have important effects on the heath of humans and their blood lipid profile. People with high levels of triglycerides, high low-density lipoprotein cholesterol (LDL-cholesterol) level and low high-density lipoprotein cholesterol (HDL-cholesterol) level, are more predisposed to health risks than those who are not (Sengupta, Gupta, Nadi, & Ghosh, 2013). Recently, the effect of dietary components on the transcription of cells and tissues (nutrigenomics) had been studied. Nutrigenomics refers to the influence of food constituents and dietary bio-actives on gene expression (Ayisi & Zhao, 2017; Kaput, Perlina, Hatipoglu, Bathelomew, & Nikolsky, 2007; Zheng, Pan, Huang, Ci, Zhao, & Yang, 2015). Gene expression studies are becoming important for free radical research and molecular nutrition (Dieck, Doring, Roth, & Daniel, 2003). Many different enzymes involved in glucose, cholesterol and lipid metabolism could be regulated by the SREBP
Corresponding author. Faculty of Agriculture, 12613 Giza, Egypt. E-mail addresses: [email protected], [email protected] (S.S. Sakr).
https://doi.org/10.1016/j.fbio.2020.100540 Received 23 February 2018; Received in revised form 31 January 2020; Accepted 31 January 2020 Available online 03 February 2020 2212-4292/ © 2020 Published by Elsevier Ltd.
Food Bioscience 34 (2020) 100540
F.H.R. Abd-Rabo, et al.
Table 1 The nucleotide sequences of primers used in RT-PCR. Name of the gene
Forward primer (5′ to 3′)
Reverse primer (5′ to 3′)
Amplicon-Length (bp)
SREBP-1c FAS β-actin
AGCCATGGATTGCACATTTG CGGCGAGTCTATGCCACTAT GACGAGGCCCAGAGCAAGAGA
GGTACATCTTTACAGCAGTG ACACAGGGACCGAGTAATGC GGGTGTTGAAGGTCTCAAACA
260 222 225
Table 2 Fatty acids relative distribution (%) of different dietary fats used in the formulation of different rodent's chow. Fatty acid
Fatty acid's name
Butter oil
Solid fraction of butter oil (S30)
Shortening
Margarine
C8:0 C10:0 C12:0 C14:0 C15:0 C16:0 C17:0 C18:0 C20:0 C14:1ω5 C16:3ω4 C18:1n9 C18:2ω4 C18:2n6 C18:3n3 C18:4ω3
Caprylic Capric Lauric Myristic Pentadecanoic Palmitic Heptadecanoic Stearic Arachidic Tetradecenoic Hexadecatrienoic Oleic – Linoleic Alfa-Linolenic Alfa-Octadecatetraenoic
0.33 1.33 2.02 10.6 2.20 34.6 1.11 12.3 ND 0.72 0.29 28.7 1.14 2.37 0.6 1.16
0.45 1.35 2.01 11.5 2.00 34.8 1.10 12.5 ND 0.28 0.27 28.1 1.22 2.16 0.51 1.01
ND ND 0.2 1.0 ND 43.8 ND 10.4 0.29 ND ND 38.00 ND 6.33 ND ND
3.42 3.16 43.5 12.5 ND 8.26 ND 18.8 0.15 ND ND 9.65 ND ND ND ND
99.4 64.5 3.68 60.8 34.9 29.7 5.27
99.1 65.6 3.81 61.8 33.5 28.6 4.90
99.9 55.6 0.2 55.4 44.2 37.9 6.33
99.9 90.3 50.4 39.9 9.65 9.65 ND
∑ fatty acids ∑SFA Shorter chain-SFA Long chain-SFA ∑UFA MUFA PUFA
SFA: Saturated Fatty Acids, UFA: Unsaturated Fatty Acids, Shorter chain-SFA: (C8–C12), Long chain-SFA: (C14–C18). ND: not detected.
Moreover, FAS is an important multifunctional enzyme required for FA synthesis (Muñoz et al., 2003). The concentration of FAS in a specific tissue is affected by a number of hormonal and dietary factors that are important to determine the maximal capacity of a tissue to synthesize FA using the de novo pathway (Clarke, 1993). Also, positive correlations were found between the FAS mRNA expression level and the body fat content in animals (Mildner & Clarke, 1991). Therefore, the present study is designed to study whether adding different types of dietary fats can positively or negatively modulate some histological and biochemical parameters in a rat model. This research also aimed to evaluate the gene expression of lipogenesis-related genes SREBP-1c and FAS in the liver tissues of rats. 2. Materials and methods
Fig. 1. Body weight of animal groups during 6 wk of intervention. Group 1 (control): Rats were fed rodent chow, Group 2: Rats were fed rodent chow supplemented with 10% of butter oil, Group 3: Rats were fed rodent chow supplemented with 10% of solid fraction (S30) of butter oil, Group 4: Rats were fed rodent chow supplemented with 10% of shortening, Group 5: Rats were fed rodent chow supplemented with 10% of margarine.*A, B, C and D: Different letters represent significant differences between each parameter (P ≤ 0.05), i.e. same letters mean no significant difference between each parameter as assessed using the general linear model (GLM).
2.1. Materials One day post-milking un-salted butter from Bubalus bubalis (Egyptian buffalo) milk was obtained from the Dairy Science Department, Faculty of Agriculture, Cairo University. The fresh butter was subsequently used to prepare the solid fraction (S30). Shortening (hydrogenated palm kernel oil with polyunsaturated fats that had been converted to saturated fats) and margarine made of palm oil, which are both used in bakery products (PT. Sinar Meadow International, Jakarta, Indonesia) was purchased from an Egyptian local market.
(sterol regulatory element-binding protein). Three SREBP isomers have been identified, and they include SREBP-1a, -1c and −2. While SREBP1c and −2 are involved in regulating FA and cholesterol biosynthesis, respectively, SREBP-1a is involved in both processes. SREBP is synthesized as inactive precursors and activated by serial proteolytic cleavages. Gosmain et al. (2005) said that SREBP-1c was one of the main factors that led to the nutritional regulation of lipogenesis.
2.2. Preparation of butter oil and its solid fraction (S30) The dry fractionation of fresh buffalo butter was done by heating the butter to 60 °C. Then, anhydrous sodium sulphate (Sigma-Aldrich, 2
Food Bioscience 34 (2020) 100540
F.H.R. Abd-Rabo, et al.
Table 3 Levels of some serum biochemical parameters (U/L) after 6wk of intervention. Parameters LDL-cholesterol HDL-cholesterol Triglycerides Total cholesterol AST ALT Uric Acid Creatinine Urea Glucose
Group 1
Group 2 c
0.73 ± 0.12 0.38 ± 0.24a 0.96 ± 0.1c 1.3 ± 0.1b 2.2 ± 0.2a 2.1 ± 0.3a 3.6 ± 0.3b 0.69 ± 0.09b 0.23 ± 0.01c 0.07 ± 0.05c
Group 3 c
Group 4 b
0.76 ± 0.1 0.34 ± 0.03b 0.90 ± 0.12c 1.3 ± 0.1b 2.9 ± 0.3a 3.0 ± 0.7a 3.4 ± 0.3b 0.62 ± 0.07b 0.21 ± 0.02c 0.07 ± 0.06c
1.4 ± 0.2 0.37 ± 0.1a 1.7 ± 0.1b 2.1 ± 0.2a 2.7 ± 0.5a 3.0 ± 0.4a 3.7 ± 0.4b 0.71 ± 0.12a 0.29 ± 0.04a 1.1 ± 0.1c
Group 5 a
1.7 ± 0.1 0.31 ± 0.01b 1.9 ± 0.1a 2.4 ± 0.3a 3.2 ± 0.4a 3.0 ± 0.4a 4.1 ± 0.3a 0.82 ± 0.11a 0.31 ± 0.03a 1.6 ± 0.2a
0.79 ± 0.2c 0.4 ± 0.05a 1.0 ± 0.1c 1.4 ± 0.2b 2.8 ± 0.4a 2.9 ± 0.5a 3.6 ± 0.4b 0.63 ± 0.11b 0.26 ± 0.05b 1.3 ± 0.1b
Group 1: Rats were fed rodent chow, Group 2: Rats were fed rodent chow supplemented with 10% of butter oil, Group 3: Rats were fed rodent chow supplemented with 10% of solid fraction (S30) of butter oil, Group 4: Rats were fed rodent chow supplemented with 10% of Shortening, Group 5: Rats were fed rodent chow supplemented with 10% of margarine. a, b and c: Different letters represent significant differences between each parameters (P ≤ 0.05), i.e., same letters mean no significant difference between each parameter using the general linear model (GLM).
The body weight of rats was measured weekly.
Egyptian International Centre for Import, Cairo, Egypt) was added. After that, filter paper Whatman No. 1 (Middle East Co. for Chemicals, Cairo, Egypt) was used. Then, the pure fat (butter oil) was reheated (60 °C) to destroy the crystal memory and was cooled to 30 °C using a circulating water bath (Labcompare, San Francisco, CA, USA). After that, it was held at 30 °C for 6 h with constant stirring (60–80 rpm). Finally, the Whatman No. 1 filter paper in a Buchner funnel with mild suction was used to separate the solid fraction (S30) from the filtrate (liquid fraction).
2.5. Blood collection After 6 wk, animals were anesthetized with ether, and blood samples were collected without anticoagulant from the retro-orbital Venus plexus. Blood samples of all treatments were centrifuged at 4000×g (2300 rpm in the Hermle Labortechnik GmbH, Wehingen, Germany centrifuge with SER. #220.72, Type 09/144 rotor) at room temperature (22–25 °C) for 10 min. Also, separated serum was stored in Eppendorf (2 mL) vials in the freezer at −18 °C for maximum of 7 days before the biochemical analysis.
2.3. FA profile analysis FA methyl esters (FAME) profile was done in the Food Safety and Quality Control Lab (FSQC), Faculty of Agriculture, Cairo University, (Cairo, Egypt). The FAME were prepared according to AOAC official method 969.33 (2012), and separated using the gas-liquid chromatography (Hewlett Packard Model 6890 chromatograph, San Diego, CA, USA). The separation process was done on an INNOWax capillary column (polyethylene glycol, Model No. 19095 N-123, 240 °C maximum, 30.0 m × 530 μm x 1.0 μm, Agilent, Santa Clara, CA, USA). The carrier gas was nitrogen (15 mL min−1). The injector and detector temperatures were held at 280 °C. The column temperature was programmed as follows: initial oven temperature at 100 °C for 10 min, then increased to 240 °C at 10 °C min−1 and maintained for 10 min, and finally increased to 280 °C, hydrogen flow rate 30 mL min−1 and air flow rate 300 mL min−1. The relative percentage of FAME was determined using an area normalization method with a standard of FAME as a reference.
2.6. Determination of biochemical parameters in serum samples The spectrophotometer (Shimadzu UV-1900, Tokyo, Japan) was used to determine the serum alanine transaminase (ALT), aspartate aminotransferase (AST), triglycerides, total cholesterol, LDL-cholesterol, HDL-cholesterol, creatinine and uric acid using commercial kits (Thermo Fisher Scientific Co., Passau, Germany). The methods for determination were according to the instruction document for each kit. In brief, a colorimetric method depending on transferring the amino group from the sample to the carbon atom on the 2-oxoglutarate and forming pyruvate and oxaloacetate was used to determine ALT and AST, respectively, according to Reitman and Frankel (1957) and the detections were done at 340 nm. Triglycerides were detected using a simplified enzymatic procedure based on previously reported methods (Fossati & Prencipe, 1982; McGowan, Artiss, Strandbergh, & Zak, 1983); in which lipase was used to hydrolyze TG and produce glycerol which is phosphorylated by adenosine triphosphate with glycerol kinase in a system generates hydrogen peroxide and the red-colored dye appeared was detected at 570 nm. Total cholesterol, LDL-cholesterol and HDL-cholesterol were measured using an enzyme assay method. In which cholesterol oxidase-amino antipyrine for Total cholesterol determination and 2,4,6-tribromo-3-hydroxybenzoic acid for HDL-cholesterol determination were used as previously described (Allain, Poon, Chan, Richmond, & Fu, 1974; Bachorik & Albers, 1986; Roeschlau, Bernt, & Gruber, 1974) and the detections were done at 546 nm. In an alkaline solution, the level of creatinine reacts with picric acid and the level of uric acid reduces the phosphotungstic acid were determined as previously described by Elhardallou, Babiker, Sulieman, and Gobouri (2015) and the absorbance was readied at 495 and 700 nm for creatinine and uric acid, respectively. For glucose, a serum drop was put on the test zone of a strip for immediate measurement of glycemia with a Glucotrend device (Boehringer, Mannheim, Germany).
2.4. Animals and feeding protocol Forty male weaned Wistar rats 50 g; initially 3 wk old (Wistar Han IGS, Strain code: 273 Charles Rivers, San Francisco, CA, USA) were obtained from the animal house at Research Institute of Ophthalmology, (Giza, Egypt). Animal care and experimentation were done according to the guidelines for animal care recommended by the local experimental ethics committee of the same research institute. Rats were housed individually in micro-isolator plastic cages and fed with rodent chow composed of 60% corn starch, 20% casein, 10% dietary fat, 5% cellulose, 4% salt mixture and 1% vitamins mixture (Miladco Co., Giza, Egypt) and given water ad libitum for 2 wk until they reached 1.0 ± 0.5g in ambient temperature (22 ± 2 °C) and humidity (50 ± 5%) with a 12 h light-dark cycle. Afterwards, the rats were randomly categorized into 5 groups (8 rats/group). Rats in group 1 (control) were given only rodent chow. Rats in groups 2, 3, 4, and 5 were fed with rodent chow supplemented with 10% of buffalo butter oil, 10% of the solid fraction of the butter oil at 30 °C (S30), 10% shortening, and 10% margarine, respectively, for 6 wk of intervention. 3
Food Bioscience 34 (2020) 100540
F.H.R. Abd-Rabo, et al.
Fig. 2. Rat liver microscopic photographs (H&E stain) from different groups (X 400). Group 1: Rats were fed rodent chow, Group 2 (2-a and 2-b): Rats were fed rodent chow supplemented with 10% of butter oil, Group 3 (3-a and 3-b): Rats fed rodent chow supplemented with 10% of solid fraction (S30) of butter oil, Group 4 (4-a and 4-b): Rats were fed rodent chow supplemented with 10% of shortening, Group 5 (5-a and 5-b): Rats were fed rodent chow supplemented with 10% of margarine.
Germany) equipped with a Rezex@ ROA-organic acid H+ ion exchange column (Phenonmenex Inc., Torrance, CA, USA) at 65 °C was used to measure the levels of acetate, propionate and butyrate in serum. The binary pump flow rate was set at 0.6 mL min−1, the UV detector was set at 214 nm, and the mobile phase was 0.0065 M H2SO4 (Elshaghabee et al., 2016).
2.7. Determination of acetate, propionate and butyrate levels in serum Each serum sample was mixed with 25 μL Carrez I and 25 μL Carrez II solution and then centrifuged at 3000×g (1750 rpm) at 4 °C for 15 min. The supernatant was filtered with a 0.45 μm PTEF syringe membrane filter (Millipore, Bedford, MA, USA). High-performance liquid chromatography (HPLC, Agilent 1260 series, Knauer, Berlin, 4
Food Bioscience 34 (2020) 100540
F.H.R. Abd-Rabo, et al.
where ΔCttarget is for the target sample (experiment) and ΔCtreference is for the reference sample (control) The program was started with initial denaturation at 94 °C for 15 min, then 40 cycles of denaturation at 94 °C for 45 s, followed by annealing at 62, 62 and 55 °C for 45 s (SREBP-1c, β-actin and FAS genes, respectively), and followed by an extension at 72 °C for 45 s. The analyses were done using the CFX384 Thermocycler from Bio-Rad (BioRad Laboratories, Inc., Hercules, CA, USA). The comparative Ct (ΔΔCt) was measured by subtracting ΔCt of calibrator from ΔCt of treated samples. Relative expression fold changes were also calculated by using formula 2−ΔΔCT which was proposed by Livak and Schmittgen (2001) and calculated as: ΔΔCt = ΔCttarget ΔCtreference. To determine the significance (P ≤ 0.05) between the mean differences of the groups, the independent unpaired student's t-test was used the Statistical Package for the Social Sciences version 23 (SPSS, IBM, Armonk, NY, USA).
Table 4 Mean values of levels of serum acetate, propionate and butyrate (μg/mL) after 6 wk of intervention. Parameter
Acetate Propionate Butyrate
Animal Groups Group 1
Group 2
Group 3
Group 4
Group 5
0.4 ± 0.1 0.4 ± 0.1 ND
3.9 ± 0.5 0.3 ± 0.2 0.1 ± 0.1
4.6 ± 0.4 0.1 ± 0.1 ND
5.9 ± 0.6 0.1 ± 0.01 ND
2.4 ± 0.4 0.8 ± 0.3 0.6 ± 0.3
Group 1: Rats were fed rodent chow, Group 2: Rats were fed rodent chow supplemented with 10% of butter oil, Group 3: Rats were fed rodent chow supplemented with 10% of solid fraction (S30) of butter oil, Group 4: Rats were fed rodent chow supplemented with 10% of Shortening, Group 5: Rats were fed rodent chow supplemented with 10% of margarine. ND: not detected.
2.8. Histological examination and grading of the histopathological lesions 2.10. Data analysis Tissue specimens from liver were collected from the 5 rats from each group and fixed in 10% buffered formalin. After that, they were processed using a routine paraffin embedding technique in which they were sectioned at ~5 μm thickness and stained with Hematoxylin and Eosin (H&E) (Bancroft, Stevens, & Turner, 1996). The grading of the histopathological lesions was carried out according to the technique used by Arsad, Esa, and Hamzah (2014) in which (0), (1), (2), and (3) indicated no changes, mild, moderate and severe changes, respectively.
Samples of serum were subjected to triplicate analyses. The mean and standard deviations of triplicates are shown. Statistics using the analysis of variance (ANOVA) version 6.04 and Duncan tests with the Statistical Analysis System (SAS Institute Inc., Cary, NC., USA). A probability of (P ≤ 0.05) was used to establish the statistical significance. The real-time polymerase chain reaction was done in three wells (replicates) for all genes. 3. Results and discussion
2.9. RNA extraction and real-time-PCR analysis
This study was done to evaluate the impact of different dietary fats on biochemical and histological parameters and gene expression of lipogenesis-related genes in vitro. The dietary fats were evaluated for their FA composition, and they are shown in Table 2.
The total RNA was isolated from 100 mg of frozen liver tissue using the RNA extraction kit (Cat No. Z3100, Promega, Madison, WI, USA) according to the manufacturer's instructions. Frozen liver tissues were homogenized in RNA lysis buffer (RLA). Then the samples were transferred to fresh tubes and RNA dilution buffer was added. After centrifugation at 20.100×g (12000 rpm in the Eppendorf, rolling cabinet 5804/5804 R, centrifuge, Hamburg, Germany) at 4 °C for 10 min. Then samples were transfer to fresh tubes and 95% ethanol was added. The supernatant was transferred to a spin column and centrifuged at 20.100×g for 1 min. The RNA was washed with RNA wash solution (RWA). DNase stop solution (DSA) was added. One min later the RNA was eluted into an elution tube. Then, the total RNA was reversed and transcribed to cDNA using the Go Script™ Reverse Transcription System Kit (Cat No. A5000, Promega). The real-time polymerase chain reaction (RT-PCR) was used to measure messenger RNA expression levels of both genes (FAS and SREBP-1c) in the liver tissue using a qPCR kit (Cat No. A6001, Promega). Primer (10 pmol) sequences are shown in Table 1. The βactin gene was used as a reference gene. The relative expression fold changes using formula 2−ΔΔCT which includes the control value using Equation (1): ΔΔCt = ΔCttarget - ΔCtreference
3.1. Effects of some dietary fats on weight gain At the baseline, the average weight of rats was ~110 g with no significant differences between all groups (Fig. 1). During the 6 wk of intervention, weight gain of rats fed with added 10% of shortening (group 4) was significantly increased (P ≤ 0.05) and they started to gain weight at a faster rate compared with rats in group 1 (control) and in other experimental groups. In the cat model, cats fed with diets supplemented with shortening resulted in an increase in body weight and adiposity during the period of intervention (Collison et al., 2011). At the end of the intervention period, weight gain of rats in group 3 was significantly increased compared with rats in group 2. Results obtained by Asselin et al. (2004) showed that feeding guinea pigs a diet supplemented with modified milk fat separated at 30 and 40 °C resulted in a significant increase in weight gain and the plasma lipid profile compared to pigs in the control group. Finally, rats in group 2 did not differ from rats in group 5 in terms of weight gain. These results are consistent with the findings of Judd et al. (1998) who determined that
(1)
Table 5 Grading of the histopathological lesions seen in rat's livers from different groups. Histopathological lesions
Group 1
Group 2
Group 3
Group 4
Group 5
Activation of Kupffer cells Hydropic degeneration of hepatocytes Cytoplasmic vacuolization of centrilobular hepatocytes Sporadic cell necrosis Total scorea
0 0 0 0 0
0 1 0 0 1
1 0 1 1 3
1 1 2 1 5
0 0 0 0 0
Group 1: Rats were fed rodent chow, Group 2: Rats were fed rodent chow supplemented with 10% of butter oil, Group 3: Rats were fed rodent chow supplemented with 10% of solid fraction (S30) of butter oil, Group 4: Rats were fed rodent chow supplemented with 10% of Shortening, Group 5: Rats were fed rodent chow supplemented with 10% of margarine. a 0: normal (no change), 1: mild, 2: moderate, 3: severe. 5
Food Bioscience 34 (2020) 100540
F.H.R. Abd-Rabo, et al.
Fig. 3. The effect of dietary fats on the expression levels of some lipogenesis genes. The qRT-PCR analysis results to measure the relative mRNA expression levels of FAS and SREBP-1c genes of rat livers fed with different dietary fats. Bars represent mean values ± standard error. The number of samples = 4.
3.3. Effect of some dietary fats on histological parameters
when the FA profile was controlled in the margarine and consumed in place of butter, and presumably in place of other fats high in SFA, appreciable improvement in the blood lipid profile of the major lipoproteins can be expected for most people.
The histopathological lesions of rats liver were examined and graded. Data are shown in Fig. 2 and Table 5. The livers of rats from group 1 showed the normal histological structure of the hepatic lobule. Group 2 showed no histopathological changes (2-a) even though a few sections from the same group indicated mild hydropic degeneration of hepatocytes (2-b). Mild cytoplasmic vacuolization of centrilobular hepatocytes, mild sporadic cell necrosis and activation of Kupffer aclls were seen in group 3 (3-a and 3-b photos). The livers of rats from group 4 showed cytoplasmic vacuolization (fatty change) of centrilobular hepatocytes, sporadic cell necrosis, mild activation of Kupffer cells and hydropic degeneration of hepatocytes (4-a and 4-b photos). However, the livers of rats from group 5 showed no histopathological changes. The previous results indicated that the type and composition of fats in the diet have an important effect on the rats’ liver. The supplementation of diet with shortening increased the level of fatty changes in liver tissues. Severe histopathological lesions (a total score of 5) in the shortening group (group 4), compared with other experimental groups (Table 5), were observed.
3.2. Effect of some dietary fats on biochemical parameters Among the 5 groups (Table 3), the lowest concentration of triglycerides and cholesterol was observed in group 2. This group showed a significant difference in weight gain compared to groups 3 and 4. Although there are slight differences in the FA distribution between butter oil and S30 as shown in Table 2, there were differences in the levels of LDL-cholesterol, triglyceride and cholesterol in group 3 compared with that in group 2 (Table 3). This may be because the S30 is rich in long chain SFA, especially in palmitic and stearic acids (C16 and C18), as reported by many researchers (Oversesen, Leth, & Hansen, 1998; Rabar, Harker, O’Flynn, & Wierzbicki, 2014). Lai, Lasekan, Monsma, and Ney (1995) studie's on rats showed that high melting fractions led to plasma lipid profile similar to the palm oil diet. They also reported that trans UFA with a higher melting point than their cis isomers are usually partitioned into the higher melting fraction. These results suggested that changes in the triglyceride and FA composition of butter may change its nutritional profile. These results were consistent with the results of Saravanan, Haseeb, Ehtesham, and Ghafoorunissa (2005) who reported that SFA (high in the butter oil and S30) are less atherogenic than trans FA (high in the shortening). Rats that were given rodent chow supplemented with 10% shortening showed a lipid profile that was affected by the lipid source and the partially hydrogenated oil had a hypercholesteraemic effect (Table 3). Idris and Sundram (2002) mentioned that the trans FA, produced during the partially hydrogenation process, were considered a risk factor for coronary heart diseases and associated with total cholesterol, LDL-cholesterol and triglycerides increments as well as low HDL-cholesterol levels. No significant variations for serum AST and serum ALT levels were observed among all the groups. Uric acid was also less affected by supplementing the diet. The highest concentration of creatinine and urea was observed in rats fed with S30 and shortening. The level of serum glucose was the highest in the rats fed 10% shortening.
3.4. Effect of some dietary fats on the level of acetate, propionate and butyrate in serum Shortening is a major source of trans FA, and a diet that contains high levels of trans FA have been shown to increase levels of plasma LDL-cholesterol and reduce levels of HDL-cholesterol which may increase the risks of cardiovascular diseases (Crupkin & Zambelli, 2008; Takeuchi & Sugano, 2017). Table 4 shows an increase in the serum-acetate level in rats fed with shortening (group 4) compared with other groups. This increase in serum acetate is associated with an increase in the total cholesterol (see Table 3) and the body weight of the same group (see Fig. 1). Acetate is the most abundant short-chain FA in the colon (Juárez-Hernández, Chávez-Tapia, & Barbero-Becerra, 2016), and it acts as a substrate for hepatic cholesterol synthesis and de novo lipogenesis, thus resulting in an increase in plasma cholesterol (Wong, de Souza, Kendall, Emam, & Jenkins, 2006). Levels of propionate varied among different tested groups. High levels of serum propionate were observed in rats’ serum of 6
Food Bioscience 34 (2020) 100540
F.H.R. Abd-Rabo, et al.
Acknowledgment
groups 1, 2 and 5. An increase of propionate was associated with a low plasma cholesterol level (Al-Lahham, Peppelenbosch, Roelofsen, Vonk, & Venema, 2010; Hara, Haga, Aoyama, & Kiriyama, 1999). Moreover, Morrison and Preston (2016) explained the role of short chain FA in human metabolism; they reported that there was a significant reduction in propionate compared to acetate in the liver. In groups 2 and 5, the levels of butyrate were associated with a decrease in body weight of rats compared to rats in group 4 (Fig. 1). Juárez-Hernández et al. (2016) noted that butyrate improved thermogenesis and energy expenditure, which in turn reduced body weight. Also, the results in Table 4 showed that the diet rich in the S30 or shortening suppressed the formation of butyrate. Results obtained by Jakobsdottir, Xu, Molin, Ahrne, and Nyman (2013) also showed that rats fed high-fat diets containing trans FA reduced the formation of plasma butyrate.
Authors thank the Faculty of Agriculture, Cairo University for funding this research. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.fbio.2020.100540. References Achliya, G. S., Barabde, U., Wadodkar, S., & Dorle, A. (2004). Effect of Bramhi Ghrita, a polyherbal formulation on learning and memory paradigms in experimental animals. Indian Journal of Farmachology, 36, 159–162. Al-Lahham, S. H., Peppelenbosch, M. P., Roelofsen, H., Vonk, R. J., & Venema, K. (2010). Biological effects of propionic acid in humans; metabolism, potential applications and underlying mechanisms. Biochimica et Biophysica Acta, 1801, 1175–1183. Allain, C. C., Poon, L. S., Chan, C. S., Richmond, W., & Fu, P. C. (1974). Enzymatic determination of total serum cholesterol. Clinical Chemistry, 20, 470–475. AOAC (2012). Chapter 41: 19-20.Official methods of analysis of the association of official analytical chemist (17th ed.). Gaithersburg, MD, USA, 969.3 and 991.39. Fatty acids in oils and fats preparation of methyl ester boron trifluoride-AOAC-IUPAC method Codex-adopted-AOAC Method. Arsad, S. S., Esa, N. M., & Hamzah, H. (2014). Histopathologic changes in liver and kidney tissues from male Sprague Dawley rats treated with Rhaphidophora Decursiva (Roxb.) Schott extract. Journal of Cytology & Histology, S4. https://doi.org/10.4172/21577099.S4-001 001-6. Asselin, G., Lavigne, C., Bergeron, N., Angers, P., Belkacemi, K., Arul, J., et al. (2004). Fasting and postprandial lipid response to the consumption of modified milk fats by Guinea pigs. Lipids, 39, 985–992. Ayisi, C. L., & Zhao, J. L. (2017). Fatty acid composition, lipogenic enzyme activities and mrna expression of genes involved in the lipid metabolism of Nile tilapia fed with palm oil. Turkish Journal of Fisheries and Aquatic Sciences, 17, 405–415. Bachorik, P. S., & Albers, J. J. (1986). Precipitation methods for quantification of lipoproteins. Methods in Enzymology, 129, 78–100. Bancroft, J. D., Stevens, A., & Turner, D. R. (1996). Theory and practice of histopathological techniques. New York: Churchill Livingstone. Black, R. G. (1975). Partial crystallization of milk fat and separation of fractions by vacuum filtration. Australian Journal of Dairy Technology, 30, 153–156. Clarke, S. D. (1993). Regulation of fatty acid synthase gene expression: An approach for reducing fat accumulation. Journal of Animal Science, 71, 1957–1965. Collison, K. S., Zaidi, M. Z., Saleh, S. M., Inglis, A., Mondreal, R., Makhoul, N. J., et al. (2011). Effect of trans-fat, fructose and monosodium glutamate feeding on feline weight gain, adiposity, insulin sensitivity, adipokine and lipid profile. British Journal of Nutrition, 106, 218–226. Crupkin, M., & Zambelli, A. (2008). Detrimental impact of trans fats on human health: Stearic acid-rich fats as possible substitutes. Comprehensive Reviews in Food Science and Food Safety, 7, 271–279. Dias, F. S., Passos, C. M., Lopes, D. O. M. L., & Valente, V. (2015). Fatty acid profile of biscuits and salty snacks consumed by Brazilian college students. Food Chemistry, 171, 351–355. Dieck, H. T., Doring, F., Roth, H., & Daniel, H. (2003). Changes in rat hepatic gene expression in response to zinc deficiency as assessed by DNA arrays. Journal of Nutrition, 133, 1004–1010. Elhardallou, S. B., Babiker, W. A. M., Sulieman, A. M. E., & Gobouri, A. A. (2015). Effect of diet supplementation with food industry by-products on diabetic rats. Food and Nutrition Sciences, 6, 875–882. Elshaghabee, F. M. F., Bockelmann, W., Meske, D., de Vrese, M., Walte, H.-G., Schrezenmeir, J., et al. (2016). Ethanol production by selected intestinal microorganisms and lactic acid bacteria growing under different nutritional conditions. Frontiers in Microbiology, 7, 47. Fossati, P., & Prencipe, L. (1982). Serum triglycerides determined calorimetrically with an enzyme that produces hydrogen peroxide. Clinical Chemistry, 28, 2077–2080. Gosmain, Y., Dif, N., Berbe, V., Loizon, E., Rieusset, J., Vidal, H., et al. (2005). Regulation of SREBP-1 expression and transcriptional action on HKII and FAS genes during fasting and refeeding in rat tissues. Journal of Lipid Research, 46, 697–705. Grunberger, G. (2011). Do we need a fasting lipid profile to assess cardiovascular risk? Journal of Diabetes, 3, 172–173. Hara, H., Haga, S., Aoyama, Y., & Kiriyama, S. (1999). Short-chain fatty acids suppress cholesterol synthesis in rat liver and intestine. Journal of Nutrition, 129, 942–948. Idris, C. A., & Sundram, K. (2002). Effect of dietary cholesterol, trans and saturated fatty acids on serum lipoproteins in non-human primates. Asia Pacific Journal of Clinical Nutrition, 11, 408–415. Jakobsdottir, G., Xu, J., Molin, G., Ahrne, S., & Nyman, M. (2013). High-fat diet reduces the formation of butyrate, but increases succinate, inflammation, liver fat and cholesterol in rats, while dietary fiber counteracts these effects. PloS One, 8, e80476. https://doi.org/10.1371/journal.pone.0080476. Juárez-Hernández, E., Chávez-Tapia, C. N., & Barbero-Becerra, V. J. (2016). Role of bioactive fatty acids in nonalcoholic fatty liver disease. Nutrition Journal, 15, 72–81. Judd, J. T., Baer, D. J., Clevidence, B. A., Muesing, R. A., Chen, S. C., Weststrate, J. A., et al. (1998). Effects of margarine compared with those of butter on blood lipid
3.5. Gene expression of lipogenesis-related genes in the liver as affected by different dietary fats The expression of lipogenesis genes in the liver tissues (Fig. 3) showed a significant decrease (P ≤ 0.05) in the mRNA expression levels of SREBP-1c and FAS by the addition of butter oil to the diet. On the other hand, the 30S and shortening treatments led to a significant increase in expression levels of SREBP-1c and FAS genes for the butter oil treatment (P ≤ 0.05). It was also noted that the administration of margarine did not significantly (P > 0.05) affect mRNA expression levels of SREBP-1c and FAS genes compared with levels found in the other treatments (P ≤ 0.05). In this study, lipogenesis response genes, especially SREBP-1c, were significantly higher (P ≤ 0.05) and showed the quickest response to feeding with 30S and shortening. SREBP-1c is considered one of the important transcription factors involved in the nutritional induction of lipogenic enzyme genes (Gosmain et al., 2005). Also, both lipogenic transcription factors, PPAR and SREBP-1c, were expressed in the retroperitoneal depot compared with the mesenteric and the inguinal depots (Palou et al., 2009). Moreover, SREBP-1c, FAS, and glycerol-3-phosphate acyltransferases (GPAT) gene expression involved in the liver lipogenesis decreased after 4 h fasting, but the 3 h refeeding after 8 h fasting led to a significant increase in SREBP-1c and GPAT mRNA levels in the liver (Palou et al., 2008). Ayisi and Zhao (2017) concluded that FAS, acetyl-CoA carboxylase (ACC), steroyl-CoA desaturase (SCD) 1, ATP citrate lyase (ACYL), carnitine palmitoyltransferase (CPT) Ia and CPT Ib were significantly increased when feeding tilapia with palm oil (P ≤ 0.05). Furthermore, there was a significant/positive correlation between the expression of ACYL mRNA and dietary palm oil and/or liver tissue FA with FAS, ACC, and SCD1. 4. Conclusion The amount, type and composition of lipids in the diet have an important effect on the body weight and serum lipid profile. Reports of the dietary intakes of butter oil or margarine are consistent with the beneficial effects than of the solid fraction of butter oil (S30) and shortening. These positive results support the beneficial effect of ghee (butter oil) outlined in the ancient Ayurveda texts and the therapeutic use of ghee for thousands of years in the Ayurveda system of medicine as mentioned by many authors (Achliya, Barabde, Wadodkar, & Dorle, 2004; Sharma et al., 2010). In addition, supplementing rats’ diet with S30 or shortening resulted in a significant up-regulation of SREBP-1c and FAS gene expression levels. While, the administration of margarine did not significantly (P > 0.05) affect mRNA expression levels of SREBP-1c and FAS genes. Declaration of competing interest The authors confirm that they have no conflicts of interest with respect to the work described in this manuscript. 7
Food Bioscience 34 (2020) 100540
F.H.R. Abd-Rabo, et al.
tissue and liver in response to fasting. European Journal of Physiology, 456, 825–836. Palou, M., Sanchez, J., Priego, T., Rodriguez, A. M., Pico, C., & Palou, A. (2009). Gene expression patterns in visceral and subcutaneous adipose depots in rats are linked to their morphologic features. Cellular Physiology and Biochemistry, 24, 547–556. Rabar, S., Harker, M., O'Flynn, N., & Wierzbicki, A. S. (2014). Lipid modification and cardiovascular risk assessment for the primary and secondary prevention of cardiovascular disease: Summary of updated NICE guidance. British Medical Journal, 349, 43–56. Reitman, S., & Frankel, S. (1957). A colorimetric method for the determination of serum glutamic oxalacetic and glutamic pyruvic transaminases. American Journal of Clinical Pathology, 28, 56–63. Roeschlau, P., Bernt, E., & Gruber, W. A. (1974). Enzymatic determination of total cholesterol in serum. Journal of Clinical Chemistry & Clinical Biochemistry, 12, 226. Saravanan, N., Haseeb, A., Ehtesham, N. Z., & Ghafoorunissa (2005). Differential effects of dietary saturated and trans-fatty acids on expression of genes associated with insulin sensitivity in rat adipose tissue. European Journal of Endocrinology, 153, 159–165. SAS (2004). SAS user's guide: Statistics (4th ed.). Cary, NC.,USA: SAS Inst. IncVersion 6.04. Sengupta, A., Gupta, S. S., Nadi, I., & Ghosh, M. (2013). Conjugated linoleic acid nanoparticles inhibits hypercholesterolemia induced by feeding high fat diet in male albino rats. Journal of Food Science & Technology, 52, 458–464. Sharma, H., Zhang, X., & Dwivedi, C. (2010). The effect of ghee (clarified butter) on serum lipid levels and microsomal lipid peroxidation. Ayu, 31, 134–140. Takeuchi, H., & Sugano, M. (2017). Industrial trans fatty acids and serum cholesterol: The allowable dietary level. Journal of Lipids. https://doi.org/10.1155/2017/9751756. Wong, J. M., de Souza, R., Kendall, C. W., Emam, A., & Jenkins, D. J. (2006). Colonic health: Fermentation and short chain fatty acids. Journal of Clinical Gastroenterology, 40, 235–243. World Health Organization (2013). Cardiovascular diseases (CVDs), media Centre, fact sheet, 317. Geneva: WHO. Zheng, Y., Pan, S., Huang, Y., Ci, L., Zhao, R., & Yang, X. (2015). Breed-specific lipid related gene expression in the subcutaneous fat of large white and Erhualian pigs at weaning. Archives of Animal Breeding, 58, 33–41.
profiles related to cardiovascular disease risk factors in normolipemic adults fed controlled diets. American Journal of Clinical Nutrition, 68, 768–777. Kaput, J., Perlina, A., Hatipoglu, P. B., Bathelomew, A., & Nikolsky, Y. (2007). Nutrigenomics: Concept and application to pharmacogenomics and clinical medicine. Pharmacogenomics, 8, 369–390. Kris-Etherton, P. M., Hecker, K. D., Bonanome, S. M., Coval, A. E., Binkoski, K. F., Hilpert, A. E., et al. (2002). Bioactive compounds in foods: Their role in the prevention of cardiovascular disease and cancer. The American Journal of Medicine, 113, 71–88. Lai, H. C., Lasekan, J. B., Monsma, C. C., & Ney, D. M. (1995). Alteration of plasma lipids in the rat by fractionation of modified milk fat (butter fat). Journal of Dairy Science, 78, 794–803. Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods, 25, 402–408. McGowan, M. W., Artiss, J. D., Strandbergh, D. R., & Zak, B. (1983). A peroxidase-coupled method for the colorimetric determination of serum triglycerides. Clinical Chemistry, 29, 538–542. Mensink, R. P., Zock, P. L., Kester, A. D., & Katan, M. B. (2003). Effects of dietary fatty acids and carbohydrates on the ratio of serum total to HDL cholesterol and on serum lipids and apolipoproteins: A meta-analysis of 60 controlled trials. American Journal of Clinical Nutrition, 77, 1146–1155. Mildner, A. M., & Clarke, S. D. (1991). Porcine fatty acid synthase: Cloning of a complementary DNA, tissue distribution of its mRNA and suppression of expression by somatotropin and dietary protein. Journal of Nutrition, 121, 900–907. Morrison, D. J., & Preston, T. (2016). Formation of short chain fatty acids by gut microbiota and their impact on human metabolism. Gut Microbes, 7, 189–200. Muñoz, G., Óvilo, C., Noguera, J. L., Sánchez, A., Rodríguez, C., & Silió, L. (2003). Assignment of the fatty acid synthase (FASN) gene to pig chromosome 12 by physical and linkage mapping. Animal Genetics, 34, 234–235. Oversesen, L., Leth, T., & Hansen, K. (1998). Fatty acid composition and contents of trans monounsaturated fatty acids in frying fats, and in margarines and shortenings marketed in Denmark. Journal of the American Oil Chemists Society, 75, 1079–1083. Palou, M., Priego, T., Sánchez, J., Villegas, E., Rodríguez, A. M., Palou, A., et al. (2008). Sequential changes in the expression of genes involved in lipid metabolism in adipose
8
Contents lists available at ScienceDirect
Food Bioscience journal homepage: www.elsevier.com/locate/fbio
Different dietary fats impact on biochemical and histological parameters and gene expression of lipogenesis-related genes in rats
T
Fawzia H.R. Abd-Raboa, Fouad M.F. Elshaghabeea, Sally S. Sakra,b,∗, Nagwa I. El-Arabic, Shereen Abu El-Maatyc a
Dairy Science Department, Faculty of Agriculture, Cairo University, Giza, Egypt Department of Food Science and Human Nutrition, College of Agriculture and Veterinary Medicine, Qassim University, Qassim, Saudi Arabia c Genetics Department, Faculty of Agriculture, Cairo University, Giza, Egypt b
A R T I C LE I N FO
A B S T R A C T
Keywords: Dietary fats Bubalus bubalis milk Buffaloes' butter oil Shortening Margarine Lipogenesis-related genes
The effects of different types of dietary fats on some biochemical and histological parameters were investigated and gene expression of lipogenesis-related genes in rats was evaluated. Five groups of Wister rats were randomly selected. Rats in group 1 (control) were given only rodent chow. Rats in groups 2, 3, 4 and 5 were fed with rodent chow supplemented with 10% buffalo butter oil, buffalo butter oil solid fraction (S30), hydrogenated palm kernel oil shortening, and margarine, respectively. As a result of adding shortening (group 4), there was an increase in the rats’ weight and some of the serum biochemical parameters compared to the other experimental groups. Those increments were parallel to an increase in serum acetate of the same group. Histologically, photographs of the livers of rats in group 3 showed slight cytoplasmic vacuolization of centrilobular hepatocytes and asporadic cell necrosis. The livers of rats in group 4, however, showed activation of Kupffer cells, hydropic degeneration of hepatocytes and cytoplasmic vacuolization of centrilobular hepatocytes. The gene expression of sterol regulatory element-binding protein (SREBP) 1c and fatty acid synthase (FAS) showed that feeding rats with S30 and shortening led to an increase in SREBP-1c and FAS mRNA levels, thus indicating the activation of lipogenesis genes in the liver. Supplementing rat diets with margarine showed no changes in SREBP-1c and FAS mRNA levels compared with other treatments. In conclusion, diets with shortening or S30 resulted in an increase in weight gain, histopathological lesions, lipid profile levels changes and a significant up-regulation of SREBP-1c and FAS gene expression levels compared with butter oil and margarine.
1. Introduction Although dietary fat and oil are the main micronutrient sources that provide energy and fat-soluble vitamins for the human metabolic process (Sharma, Zhang, & Dwivedi, 2010), eating foods rich in saturated fat is directly related to hypercholesterolemia and obesity (Grunberger, 2011; WHO, 2013). Excessive consumption of high cholesterol foods also increases the risk of atherosclerosis and coronary heart diseases developments (Black, 1975). Many developing nations consume transrich partially hydrogenated vegetable fat or oil, which has been linked to metabolic and inflammatory risk factors and coronary heart diseases (Idris and Sundram, 2002). Many food companies prefer using trans fatty acids (FA) because of their palatability, stability and cost-effectiveness (Dias, Passos, Lopes, & Valente, 2015; Mensink, Zock, Kester, & Katan, 2003). On the other hand, oils rich in PUFA and MUFA may prevent cardiovascular diseases (Kris-Etherton, Hecker, Bonanome,
∗
Coval, Binkoski and Hilpert, 2002). The amount and type of fats in the diet have important effects on the heath of humans and their blood lipid profile. People with high levels of triglycerides, high low-density lipoprotein cholesterol (LDL-cholesterol) level and low high-density lipoprotein cholesterol (HDL-cholesterol) level, are more predisposed to health risks than those who are not (Sengupta, Gupta, Nadi, & Ghosh, 2013). Recently, the effect of dietary components on the transcription of cells and tissues (nutrigenomics) had been studied. Nutrigenomics refers to the influence of food constituents and dietary bio-actives on gene expression (Ayisi & Zhao, 2017; Kaput, Perlina, Hatipoglu, Bathelomew, & Nikolsky, 2007; Zheng, Pan, Huang, Ci, Zhao, & Yang, 2015). Gene expression studies are becoming important for free radical research and molecular nutrition (Dieck, Doring, Roth, & Daniel, 2003). Many different enzymes involved in glucose, cholesterol and lipid metabolism could be regulated by the SREBP
Corresponding author. Faculty of Agriculture, 12613 Giza, Egypt. E-mail addresses: [email protected], [email protected] (S.S. Sakr).
https://doi.org/10.1016/j.fbio.2020.100540 Received 23 February 2018; Received in revised form 31 January 2020; Accepted 31 January 2020 Available online 03 February 2020 2212-4292/ © 2020 Published by Elsevier Ltd.
Food Bioscience 34 (2020) 100540
F.H.R. Abd-Rabo, et al.
Table 1 The nucleotide sequences of primers used in RT-PCR. Name of the gene
Forward primer (5′ to 3′)
Reverse primer (5′ to 3′)
Amplicon-Length (bp)
SREBP-1c FAS β-actin
AGCCATGGATTGCACATTTG CGGCGAGTCTATGCCACTAT GACGAGGCCCAGAGCAAGAGA
GGTACATCTTTACAGCAGTG ACACAGGGACCGAGTAATGC GGGTGTTGAAGGTCTCAAACA
260 222 225
Table 2 Fatty acids relative distribution (%) of different dietary fats used in the formulation of different rodent's chow. Fatty acid
Fatty acid's name
Butter oil
Solid fraction of butter oil (S30)
Shortening
Margarine
C8:0 C10:0 C12:0 C14:0 C15:0 C16:0 C17:0 C18:0 C20:0 C14:1ω5 C16:3ω4 C18:1n9 C18:2ω4 C18:2n6 C18:3n3 C18:4ω3
Caprylic Capric Lauric Myristic Pentadecanoic Palmitic Heptadecanoic Stearic Arachidic Tetradecenoic Hexadecatrienoic Oleic – Linoleic Alfa-Linolenic Alfa-Octadecatetraenoic
0.33 1.33 2.02 10.6 2.20 34.6 1.11 12.3 ND 0.72 0.29 28.7 1.14 2.37 0.6 1.16
0.45 1.35 2.01 11.5 2.00 34.8 1.10 12.5 ND 0.28 0.27 28.1 1.22 2.16 0.51 1.01
ND ND 0.2 1.0 ND 43.8 ND 10.4 0.29 ND ND 38.00 ND 6.33 ND ND
3.42 3.16 43.5 12.5 ND 8.26 ND 18.8 0.15 ND ND 9.65 ND ND ND ND
99.4 64.5 3.68 60.8 34.9 29.7 5.27
99.1 65.6 3.81 61.8 33.5 28.6 4.90
99.9 55.6 0.2 55.4 44.2 37.9 6.33
99.9 90.3 50.4 39.9 9.65 9.65 ND
∑ fatty acids ∑SFA Shorter chain-SFA Long chain-SFA ∑UFA MUFA PUFA
SFA: Saturated Fatty Acids, UFA: Unsaturated Fatty Acids, Shorter chain-SFA: (C8–C12), Long chain-SFA: (C14–C18). ND: not detected.
Moreover, FAS is an important multifunctional enzyme required for FA synthesis (Muñoz et al., 2003). The concentration of FAS in a specific tissue is affected by a number of hormonal and dietary factors that are important to determine the maximal capacity of a tissue to synthesize FA using the de novo pathway (Clarke, 1993). Also, positive correlations were found between the FAS mRNA expression level and the body fat content in animals (Mildner & Clarke, 1991). Therefore, the present study is designed to study whether adding different types of dietary fats can positively or negatively modulate some histological and biochemical parameters in a rat model. This research also aimed to evaluate the gene expression of lipogenesis-related genes SREBP-1c and FAS in the liver tissues of rats. 2. Materials and methods
Fig. 1. Body weight of animal groups during 6 wk of intervention. Group 1 (control): Rats were fed rodent chow, Group 2: Rats were fed rodent chow supplemented with 10% of butter oil, Group 3: Rats were fed rodent chow supplemented with 10% of solid fraction (S30) of butter oil, Group 4: Rats were fed rodent chow supplemented with 10% of shortening, Group 5: Rats were fed rodent chow supplemented with 10% of margarine.*A, B, C and D: Different letters represent significant differences between each parameter (P ≤ 0.05), i.e. same letters mean no significant difference between each parameter as assessed using the general linear model (GLM).
2.1. Materials One day post-milking un-salted butter from Bubalus bubalis (Egyptian buffalo) milk was obtained from the Dairy Science Department, Faculty of Agriculture, Cairo University. The fresh butter was subsequently used to prepare the solid fraction (S30). Shortening (hydrogenated palm kernel oil with polyunsaturated fats that had been converted to saturated fats) and margarine made of palm oil, which are both used in bakery products (PT. Sinar Meadow International, Jakarta, Indonesia) was purchased from an Egyptian local market.
(sterol regulatory element-binding protein). Three SREBP isomers have been identified, and they include SREBP-1a, -1c and −2. While SREBP1c and −2 are involved in regulating FA and cholesterol biosynthesis, respectively, SREBP-1a is involved in both processes. SREBP is synthesized as inactive precursors and activated by serial proteolytic cleavages. Gosmain et al. (2005) said that SREBP-1c was one of the main factors that led to the nutritional regulation of lipogenesis.
2.2. Preparation of butter oil and its solid fraction (S30) The dry fractionation of fresh buffalo butter was done by heating the butter to 60 °C. Then, anhydrous sodium sulphate (Sigma-Aldrich, 2
Food Bioscience 34 (2020) 100540
F.H.R. Abd-Rabo, et al.
Table 3 Levels of some serum biochemical parameters (U/L) after 6wk of intervention. Parameters LDL-cholesterol HDL-cholesterol Triglycerides Total cholesterol AST ALT Uric Acid Creatinine Urea Glucose
Group 1
Group 2 c
0.73 ± 0.12 0.38 ± 0.24a 0.96 ± 0.1c 1.3 ± 0.1b 2.2 ± 0.2a 2.1 ± 0.3a 3.6 ± 0.3b 0.69 ± 0.09b 0.23 ± 0.01c 0.07 ± 0.05c
Group 3 c
Group 4 b
0.76 ± 0.1 0.34 ± 0.03b 0.90 ± 0.12c 1.3 ± 0.1b 2.9 ± 0.3a 3.0 ± 0.7a 3.4 ± 0.3b 0.62 ± 0.07b 0.21 ± 0.02c 0.07 ± 0.06c
1.4 ± 0.2 0.37 ± 0.1a 1.7 ± 0.1b 2.1 ± 0.2a 2.7 ± 0.5a 3.0 ± 0.4a 3.7 ± 0.4b 0.71 ± 0.12a 0.29 ± 0.04a 1.1 ± 0.1c
Group 5 a
1.7 ± 0.1 0.31 ± 0.01b 1.9 ± 0.1a 2.4 ± 0.3a 3.2 ± 0.4a 3.0 ± 0.4a 4.1 ± 0.3a 0.82 ± 0.11a 0.31 ± 0.03a 1.6 ± 0.2a
0.79 ± 0.2c 0.4 ± 0.05a 1.0 ± 0.1c 1.4 ± 0.2b 2.8 ± 0.4a 2.9 ± 0.5a 3.6 ± 0.4b 0.63 ± 0.11b 0.26 ± 0.05b 1.3 ± 0.1b
Group 1: Rats were fed rodent chow, Group 2: Rats were fed rodent chow supplemented with 10% of butter oil, Group 3: Rats were fed rodent chow supplemented with 10% of solid fraction (S30) of butter oil, Group 4: Rats were fed rodent chow supplemented with 10% of Shortening, Group 5: Rats were fed rodent chow supplemented with 10% of margarine. a, b and c: Different letters represent significant differences between each parameters (P ≤ 0.05), i.e., same letters mean no significant difference between each parameter using the general linear model (GLM).
The body weight of rats was measured weekly.
Egyptian International Centre for Import, Cairo, Egypt) was added. After that, filter paper Whatman No. 1 (Middle East Co. for Chemicals, Cairo, Egypt) was used. Then, the pure fat (butter oil) was reheated (60 °C) to destroy the crystal memory and was cooled to 30 °C using a circulating water bath (Labcompare, San Francisco, CA, USA). After that, it was held at 30 °C for 6 h with constant stirring (60–80 rpm). Finally, the Whatman No. 1 filter paper in a Buchner funnel with mild suction was used to separate the solid fraction (S30) from the filtrate (liquid fraction).
2.5. Blood collection After 6 wk, animals were anesthetized with ether, and blood samples were collected without anticoagulant from the retro-orbital Venus plexus. Blood samples of all treatments were centrifuged at 4000×g (2300 rpm in the Hermle Labortechnik GmbH, Wehingen, Germany centrifuge with SER. #220.72, Type 09/144 rotor) at room temperature (22–25 °C) for 10 min. Also, separated serum was stored in Eppendorf (2 mL) vials in the freezer at −18 °C for maximum of 7 days before the biochemical analysis.
2.3. FA profile analysis FA methyl esters (FAME) profile was done in the Food Safety and Quality Control Lab (FSQC), Faculty of Agriculture, Cairo University, (Cairo, Egypt). The FAME were prepared according to AOAC official method 969.33 (2012), and separated using the gas-liquid chromatography (Hewlett Packard Model 6890 chromatograph, San Diego, CA, USA). The separation process was done on an INNOWax capillary column (polyethylene glycol, Model No. 19095 N-123, 240 °C maximum, 30.0 m × 530 μm x 1.0 μm, Agilent, Santa Clara, CA, USA). The carrier gas was nitrogen (15 mL min−1). The injector and detector temperatures were held at 280 °C. The column temperature was programmed as follows: initial oven temperature at 100 °C for 10 min, then increased to 240 °C at 10 °C min−1 and maintained for 10 min, and finally increased to 280 °C, hydrogen flow rate 30 mL min−1 and air flow rate 300 mL min−1. The relative percentage of FAME was determined using an area normalization method with a standard of FAME as a reference.
2.6. Determination of biochemical parameters in serum samples The spectrophotometer (Shimadzu UV-1900, Tokyo, Japan) was used to determine the serum alanine transaminase (ALT), aspartate aminotransferase (AST), triglycerides, total cholesterol, LDL-cholesterol, HDL-cholesterol, creatinine and uric acid using commercial kits (Thermo Fisher Scientific Co., Passau, Germany). The methods for determination were according to the instruction document for each kit. In brief, a colorimetric method depending on transferring the amino group from the sample to the carbon atom on the 2-oxoglutarate and forming pyruvate and oxaloacetate was used to determine ALT and AST, respectively, according to Reitman and Frankel (1957) and the detections were done at 340 nm. Triglycerides were detected using a simplified enzymatic procedure based on previously reported methods (Fossati & Prencipe, 1982; McGowan, Artiss, Strandbergh, & Zak, 1983); in which lipase was used to hydrolyze TG and produce glycerol which is phosphorylated by adenosine triphosphate with glycerol kinase in a system generates hydrogen peroxide and the red-colored dye appeared was detected at 570 nm. Total cholesterol, LDL-cholesterol and HDL-cholesterol were measured using an enzyme assay method. In which cholesterol oxidase-amino antipyrine for Total cholesterol determination and 2,4,6-tribromo-3-hydroxybenzoic acid for HDL-cholesterol determination were used as previously described (Allain, Poon, Chan, Richmond, & Fu, 1974; Bachorik & Albers, 1986; Roeschlau, Bernt, & Gruber, 1974) and the detections were done at 546 nm. In an alkaline solution, the level of creatinine reacts with picric acid and the level of uric acid reduces the phosphotungstic acid were determined as previously described by Elhardallou, Babiker, Sulieman, and Gobouri (2015) and the absorbance was readied at 495 and 700 nm for creatinine and uric acid, respectively. For glucose, a serum drop was put on the test zone of a strip for immediate measurement of glycemia with a Glucotrend device (Boehringer, Mannheim, Germany).
2.4. Animals and feeding protocol Forty male weaned Wistar rats 50 g; initially 3 wk old (Wistar Han IGS, Strain code: 273 Charles Rivers, San Francisco, CA, USA) were obtained from the animal house at Research Institute of Ophthalmology, (Giza, Egypt). Animal care and experimentation were done according to the guidelines for animal care recommended by the local experimental ethics committee of the same research institute. Rats were housed individually in micro-isolator plastic cages and fed with rodent chow composed of 60% corn starch, 20% casein, 10% dietary fat, 5% cellulose, 4% salt mixture and 1% vitamins mixture (Miladco Co., Giza, Egypt) and given water ad libitum for 2 wk until they reached 1.0 ± 0.5g in ambient temperature (22 ± 2 °C) and humidity (50 ± 5%) with a 12 h light-dark cycle. Afterwards, the rats were randomly categorized into 5 groups (8 rats/group). Rats in group 1 (control) were given only rodent chow. Rats in groups 2, 3, 4, and 5 were fed with rodent chow supplemented with 10% of buffalo butter oil, 10% of the solid fraction of the butter oil at 30 °C (S30), 10% shortening, and 10% margarine, respectively, for 6 wk of intervention. 3
Food Bioscience 34 (2020) 100540
F.H.R. Abd-Rabo, et al.
Fig. 2. Rat liver microscopic photographs (H&E stain) from different groups (X 400). Group 1: Rats were fed rodent chow, Group 2 (2-a and 2-b): Rats were fed rodent chow supplemented with 10% of butter oil, Group 3 (3-a and 3-b): Rats fed rodent chow supplemented with 10% of solid fraction (S30) of butter oil, Group 4 (4-a and 4-b): Rats were fed rodent chow supplemented with 10% of shortening, Group 5 (5-a and 5-b): Rats were fed rodent chow supplemented with 10% of margarine.
Germany) equipped with a Rezex@ ROA-organic acid H+ ion exchange column (Phenonmenex Inc., Torrance, CA, USA) at 65 °C was used to measure the levels of acetate, propionate and butyrate in serum. The binary pump flow rate was set at 0.6 mL min−1, the UV detector was set at 214 nm, and the mobile phase was 0.0065 M H2SO4 (Elshaghabee et al., 2016).
2.7. Determination of acetate, propionate and butyrate levels in serum Each serum sample was mixed with 25 μL Carrez I and 25 μL Carrez II solution and then centrifuged at 3000×g (1750 rpm) at 4 °C for 15 min. The supernatant was filtered with a 0.45 μm PTEF syringe membrane filter (Millipore, Bedford, MA, USA). High-performance liquid chromatography (HPLC, Agilent 1260 series, Knauer, Berlin, 4
Food Bioscience 34 (2020) 100540
F.H.R. Abd-Rabo, et al.
where ΔCttarget is for the target sample (experiment) and ΔCtreference is for the reference sample (control) The program was started with initial denaturation at 94 °C for 15 min, then 40 cycles of denaturation at 94 °C for 45 s, followed by annealing at 62, 62 and 55 °C for 45 s (SREBP-1c, β-actin and FAS genes, respectively), and followed by an extension at 72 °C for 45 s. The analyses were done using the CFX384 Thermocycler from Bio-Rad (BioRad Laboratories, Inc., Hercules, CA, USA). The comparative Ct (ΔΔCt) was measured by subtracting ΔCt of calibrator from ΔCt of treated samples. Relative expression fold changes were also calculated by using formula 2−ΔΔCT which was proposed by Livak and Schmittgen (2001) and calculated as: ΔΔCt = ΔCttarget ΔCtreference. To determine the significance (P ≤ 0.05) between the mean differences of the groups, the independent unpaired student's t-test was used the Statistical Package for the Social Sciences version 23 (SPSS, IBM, Armonk, NY, USA).
Table 4 Mean values of levels of serum acetate, propionate and butyrate (μg/mL) after 6 wk of intervention. Parameter
Acetate Propionate Butyrate
Animal Groups Group 1
Group 2
Group 3
Group 4
Group 5
0.4 ± 0.1 0.4 ± 0.1 ND
3.9 ± 0.5 0.3 ± 0.2 0.1 ± 0.1
4.6 ± 0.4 0.1 ± 0.1 ND
5.9 ± 0.6 0.1 ± 0.01 ND
2.4 ± 0.4 0.8 ± 0.3 0.6 ± 0.3
Group 1: Rats were fed rodent chow, Group 2: Rats were fed rodent chow supplemented with 10% of butter oil, Group 3: Rats were fed rodent chow supplemented with 10% of solid fraction (S30) of butter oil, Group 4: Rats were fed rodent chow supplemented with 10% of Shortening, Group 5: Rats were fed rodent chow supplemented with 10% of margarine. ND: not detected.
2.8. Histological examination and grading of the histopathological lesions 2.10. Data analysis Tissue specimens from liver were collected from the 5 rats from each group and fixed in 10% buffered formalin. After that, they were processed using a routine paraffin embedding technique in which they were sectioned at ~5 μm thickness and stained with Hematoxylin and Eosin (H&E) (Bancroft, Stevens, & Turner, 1996). The grading of the histopathological lesions was carried out according to the technique used by Arsad, Esa, and Hamzah (2014) in which (0), (1), (2), and (3) indicated no changes, mild, moderate and severe changes, respectively.
Samples of serum were subjected to triplicate analyses. The mean and standard deviations of triplicates are shown. Statistics using the analysis of variance (ANOVA) version 6.04 and Duncan tests with the Statistical Analysis System (SAS Institute Inc., Cary, NC., USA). A probability of (P ≤ 0.05) was used to establish the statistical significance. The real-time polymerase chain reaction was done in three wells (replicates) for all genes. 3. Results and discussion
2.9. RNA extraction and real-time-PCR analysis
This study was done to evaluate the impact of different dietary fats on biochemical and histological parameters and gene expression of lipogenesis-related genes in vitro. The dietary fats were evaluated for their FA composition, and they are shown in Table 2.
The total RNA was isolated from 100 mg of frozen liver tissue using the RNA extraction kit (Cat No. Z3100, Promega, Madison, WI, USA) according to the manufacturer's instructions. Frozen liver tissues were homogenized in RNA lysis buffer (RLA). Then the samples were transferred to fresh tubes and RNA dilution buffer was added. After centrifugation at 20.100×g (12000 rpm in the Eppendorf, rolling cabinet 5804/5804 R, centrifuge, Hamburg, Germany) at 4 °C for 10 min. Then samples were transfer to fresh tubes and 95% ethanol was added. The supernatant was transferred to a spin column and centrifuged at 20.100×g for 1 min. The RNA was washed with RNA wash solution (RWA). DNase stop solution (DSA) was added. One min later the RNA was eluted into an elution tube. Then, the total RNA was reversed and transcribed to cDNA using the Go Script™ Reverse Transcription System Kit (Cat No. A5000, Promega). The real-time polymerase chain reaction (RT-PCR) was used to measure messenger RNA expression levels of both genes (FAS and SREBP-1c) in the liver tissue using a qPCR kit (Cat No. A6001, Promega). Primer (10 pmol) sequences are shown in Table 1. The βactin gene was used as a reference gene. The relative expression fold changes using formula 2−ΔΔCT which includes the control value using Equation (1): ΔΔCt = ΔCttarget - ΔCtreference
3.1. Effects of some dietary fats on weight gain At the baseline, the average weight of rats was ~110 g with no significant differences between all groups (Fig. 1). During the 6 wk of intervention, weight gain of rats fed with added 10% of shortening (group 4) was significantly increased (P ≤ 0.05) and they started to gain weight at a faster rate compared with rats in group 1 (control) and in other experimental groups. In the cat model, cats fed with diets supplemented with shortening resulted in an increase in body weight and adiposity during the period of intervention (Collison et al., 2011). At the end of the intervention period, weight gain of rats in group 3 was significantly increased compared with rats in group 2. Results obtained by Asselin et al. (2004) showed that feeding guinea pigs a diet supplemented with modified milk fat separated at 30 and 40 °C resulted in a significant increase in weight gain and the plasma lipid profile compared to pigs in the control group. Finally, rats in group 2 did not differ from rats in group 5 in terms of weight gain. These results are consistent with the findings of Judd et al. (1998) who determined that
(1)
Table 5 Grading of the histopathological lesions seen in rat's livers from different groups. Histopathological lesions
Group 1
Group 2
Group 3
Group 4
Group 5
Activation of Kupffer cells Hydropic degeneration of hepatocytes Cytoplasmic vacuolization of centrilobular hepatocytes Sporadic cell necrosis Total scorea
0 0 0 0 0
0 1 0 0 1
1 0 1 1 3
1 1 2 1 5
0 0 0 0 0
Group 1: Rats were fed rodent chow, Group 2: Rats were fed rodent chow supplemented with 10% of butter oil, Group 3: Rats were fed rodent chow supplemented with 10% of solid fraction (S30) of butter oil, Group 4: Rats were fed rodent chow supplemented with 10% of Shortening, Group 5: Rats were fed rodent chow supplemented with 10% of margarine. a 0: normal (no change), 1: mild, 2: moderate, 3: severe. 5
Food Bioscience 34 (2020) 100540
F.H.R. Abd-Rabo, et al.
Fig. 3. The effect of dietary fats on the expression levels of some lipogenesis genes. The qRT-PCR analysis results to measure the relative mRNA expression levels of FAS and SREBP-1c genes of rat livers fed with different dietary fats. Bars represent mean values ± standard error. The number of samples = 4.
3.3. Effect of some dietary fats on histological parameters
when the FA profile was controlled in the margarine and consumed in place of butter, and presumably in place of other fats high in SFA, appreciable improvement in the blood lipid profile of the major lipoproteins can be expected for most people.
The histopathological lesions of rats liver were examined and graded. Data are shown in Fig. 2 and Table 5. The livers of rats from group 1 showed the normal histological structure of the hepatic lobule. Group 2 showed no histopathological changes (2-a) even though a few sections from the same group indicated mild hydropic degeneration of hepatocytes (2-b). Mild cytoplasmic vacuolization of centrilobular hepatocytes, mild sporadic cell necrosis and activation of Kupffer aclls were seen in group 3 (3-a and 3-b photos). The livers of rats from group 4 showed cytoplasmic vacuolization (fatty change) of centrilobular hepatocytes, sporadic cell necrosis, mild activation of Kupffer cells and hydropic degeneration of hepatocytes (4-a and 4-b photos). However, the livers of rats from group 5 showed no histopathological changes. The previous results indicated that the type and composition of fats in the diet have an important effect on the rats’ liver. The supplementation of diet with shortening increased the level of fatty changes in liver tissues. Severe histopathological lesions (a total score of 5) in the shortening group (group 4), compared with other experimental groups (Table 5), were observed.
3.2. Effect of some dietary fats on biochemical parameters Among the 5 groups (Table 3), the lowest concentration of triglycerides and cholesterol was observed in group 2. This group showed a significant difference in weight gain compared to groups 3 and 4. Although there are slight differences in the FA distribution between butter oil and S30 as shown in Table 2, there were differences in the levels of LDL-cholesterol, triglyceride and cholesterol in group 3 compared with that in group 2 (Table 3). This may be because the S30 is rich in long chain SFA, especially in palmitic and stearic acids (C16 and C18), as reported by many researchers (Oversesen, Leth, & Hansen, 1998; Rabar, Harker, O’Flynn, & Wierzbicki, 2014). Lai, Lasekan, Monsma, and Ney (1995) studie's on rats showed that high melting fractions led to plasma lipid profile similar to the palm oil diet. They also reported that trans UFA with a higher melting point than their cis isomers are usually partitioned into the higher melting fraction. These results suggested that changes in the triglyceride and FA composition of butter may change its nutritional profile. These results were consistent with the results of Saravanan, Haseeb, Ehtesham, and Ghafoorunissa (2005) who reported that SFA (high in the butter oil and S30) are less atherogenic than trans FA (high in the shortening). Rats that were given rodent chow supplemented with 10% shortening showed a lipid profile that was affected by the lipid source and the partially hydrogenated oil had a hypercholesteraemic effect (Table 3). Idris and Sundram (2002) mentioned that the trans FA, produced during the partially hydrogenation process, were considered a risk factor for coronary heart diseases and associated with total cholesterol, LDL-cholesterol and triglycerides increments as well as low HDL-cholesterol levels. No significant variations for serum AST and serum ALT levels were observed among all the groups. Uric acid was also less affected by supplementing the diet. The highest concentration of creatinine and urea was observed in rats fed with S30 and shortening. The level of serum glucose was the highest in the rats fed 10% shortening.
3.4. Effect of some dietary fats on the level of acetate, propionate and butyrate in serum Shortening is a major source of trans FA, and a diet that contains high levels of trans FA have been shown to increase levels of plasma LDL-cholesterol and reduce levels of HDL-cholesterol which may increase the risks of cardiovascular diseases (Crupkin & Zambelli, 2008; Takeuchi & Sugano, 2017). Table 4 shows an increase in the serum-acetate level in rats fed with shortening (group 4) compared with other groups. This increase in serum acetate is associated with an increase in the total cholesterol (see Table 3) and the body weight of the same group (see Fig. 1). Acetate is the most abundant short-chain FA in the colon (Juárez-Hernández, Chávez-Tapia, & Barbero-Becerra, 2016), and it acts as a substrate for hepatic cholesterol synthesis and de novo lipogenesis, thus resulting in an increase in plasma cholesterol (Wong, de Souza, Kendall, Emam, & Jenkins, 2006). Levels of propionate varied among different tested groups. High levels of serum propionate were observed in rats’ serum of 6
Food Bioscience 34 (2020) 100540
F.H.R. Abd-Rabo, et al.
Acknowledgment
groups 1, 2 and 5. An increase of propionate was associated with a low plasma cholesterol level (Al-Lahham, Peppelenbosch, Roelofsen, Vonk, & Venema, 2010; Hara, Haga, Aoyama, & Kiriyama, 1999). Moreover, Morrison and Preston (2016) explained the role of short chain FA in human metabolism; they reported that there was a significant reduction in propionate compared to acetate in the liver. In groups 2 and 5, the levels of butyrate were associated with a decrease in body weight of rats compared to rats in group 4 (Fig. 1). Juárez-Hernández et al. (2016) noted that butyrate improved thermogenesis and energy expenditure, which in turn reduced body weight. Also, the results in Table 4 showed that the diet rich in the S30 or shortening suppressed the formation of butyrate. Results obtained by Jakobsdottir, Xu, Molin, Ahrne, and Nyman (2013) also showed that rats fed high-fat diets containing trans FA reduced the formation of plasma butyrate.
Authors thank the Faculty of Agriculture, Cairo University for funding this research. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.fbio.2020.100540. References Achliya, G. S., Barabde, U., Wadodkar, S., & Dorle, A. (2004). Effect of Bramhi Ghrita, a polyherbal formulation on learning and memory paradigms in experimental animals. Indian Journal of Farmachology, 36, 159–162. Al-Lahham, S. H., Peppelenbosch, M. P., Roelofsen, H., Vonk, R. J., & Venema, K. (2010). Biological effects of propionic acid in humans; metabolism, potential applications and underlying mechanisms. Biochimica et Biophysica Acta, 1801, 1175–1183. Allain, C. C., Poon, L. S., Chan, C. S., Richmond, W., & Fu, P. C. (1974). Enzymatic determination of total serum cholesterol. Clinical Chemistry, 20, 470–475. AOAC (2012). Chapter 41: 19-20.Official methods of analysis of the association of official analytical chemist (17th ed.). Gaithersburg, MD, USA, 969.3 and 991.39. Fatty acids in oils and fats preparation of methyl ester boron trifluoride-AOAC-IUPAC method Codex-adopted-AOAC Method. Arsad, S. S., Esa, N. M., & Hamzah, H. (2014). Histopathologic changes in liver and kidney tissues from male Sprague Dawley rats treated with Rhaphidophora Decursiva (Roxb.) Schott extract. Journal of Cytology & Histology, S4. https://doi.org/10.4172/21577099.S4-001 001-6. Asselin, G., Lavigne, C., Bergeron, N., Angers, P., Belkacemi, K., Arul, J., et al. (2004). Fasting and postprandial lipid response to the consumption of modified milk fats by Guinea pigs. Lipids, 39, 985–992. Ayisi, C. L., & Zhao, J. L. (2017). Fatty acid composition, lipogenic enzyme activities and mrna expression of genes involved in the lipid metabolism of Nile tilapia fed with palm oil. Turkish Journal of Fisheries and Aquatic Sciences, 17, 405–415. Bachorik, P. S., & Albers, J. J. (1986). Precipitation methods for quantification of lipoproteins. Methods in Enzymology, 129, 78–100. Bancroft, J. D., Stevens, A., & Turner, D. R. (1996). Theory and practice of histopathological techniques. New York: Churchill Livingstone. Black, R. G. (1975). Partial crystallization of milk fat and separation of fractions by vacuum filtration. Australian Journal of Dairy Technology, 30, 153–156. Clarke, S. D. (1993). Regulation of fatty acid synthase gene expression: An approach for reducing fat accumulation. Journal of Animal Science, 71, 1957–1965. Collison, K. S., Zaidi, M. Z., Saleh, S. M., Inglis, A., Mondreal, R., Makhoul, N. J., et al. (2011). Effect of trans-fat, fructose and monosodium glutamate feeding on feline weight gain, adiposity, insulin sensitivity, adipokine and lipid profile. British Journal of Nutrition, 106, 218–226. Crupkin, M., & Zambelli, A. (2008). Detrimental impact of trans fats on human health: Stearic acid-rich fats as possible substitutes. Comprehensive Reviews in Food Science and Food Safety, 7, 271–279. Dias, F. S., Passos, C. M., Lopes, D. O. M. L., & Valente, V. (2015). Fatty acid profile of biscuits and salty snacks consumed by Brazilian college students. Food Chemistry, 171, 351–355. Dieck, H. T., Doring, F., Roth, H., & Daniel, H. (2003). Changes in rat hepatic gene expression in response to zinc deficiency as assessed by DNA arrays. Journal of Nutrition, 133, 1004–1010. Elhardallou, S. B., Babiker, W. A. M., Sulieman, A. M. E., & Gobouri, A. A. (2015). Effect of diet supplementation with food industry by-products on diabetic rats. Food and Nutrition Sciences, 6, 875–882. Elshaghabee, F. M. F., Bockelmann, W., Meske, D., de Vrese, M., Walte, H.-G., Schrezenmeir, J., et al. (2016). Ethanol production by selected intestinal microorganisms and lactic acid bacteria growing under different nutritional conditions. Frontiers in Microbiology, 7, 47. Fossati, P., & Prencipe, L. (1982). Serum triglycerides determined calorimetrically with an enzyme that produces hydrogen peroxide. Clinical Chemistry, 28, 2077–2080. Gosmain, Y., Dif, N., Berbe, V., Loizon, E., Rieusset, J., Vidal, H., et al. (2005). Regulation of SREBP-1 expression and transcriptional action on HKII and FAS genes during fasting and refeeding in rat tissues. Journal of Lipid Research, 46, 697–705. Grunberger, G. (2011). Do we need a fasting lipid profile to assess cardiovascular risk? Journal of Diabetes, 3, 172–173. Hara, H., Haga, S., Aoyama, Y., & Kiriyama, S. (1999). Short-chain fatty acids suppress cholesterol synthesis in rat liver and intestine. Journal of Nutrition, 129, 942–948. Idris, C. A., & Sundram, K. (2002). Effect of dietary cholesterol, trans and saturated fatty acids on serum lipoproteins in non-human primates. Asia Pacific Journal of Clinical Nutrition, 11, 408–415. Jakobsdottir, G., Xu, J., Molin, G., Ahrne, S., & Nyman, M. (2013). High-fat diet reduces the formation of butyrate, but increases succinate, inflammation, liver fat and cholesterol in rats, while dietary fiber counteracts these effects. PloS One, 8, e80476. https://doi.org/10.1371/journal.pone.0080476. Juárez-Hernández, E., Chávez-Tapia, C. N., & Barbero-Becerra, V. J. (2016). Role of bioactive fatty acids in nonalcoholic fatty liver disease. Nutrition Journal, 15, 72–81. Judd, J. T., Baer, D. J., Clevidence, B. A., Muesing, R. A., Chen, S. C., Weststrate, J. A., et al. (1998). Effects of margarine compared with those of butter on blood lipid
3.5. Gene expression of lipogenesis-related genes in the liver as affected by different dietary fats The expression of lipogenesis genes in the liver tissues (Fig. 3) showed a significant decrease (P ≤ 0.05) in the mRNA expression levels of SREBP-1c and FAS by the addition of butter oil to the diet. On the other hand, the 30S and shortening treatments led to a significant increase in expression levels of SREBP-1c and FAS genes for the butter oil treatment (P ≤ 0.05). It was also noted that the administration of margarine did not significantly (P > 0.05) affect mRNA expression levels of SREBP-1c and FAS genes compared with levels found in the other treatments (P ≤ 0.05). In this study, lipogenesis response genes, especially SREBP-1c, were significantly higher (P ≤ 0.05) and showed the quickest response to feeding with 30S and shortening. SREBP-1c is considered one of the important transcription factors involved in the nutritional induction of lipogenic enzyme genes (Gosmain et al., 2005). Also, both lipogenic transcription factors, PPAR and SREBP-1c, were expressed in the retroperitoneal depot compared with the mesenteric and the inguinal depots (Palou et al., 2009). Moreover, SREBP-1c, FAS, and glycerol-3-phosphate acyltransferases (GPAT) gene expression involved in the liver lipogenesis decreased after 4 h fasting, but the 3 h refeeding after 8 h fasting led to a significant increase in SREBP-1c and GPAT mRNA levels in the liver (Palou et al., 2008). Ayisi and Zhao (2017) concluded that FAS, acetyl-CoA carboxylase (ACC), steroyl-CoA desaturase (SCD) 1, ATP citrate lyase (ACYL), carnitine palmitoyltransferase (CPT) Ia and CPT Ib were significantly increased when feeding tilapia with palm oil (P ≤ 0.05). Furthermore, there was a significant/positive correlation between the expression of ACYL mRNA and dietary palm oil and/or liver tissue FA with FAS, ACC, and SCD1. 4. Conclusion The amount, type and composition of lipids in the diet have an important effect on the body weight and serum lipid profile. Reports of the dietary intakes of butter oil or margarine are consistent with the beneficial effects than of the solid fraction of butter oil (S30) and shortening. These positive results support the beneficial effect of ghee (butter oil) outlined in the ancient Ayurveda texts and the therapeutic use of ghee for thousands of years in the Ayurveda system of medicine as mentioned by many authors (Achliya, Barabde, Wadodkar, & Dorle, 2004; Sharma et al., 2010). In addition, supplementing rats’ diet with S30 or shortening resulted in a significant up-regulation of SREBP-1c and FAS gene expression levels. While, the administration of margarine did not significantly (P > 0.05) affect mRNA expression levels of SREBP-1c and FAS genes. Declaration of competing interest The authors confirm that they have no conflicts of interest with respect to the work described in this manuscript. 7
Food Bioscience 34 (2020) 100540
F.H.R. Abd-Rabo, et al.
tissue and liver in response to fasting. European Journal of Physiology, 456, 825–836. Palou, M., Sanchez, J., Priego, T., Rodriguez, A. M., Pico, C., & Palou, A. (2009). Gene expression patterns in visceral and subcutaneous adipose depots in rats are linked to their morphologic features. Cellular Physiology and Biochemistry, 24, 547–556. Rabar, S., Harker, M., O'Flynn, N., & Wierzbicki, A. S. (2014). Lipid modification and cardiovascular risk assessment for the primary and secondary prevention of cardiovascular disease: Summary of updated NICE guidance. British Medical Journal, 349, 43–56. Reitman, S., & Frankel, S. (1957). A colorimetric method for the determination of serum glutamic oxalacetic and glutamic pyruvic transaminases. American Journal of Clinical Pathology, 28, 56–63. Roeschlau, P., Bernt, E., & Gruber, W. A. (1974). Enzymatic determination of total cholesterol in serum. Journal of Clinical Chemistry & Clinical Biochemistry, 12, 226. Saravanan, N., Haseeb, A., Ehtesham, N. Z., & Ghafoorunissa (2005). Differential effects of dietary saturated and trans-fatty acids on expression of genes associated with insulin sensitivity in rat adipose tissue. European Journal of Endocrinology, 153, 159–165. SAS (2004). SAS user's guide: Statistics (4th ed.). Cary, NC.,USA: SAS Inst. IncVersion 6.04. Sengupta, A., Gupta, S. S., Nadi, I., & Ghosh, M. (2013). Conjugated linoleic acid nanoparticles inhibits hypercholesterolemia induced by feeding high fat diet in male albino rats. Journal of Food Science & Technology, 52, 458–464. Sharma, H., Zhang, X., & Dwivedi, C. (2010). The effect of ghee (clarified butter) on serum lipid levels and microsomal lipid peroxidation. Ayu, 31, 134–140. Takeuchi, H., & Sugano, M. (2017). Industrial trans fatty acids and serum cholesterol: The allowable dietary level. Journal of Lipids. https://doi.org/10.1155/2017/9751756. Wong, J. M., de Souza, R., Kendall, C. W., Emam, A., & Jenkins, D. J. (2006). Colonic health: Fermentation and short chain fatty acids. Journal of Clinical Gastroenterology, 40, 235–243. World Health Organization (2013). Cardiovascular diseases (CVDs), media Centre, fact sheet, 317. Geneva: WHO. Zheng, Y., Pan, S., Huang, Y., Ci, L., Zhao, R., & Yang, X. (2015). Breed-specific lipid related gene expression in the subcutaneous fat of large white and Erhualian pigs at weaning. Archives of Animal Breeding, 58, 33–41.
profiles related to cardiovascular disease risk factors in normolipemic adults fed controlled diets. American Journal of Clinical Nutrition, 68, 768–777. Kaput, J., Perlina, A., Hatipoglu, P. B., Bathelomew, A., & Nikolsky, Y. (2007). Nutrigenomics: Concept and application to pharmacogenomics and clinical medicine. Pharmacogenomics, 8, 369–390. Kris-Etherton, P. M., Hecker, K. D., Bonanome, S. M., Coval, A. E., Binkoski, K. F., Hilpert, A. E., et al. (2002). Bioactive compounds in foods: Their role in the prevention of cardiovascular disease and cancer. The American Journal of Medicine, 113, 71–88. Lai, H. C., Lasekan, J. B., Monsma, C. C., & Ney, D. M. (1995). Alteration of plasma lipids in the rat by fractionation of modified milk fat (butter fat). Journal of Dairy Science, 78, 794–803. Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods, 25, 402–408. McGowan, M. W., Artiss, J. D., Strandbergh, D. R., & Zak, B. (1983). A peroxidase-coupled method for the colorimetric determination of serum triglycerides. Clinical Chemistry, 29, 538–542. Mensink, R. P., Zock, P. L., Kester, A. D., & Katan, M. B. (2003). Effects of dietary fatty acids and carbohydrates on the ratio of serum total to HDL cholesterol and on serum lipids and apolipoproteins: A meta-analysis of 60 controlled trials. American Journal of Clinical Nutrition, 77, 1146–1155. Mildner, A. M., & Clarke, S. D. (1991). Porcine fatty acid synthase: Cloning of a complementary DNA, tissue distribution of its mRNA and suppression of expression by somatotropin and dietary protein. Journal of Nutrition, 121, 900–907. Morrison, D. J., & Preston, T. (2016). Formation of short chain fatty acids by gut microbiota and their impact on human metabolism. Gut Microbes, 7, 189–200. Muñoz, G., Óvilo, C., Noguera, J. L., Sánchez, A., Rodríguez, C., & Silió, L. (2003). Assignment of the fatty acid synthase (FASN) gene to pig chromosome 12 by physical and linkage mapping. Animal Genetics, 34, 234–235. Oversesen, L., Leth, T., & Hansen, K. (1998). Fatty acid composition and contents of trans monounsaturated fatty acids in frying fats, and in margarines and shortenings marketed in Denmark. Journal of the American Oil Chemists Society, 75, 1079–1083. Palou, M., Priego, T., Sánchez, J., Villegas, E., Rodríguez, A. M., Palou, A., et al. (2008). Sequential changes in the expression of genes involved in lipid metabolism in adipose
8