- Email: [email protected]
Differential development of vesicular glutamate transporters in brain: An in vitro study of cerebellar granule cells
Neurochemistry International 48 (2006) 579–585 www.elsevier.com/locate/neuint
Differential development of vesicular glutamate transporters in brain: An in vitro study of cerebellar granule cells Olof Ehlers Hallberg a,b, Inger Lise Bogen a,b,1, Trine Reistad c,1, Kristin Huse Haug a,b, Marianne S. Wright d, Frode Fonnum b, S. Ivar Walaas a,b,* a
Department of Biochemistry, Institute of Basic Medical Sciences, University of Oslo, P.O. Box 1112, Blindern, N-0317 Oslo, Norway b Molecular Neurobiology Research Group, Faculty of Medicine, University of Oslo, N-0317 Oslo, Norway c Norwegian Defence Research Establishment, N-2027 Kjeller, Norway d Department of Pediatric Research, Rikshospitalet University Hospital, N-0027 Oslo, Norway Received 20 October 2005; received in revised form 22 December 2005; accepted 22 December 2005 Available online 3 March 2006
Abstract The cerebellar granule cells have been extensively used for studies on metabolism, neurotransmission and neurotoxicology, since they can easily be grown in cultures. However, knowledge about the development of different proteins essential for synaptic transmission in these cells is lacking. This study has characterized the developmental profiles of the vesicular glutamate transporters (VGLUTs) and the synaptic vesicle proteins synapsins and synaptophysin in cerebellar granule cells and in co-cultures containing both granule cells and astrocytes. The protein levels of VGLUT2 decreased by approximately 70% from days 2 to 7 in vitro, whereas the levels of VGLUT1 increased by approximately 95%. Protein levels of synapsin I, synapsin IIIa and synaptophysin showed a developmental pattern similar to VGLUT1 while synapsin II and VGLUT3 were absent. The mRNA expressions of VGLUT1 and VGLUT2 were in accordance with the protein levels. The results indicate both that cerebellar granule cells are mature at approximately 7 days in vitro, and that the up-regulation of VGLUT1 and down-regulation of VGLUT2 in cerebellar granule cells are both independent of surrounding astrocytes and neuronal input. The results of this study are discussed in relation to general developmental profiles of VGLUTs in other brain regions. # 2006 Elsevier Ltd. All rights reserved. Keywords: Cerebellar granule cells; Co-culture; Development; Synapsin; Vesicular glutamate transporters
The cerebellar granule cells account for about half of the total number of neurons found in the brain. The granular cells constitute a broad single layer in the cerebellar cortex, from where they can easily be dissected (Lowry, 1953) and even be isolated by cell fractionation (Balazs et al., 1972). The external germinal layer of the cerebellum forms a swamp-like structure at birth, which migrates and gives rise to the granular cell layer between postnatal days 7 and 15 (p7–p15) with a peak at days p10–p11 (Schousboe et al., 1989). This postnatal development, taken together with the fact that different cell types in the cerebellum develop at different times, has made it possible to isolate the granule cells as primary neuronal cultures. In the intact cerebellum, the granule cells are innervated by the mossy fibers which originate in, e.g. the pontine nuclei, the spinal cord and the vestibular system. The granule cell axons, designated * Corresponding author. Tel.: +47 22 85 11 28; fax: +47 22 85 14 36. E-mail address: [email protected] (S.I. Walaas). 1 These authors contributed equally. 0197-0186/$ – see front matter # 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.neuint.2005.12.027
parallel fibers, directly contact and activate the Purkinje cells, which constitute the only output from the cerebellar cortex and project inhibitory fibers to the deep cerebellar nuclei. While Purkinje cells employ gamma-aminobutyrate (GABA) as their inhibitory transmitter, both mossy fibers as well as parallel fibers and climbing fibers use L-glutamate as their main transmitter (Zhang and Ottersen, 1993). The process of glutamate uptake into synaptic vesicles is energy requiring, and also depends on a proton pump and a low concentration of chloride ions (Fonnum et al., 1998). At present, three vesicular glutamate transporters (VGLUT1, VGLUT2 and VGLUT3) have been identified and characterized within a family of Na/Pi transporters (Fremeau et al., 2001; Gras et al., 2002; Ni et al., 1994). The three transporters share more than 70% amino acid sequence identity and accumulate glutamate with similar bioenergetical and pharmacological characteristics (Hisano, 2003). Cultures of cerebellar granule cells have been extensively used to study brain metabolism (Waagepetersen et al., 2000), neurotoxicity (Fonnum and Lock, 2004; Marini et al., 1989) and
580
O.E. Hallberg et al. / Neurochemistry International 48 (2006) 579–585
synaptic mechanisms and development (Barberis et al., 2005; Dittman and Regehr, 1997). Despite this, a complete characterization of pre- and postsynaptic transporters and receptors in the synapse during development in vitro is lacking. A comparison of development in vitro and in vivo would help us to evaluate whether isolated granule cells retain their biological properties in vitro. From in vivo studies we know that VGLUT1, VGLUT2 and VGLUT3 show distinct localizations and developmental profiles in the cerebellum. In this study, we have investigated the development of the three VGLUT proteins, the synapsins and synaptophysin in granule cell cultures and co-cultures. Our data indicate that the cerebellar granule cells in vitro mimic the development seen in situ, supporting the use of this preparation for functional and toxicological in vitro studies. Our results are compared to the general developmental profiles of VGLUTs in other brain regions. 1. Experimental procedures 1.1. Animals Seven-day-old Wistar rat pups were used for preparation of cerebellar granule cells and co-culture of granule cells and astrocytes. Animals were treated according to the Norwegian Animal Welfare Act and the European Communities Council Directive of 24 November 1986 (86/609/EEC). Efforts were made to minimize animal suffering and to reduce the number of animals used.
1.2. Antibodies Antiserum against VGLUT1 was raised in rabbits against a synthetic 15 amino acid peptide (STVQPPRPPPPVRDY) derived from the C-terminal part of the published sequence of brain Na+-dependent inorganic phosphate cotransporter 1 (BNPI-1) (Ni et al., 1994) as previously described by Bogen et al. (2006). Primary antibodies against VGLUT2 and VGLUT3 were obtained from Chemicon (Temecula, CA, USA), antibody against synaptophysin was obtained from Sigma Immuno Chemicals (St. Louis, MO, USA), antibodies against synapsin Ia/b and synapsin IIa/b were obtained from Stressgen Biotechnologies (San Diego, CA, USA), while antibody against synapsin IIIa was obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Secondary anti-rabbit Ig horseradish peroxidase (HRP) and anti-mouse Ig HRP were obtained from Amersham Biosciences (Buckinghamshire, UK), while secondary antiguinea pig Ig HRP and anti-goat Ig HRP were obtained from Santa Cruz Biotechnology.
1.3. Preparation of cerebellar granule cells and co-culture Primary cultured neurons from rat cerebellum were isolated mainly as previously described (Schousboe et al., 1989). The cerebella from 7-day-old pups were dissected under sterile conditions and the brain tissue was then mechanically dissected from the meninges, trypsinized and chopped in buffered solution. The cells were seeded (106 cells/ml) in basal Eagle’s medium (containing 10% heat inactivated fetal bovine serum, 25 mM KCl, 2 mM L-glutamine, 100 IU/ml penicillin and 100 mg/ml streptomycin) and plated into 50 mm cell culture dishes that had been coated previously with poly-L-lysine (10 mg/ ml). These cells were designated ‘‘co-cultures’’ of granule cells and astrocytes. For preparation of cerebellar granule cells, the procedure was performed as described above, with the addition of cytosine b-D-arabinofuranoside (final concentration 2.5 mg/ml) 16–22 h after seeding in order to prevent growth of astrocytes. Both granule cells and co-cultures were grown at 37 8C with 5% CO2. Images of granule cells were taken on days 2, 5, 7, 9 and 12 in vitro with an Olympus IMT-2 light microscope connected to an Olympus Camedia C5060 camera.
1.4. Quantification of synaptic proteins Granule cells and co-cultures of granule cells and astrocytes were harvested 2, 5, 7, 9 or 12 days after seeding. The cells were washed twice with PBS, 150 ml lysis buffer (PBS with 1% sodium dodecyl sulphate) was added and cells were harvested with a cell scrape. The cell lysate was boiled for 2 min and stored at 40 8C before analysis. After protein determination (BCA protein assay, Pierce, Rockford, IL, USA; Smith et al., 1985), sample buffer was added (final concentration 2% sodium dodecyl sulphate, 10% glycerol, 50 mM Tris/HCl (pH 6.8), 0.25% bromophenol blue, 0.1 M dithiothreitol) and samples were boiled for 5 min. Equal amounts of total protein (5 or 10 mg/lane) were subjected to sodium dodecyl sulphate-polyacrylamide gel electrophoresis on 10% polyacrylamide gels. The separated proteins were electrophoretically transferred overnight (Towbin et al., 1979) to nitrocellulose membranes (0.2 mm pore size, BioRad, CA, USA) and stained with 0.2% Ponceau S (Salinovich and Montelaro, 1986). Individual proteins were quantified by immunoblotting with different primary antibodies, employing enhanced chemiluminescence Plus reagent (Amersham) for detection. The signals were visualized on Hyperfilm MP (Amersham) and scanned in a desktop scanner (Scan Jet 3c, Hewlett Packard, Houston, TX, USA) at 400 dpi. Densitometric quantifications were analyzed in Adobe Photoshop (Version 6.0). Immunoblotting was performed in duplicates from four to five separately prepared batches of granule cell cultures or co-cultures.
1.5. Total RNA preparation and reverse transcription Total RNA from three independent preparations of cerebellar granule cell cultures, harvested on days 2 and 7 after seeding, was isolated using the RNeasy Mini KitTM (Qiagen Sciences, Valencia, CA, USA), treated with DNase I (Qiagen GmbH, Hilden, Germany) and RNAguard (Amersham Biosciences, Piscataway, NJ, USA). RNA fractions exhibited a ratio of OD260/OD280 between 1.8 and 2.0, and RNA concentration was assayed using OD260-values. 2.5 mg RNA was reverse transcribed using the High-Capacity cDNA Archive Kit (Applied Biosystem Inc., Foster City, CA, USA) with random hexamers as primers. The cDNA was kept frozen at 20 8C until use for real-time PCR analysis.
1.6. Real-time PCR A one-step RT-PCR was performed in separate tubes containing 20 ng RNA for both target genes and endogenous control. The following specific primers for rat VGLUT1 and rat VGLUT2 and the housekeeping gene rat peptidyl prolyl isomerase A (PPIA), synthesized by Invitrogen, were used at 600 nM: VGLUT1 (GenBank accession no. NM_053859) 50 -GCAGTTTCCAGGACCTCCACT (sense), 50 -CAAGAGGCAGTTGAGAAGGAGAG (antisense); VGLUT2 (GenBank accession no. NM_053427) 50 -GGTATTTGGTCTGTTTGGTGTCCT (sense), 50 -CAGCACAGCAAGGGTTATGGT (antisense); and PPIA (GenBank accession no. NM_017101) 50 -GAAGCATACAGGTCCTGGCAT (sense), 50 TCACTTTCCCAAAGACCACA (antisense). Expression of VGLUT1, VGLUT2 and PPIA was analyzed using the SYBR Green PCR Master mix (Applied Biosystems) in an ABI PRISM1 7000 Sequence Detection System (Applied Biosystems) employing universal instrument settings with an annealing/extension temperature of 60 8C for 1 min (40 repeats). Two separate cDNA preparations from three independent preparations of granular cell cultures, followed by three independent PCR analyses with duplicate samples, were performed. Samples were compared using relative threshold cycle (CT) values, with PPIA as the endogenous control. The fold increase or decrease was determined relative to the expression on day 7 in vitro after normalizing to PPIA using 2DDCT (Livak and Schmittgen, 2001), where DCT is (VGLUT1 CT or VGLUT2 CT) (PPIA CT) and DDCT is (DCT day 2) (DCT day 7). Efficiency curves with different primer and template concentrations were performed (data not shown).
2. Results 2.1. Development of VGLUT1 and VGLUT2 in cerebellar granule cells and co-cultures Light-microscopic images of cerebellar granule cells show extensive networks of axons and dendrites from day 7 in vitro
O.E. Hallberg et al. / Neurochemistry International 48 (2006) 579–585
581
Fig. 1. Images of development of cerebellar granular cells. Images were taken on days 2, 5, 7, 9 and 12 in vitro (DIV), using an Olympus IMT-2 light microscope connected to an Olympus Camedia C5060 camera.
(Fig. 1). Representative immunoblots of VGLUT1 and VGLUT2 in cerebellar granule cells (Fig. 2) show a progressive increase of VGLUT1 during development and a decrease of VGLUT2. In the following experiments, 7 DIV was set arbitrarily as 100%. VGLUT1 levels were approximately 5% (of 7 DIV) at 2 DIV, approximately 25% at 5 DIV and then increased approximately 75% from days 5 to 7 in vitro (Fig. 3A). In contrast to VGLUT1, VGLUT2 showed an approximately 70% decrease from 2 DIV to 7 DIVand continuously decreasing levels towards 12 DIV (25% of 2 DIV) (Fig. 3B). VGLUT3 could not be detected at any developmental stage. Similar analyses were performed in cerebellar co-cultures, where VGLUT1 and VGLUT2 followed the same development patterns as in granule cell cultures (Fig. 4A and B). However, the increase in VGLUT1 levels appeared earlier in co-culture compared to granule cells with approximately 85% of 7 DIV level at 5 DIV. Analysis of VGLUT2 in co-culture showed an almost eight-fold decrease from 2 DIV to 12 DIV. Finally, the concentrations of VGLUT1 and VGLUT2 in the two different types of cultures at 7 DIV were compared. The levels of VGLUT1 in co-culture reached approximately 35% of those in granule cell cultures, whereas VGLUT2 reached approximately 40%.
that synapsin I, synapsin IIIa and synaptophysin levels increase during development (Fig. 3C–E), similar to VGLUT1. The same developmental patterns were seen in co-cultures (Fig. 4C–E). Synapsin II could not be detected at any of the developmental stages tested.
2.2. Development of synapsins and synaptophysin in cerebellar granule cells and co-cultures Studies of the development of the general synaptic markers synapsins and synaptophysin in cerebellar granule cells showed
Fig. 2. Representative immunoblots showing protein levels of VGLUT1 and VGLUT2 in cerebellar granule cells at different development stages. Notice the prominent difference between in vitro days 2 and 7.
Fig. 3. Quantitative development of vesicular proteins in cerebellar granule cells. Levels of VGLUT1 (A), VGLUT2 (B), synaptophysin (C), synapsin I (D) and synapsin IIIa (E) in cerebellar granule cells were determined by quantitative immunoblotting on in vitro days 2, 5, 7, 9 and 12 and are expressed as percent of mean levels from in vitro day 7. Data shown are mean S.E.M. from four to five separately prepared batches of granule cells, performed in duplicates. Note different y-axes.
582
O.E. Hallberg et al. / Neurochemistry International 48 (2006) 579–585
Fig. 5. mRNA expression of VGLUT1 and VGLUT2 in cerebellar granule cells. The mRNA expression of VGLUT1 and VGLUT2 in granule cells was quantified by real time PCR on in vitro days (DIV) 2 and 7. Data shown are expressed as percent of mean level from 7 DIV for VGLUT1 and VGLUT2, respectively. Note that the amount of mRNA encoding VGLUT1 was at least 1000- and 7000-fold higher than that of VGLUT2, measured at 2 DIV and 7 DIV, respectively.
Fig. 4. Quantitative development of vesicular proteins in cerebellar co-culture of granule cells and astrocytes. Levels of VGLUT1 (A), VGLUT2 (B), synaptophysin (C), synapsin I (D) and synapsin IIIa (E) in cerebellar co-culture were determined by quantitative immunoblotting on in vitro days 2, 5, 7, 9 and 12 and are expressed as percent of mean levels from in vitro day 7. Data shown are mean S.E.M. from four to five separately prepared batches of co-cultures, performed in duplicates. Note different y-axes.
2.3. Transcriptional regulation of VGLUT1 and VGLUT2 in cerebellar granule cells RT-PCR analysis showed that the mRNA concentration of VGLUT1 increased approximately two-fold from 2 DIV to 7 DIV, whereas the mRNA concentration of VGLUT2 decreased by approximately 60% from 2 DIV to 7 DIV (Fig. 5). The amount of mRNA encoding VGLUT1 was approximately 1000-fold higher at 2 DIV than that encoding VGLUT2 (DCT VGLUT1 0.2, DCT VGLUT2 10) and approximately 7000-fold higher at 7 DIV (DCT VGLUT1 1.1, DCT VGLUT2 11.7). 3. Discussion 3.1. Development and distribution of VGLUTs, synapsins and synaptophysin in cerebellar granule cells and cocultures In the intact, adult cerebellum, the different VGLUTs show distinct distributions. Mossy fibers are heterogeneous and many of them coexpress VGLUT1 and VGLUT2 (Hioki et al., 2003). In contrast, parallel fibers appear to express VGLUT1 only,
whereas climbing fibers are immunoreactive for VGLUT2 (Fremeau et al., 2001; Hioki et al., 2003). In this study, we have characterized the development of VGLUT1 and VGLUT2, as well as the general synaptic markers synapsin I, synapsin IIIa and synaptophysin in granule cell cultures and co-cultures. Our findings indicate a synchronized up-regulation of VGLUT1 and down-regulation of VGLUT2 protein levels in the developing cerebellar granule cells. These results are in agreement with studies performed on parallel fibers in rodents in vivo, which showed a subtype switch from VGLUT2 to VGLUT1 during early postnatal development. VGLUT2 was present during the first postnatal days, the level peaked at p7 and then declined dramatically (14-fold) towards adulthood (Miyazaki et al., 2003). Our results on protein levels were confirmed by RT-PCR analysis of the mRNA encoding VGLUT1 and VGLUT2. VGLUT1 expression was up-regulated and VGLUT2 downregulated from 2 DIV to 7 DIV. These studies also allowed us to demonstrate the strong quantitative dominance of VGLUT1 in granule cells in vitro, with VGLUT1 mRNA levels being more than 1000-fold higher than VGLUT2 mRNA at 2 DIV, and increasing to reach 7000-fold higher VGLUT1 mRNA levels at 7 DIV. A similar dramatic difference in VGLUT1 and VGLUT2 mRNA expression was observed in neocortical circuits (De Gois et al., 2005). In our study we did not find quantifiable levels of VGLUT3 in the granule cells at any time point (2–12 DIV). VGLUT3 expression in the cerebellum has been controversial for some time. VGLUT3 mRNA was first claimed to be present (Fremeau et al., 2002) and then not to be present (Gras et al., 2002; Schafer et al., 2002) in the granular, molecular and Purkinje cell layers. None of the groups could detect VGLUT3 protein by immunohistochemistry. Recent investigations have indicated that cerebellar deep nuclei stain heavily for VGLUT3 during early development (p0 and p4), and that transient levels of VGLUT3 may occur in GABAergic neurons in the cerebellum during early postnatal life (Boulland et al., 2004; Gras et al., 2005).
O.E. Hallberg et al. / Neurochemistry International 48 (2006) 579–585
It is interesting to compare the development of synapsin I, synaptophysin and VGLUT1, since all these proteins show a prominent increase almost simultaneously during development. Our results confirm a previous developmental study in cerebellar granule cells where glutamate vesicular release was shown to develop in parallel with synaptophysin (EhrhartBornstein et al., 1991). Synapsin IIIa showed a similar pattern during the first days in vitro with continuous increase during late development. Recent results showed how the development of VGLUT1 is coordinated with functional vesicle cycling (Wilson et al., 2005). Also, the organization of docked and reserve synaptic vesicle pools shows a dramatic change at the time when VGLUT1 expression is turned up (Mozhayeva et al., 2002), which may be necessary in the developing glutamatergic synapse. When comparing the levels of both VGLUTs, synapsins and synaptophysin in granule cell cultures and co-cultures at 7 DIV, we found lower levels of all proteins in co-cultured cells. Possible mechanisms for this difference could include higher cell mortality in co-cultures than in granule cell cultures, or an inhibition of granule cell development by astrocytes in coculture. 3.2. Distribution of VGLUTs in other parts of the brain VGLUT1 and VGLUT2 have an essentially complementary distribution in the adult brain, although a slight overlap is seen (Fremeau et al., 2001; Kaneko et al., 2002; Sakata-Haga et al., 2001). High levels of VGLUT1 are found in the cortex, with the exception of layer IV which contains VGLUT2 (Fremeau et al., 2001; Varoqui et al., 2002). Most terminals in the synaptic fields in the dentate gyrus, hippocampus, striatum and thalamus stain for VGLUT1, while very low levels are detected in the pons/ medulla (Bellocchio et al., 1998; Fremeau et al., 2001). In contrast, the highest levels of VGLUT2 are found in pons and brainstem, thalamus, hypothalamus and striatum, while lower levels are found in the cortex and hippocampus (Fremeau et al., 2001; Herzog et al., 2001; Varoqui et al., 2002). The ventral striatum, which is innervated by both VGLUT1- and VGLUT2expressing neurons, shows complementary distribution of the two transporters (Hartig et al., 2003). The mRNA encoding VGLUT1 is expressed in the cerebral cortex and hippocampus (Fremeau et al., 2001; Sakata-Haga et al., 2001; Varoqui et al., 2002). In contrast, VGLUT2 transcripts are expressed only in layers IV and VI of cortex, while regions in the brainstem and diencephalon express almost exclusively VGLUT2 (Fremeau et al., 2001; Herzog et al., 2001; Ni et al., 1995). VGLUT3 is expressed in much more restricted cell populations compared to VGLUT1 and VGLUT2 (Gras et al., 2002). Even more strikingly, VGLUT3 is found in populations of non-glutamatergic cells such as cholinergic interneurons in the striatum and nucleus accumbens, GABAergic interneurons in the cortex, hippocampus and interpeduncular nucleus, and in serotonergic neurons of the raphe nuclei (Fremeau et al., 2002; Gras et al., 2002; Schafer et al., 2002).
583
3.3. Development of VGLUTs in other parts of the brain Expression of the VGLUT genes is age-dependent. Immunoblots of embryonic brain showed low levels of VGLUT1 at days 15 and 18, more pronounced levels of VGLUT2 were seen at day 18. VGLUT3 staining was not found at these embryonic stages (Boulland et al., 2004). VGLUT1 immunoreactivity is barely seen at birth but increases dramatically during postnatal development. In the first postnatal week, VGLUT1 expression is particularly striking in the deep layer of the cerebral cortex, the hippocampus, striatum and the olfactory bulbs (Boulland et al., 2004; Gras et al., 2005). Levels of VGLUT1 increase towards adulthood in the thalamus and hypothalamus reaching adult values around p15 (Boulland et al., 2004; Gras et al., 2005). VGLUT2 levels at birth have been found to represent about 40–50% of the maximum (Boulland et al., 2004; Gras et al., 2005), with high levels seen in the thalamus, hypothalamus, midbrain and pons. Towards adult age, VGLUT2 levels decline in several regions, such as the cortex, hippocampus and cerebellum (Boulland et al., 2004; Gras et al., 2005). VGLUT3 levels are high at birth (20–60% of adult values) and show a bimodal developmental profile, peaking around P10, decreasing until P15 and raising again towards adulthood (Boulland et al., 2004; Gras et al., 2005). 3.4. Subtype switch of VGLUTs The vesicular uptake of glutamate in rat brain increases from birth to 30 days of age (Christensen and Fonnum, 1992). This indicates a close connection between increasing VGLUT1 levels and an increase in uptake activity. Moreover, phenotypic characterization of VGLUT1-deficient mice has shown that the animals live for about 2 weeks after birth without major abnormalities, but then die between p18 and p21 unless specific care is provided (Fremeau et al., 2004; Wojcik et al., 2004). Thus, VGLUT1 becomes essential for survival at the time of the developmental switch from VGLUT2 to VGLUT1 in the CNS (Miyazaki et al., 2003). Further, several general synaptic properties evolve during postnatal VGLUT1 up-regulation. The probability of transmitter release shows a major decrease during this period (Bolshakov and Siegelbaum, 1995), and it has been suggested that VGLUT isoforms may correlate with the glutamate release probability (Fremeau et al., 2004). This proposal was, however, not supported by in vitro experiments, arguing the possibility that the VGLUT isoform determines or has a major role in determining the release probability of the neuron (Wojcik et al., 2004). Findings of VGLUT1 and VGLUT2 prenatally and high levels of VGLUT2 and VGLUT3 during early postnatal development are particularly interesting, considering that synaptogenesis takes place after p7 in rats (Aghajanian and Bloom, 1967; Gras et al., 2005). It has been proposed that the high early postnatal level of VGLUT2, and perhaps also VGLUT3, is important for the need for continuous activation of NMDA receptors to stimulate cell migration and differentiation and synaptic remodeling (Boulland et al., 2004).
584
O.E. Hallberg et al. / Neurochemistry International 48 (2006) 579–585
In conclusion, we have shown that cerebellar granule cells are mature on day 7 in vitro. Our studies have also shown that the switch between VGLUT1 and VGLUT2, previously found in vivo, occurs in vitro in granular cell culture without synaptic input from mossy fiber terminals and surrounding astrocytes. Hence, isolated cultures of these cells retain a number of genetic and functional properties, making them suitable for brain studies in vitro. References Aghajanian, G.K., Bloom, F.E., 1967. The formation of synaptic junctions in developing rat brain: a quantitative electron microscopic study. Brain Res. 6, 716–727. Balazs, R., Hajos, F., Michaelson, I.A., Tapia, R., Wilkin, G., 1972. Isolation of a fraction from rat cerebellum enriched in nerve terminals of one single type (mossy-fibre terminals). Biochem. J. 128, 81P–82P. Barberis, A., Lu, C., Vicini, S., Mozrzymas, J.W., 2005. Developmental changes of GABA synaptic transient in cerebellar granule cells. Mol. Pharmacol. 67, 1221–1228. Bellocchio, E.E., Hu, H., Pohorille, A., Chan, J., Pickel, V.M., Edwards, R.H., 1998. The localization of the brain-specific inorganic phosphate transporter suggests a specific presynaptic role in glutamatergic transmission. J. Neurosci. 18, 8648–8659. Bogen, I.L., Boulland, J.L., Mariussen, E., Wright, M.S., Fonnum, F., Kao, H.T., Walaas, S.I., 2006. Absence of synapsin I and II is accompanied by decreases in vesicular transport of specific neurotransmitters. J. Neurochem. 96, 1458–1466. Bolshakov, V.Y., Siegelbaum, S.A., 1995. Regulation of hippocampal transmitter release during development and long-term potentiation. Science 269, 1730–1734. Boulland, J.L., Qureshi, T., Seal, R.P., Rafiki, A., Gundersen, V., Bergersen, L.H., Fremeau Jr., R.T., Edwards, R.H., Storm-Mathisen, J., Chaudhry, F.A., 2004. Expression of the vesicular glutamate transporters during development indicates the widespread corelease of multiple neurotransmitters. J. Comp. Neurol. 480, 264–280. Christensen, H., Fonnum, F., 1992. The ontogeny of the uptake systems for glutamate, GABA, and glycine in synaptic vesicles isolated from rat brain. Neurochem. Res. 17, 457–462. De Gois, S., Schafer, M.K., Defamie, N., Chen, C., Ricci, A., Weihe, E., Varoqui, H., Erickson, J.D., 2005. Homeostatic scaling of vesicular glutamate and GABA transporter expression in rat neocortical circuits. J. Neurosci. 25, 7121–7133. Dittman, J.S., Regehr, W.G., 1997. Mechanism and kinetics of heterosynaptic depression at a cerebellar synapse. J. Neurosci. 17, 9048–9059. Ehrhart-Bornstein, M., Treiman, M., Hansen, G.H., Schousboe, A., Thorn, N.A., Frandsen, A., 1991. Parallel expression of synaptophysin and evoked neurotransmitter release during development of cultured neurons. Int. J. Dev. Neurosci. 9, 439–447. Fonnum, F., Fykse, E.M., Roseth, S., 1998. Uptake of glutamate into synaptic vesicles. Prog. Brain Res. 116, 87–101. Fonnum, F., Lock, E.A., 2004. The contributions of excitotoxicity, glutathione depletion and DNA repair in chemically induced injury to neurones: exemplified with toxic effects on cerebellar granule cells. J. Neurochem. 88, 513–531. Fremeau Jr., R.T., Burman, J., Qureshi, T., Tran, C.H., Proctor, J., Johnson, J., Zhang, H., Sulzer, D., Copenhagen, D.R., Storm-Mathisen, J., Reimer, R.J., Chaudhry, F.A., Edwards, R.H., 2002. The identification of vesicular glutamate transporter 3 suggests novel modes of signaling by glutamate. Proc. Natl. Acad. Sci. U.S.A. 99, 14488–14493. Fremeau Jr., R.T., Troyer, M.D., Pahner, I., Nygaard, G.O., Tran, C.H., Reimer, R.J., Bellocchio, E.E., Fortin, D., Storm-Mathisen, J., Edwards, R.H., 2001. The expression of vesicular glutamate transporters defines two classes of excitatory synapse. Neuron 31, 247–260.
Fremeau Jr., R.T., Voglmaier, S., Seal, R.P., Edwards, R.H., 2004. VGLUTs define subsets of excitatory neurons and suggest novel roles for glutamate. Trends Neurosci. 27, 98–103. Gras, C., Herzog, E., Bellenchi, G.C., Bernard, V., Ravassard, P., Pohl, M., Gasnier, B., Giros, B., El Mestikawy, S., 2002. A third vesicular glutamate transporter expressed by cholinergic and serotoninergic neurons. J. Neurosci. 22, 5442–5451. Gras, C., Vinatier, J., Amilhon, B., Guerci, A., Christov, C., Ravassard, P., Giros, B., El Mestikawy, S., 2005. Developmentally regulated expression of VGLUT3 during early post-natal life. Neuropharmacology 49, 901–911. Hartig, W., Riedel, A., Grosche, J., Edwards, R.H., Fremeau Jr., R.T., Harkany, T., Brauer, K., Arendt, T., 2003. Complementary distribution of vesicular glutamate transporters 1 and 2 in the nucleus accumbens of rat: relationship to calretinin-containing extrinsic innervation and calbindin-immunoreactive neurons. J. Comp. Neurol. 465, 1–10. Herzog, E., Bellenchi, G.C., Gras, C., Bernard, V., Ravassard, P., Bedet, C., Gasnier, B., Giros, B., El Mestikawy, S., 2001. The existence of a second vesicular glutamate transporter specifies subpopulations of glutamatergic neurons. J. Neurosci. 21, RC181. Hioki, H., Fujiyama, F., Taki, K., Tomioka, R., Furuta, T., Tamamaki, N., Kaneko, T., 2003. Differential distribution of vesicular glutamate transporters in the rat cerebellar cortex. Neuroscience 117, 1–6. Hisano, S., 2003. Vesicular glutamate transporters in the brain. Anat. Sci. Int. 78, 191–204. Kaneko, T., Fujiyama, F., Hioki, H., 2002. Immunohistochemical localization of candidates for vesicular glutamate transporters in the rat brain. J. Comp. Neurol. 444, 39–62. Livak, J.K., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2DDCT method. Methods 25, 402– 408. Lowry, O.H., 1953. The quantitative histochemistry of the brain. J. Histochem. 6, 420–428. Marini, A.M., Schwartz, J.P., Kopin, I.J., 1989. The neurotoxicity of 1-methyl4-phenylpyridinium in cultured cerebellar granule cells. J. Neurosci. 9, 3665–3672. Miyazaki, T., Fukaya, M., Shimizu, H., Watanabe, M., 2003. Subtype switching of vesicular glutamate transporters at parallel fibre-Purkinje cell synapses in developing mouse cerebellum. Eur. J. Neurosci. 17, 2563–2572. Mozhayeva, M.G., Sara, Y., Liu, X., Kavalali, E.T., 2002. Development of vesicle pools during maturation of hippocampal synapses. J. Neurosci. 22, 654–665. Ni, B., Rosteck Jr., P.R., Nadi, N.S., Paul, S.M., 1994. Cloning and expression of a cDNA encoding a brain-specific Na(+)-dependent inorganic phosphate cotransporter. Proc. Natl. Acad. Sci. U.S.A. 91, 5607–5611. Ni, B., Wu, X., Yan, G.M., Wang, J., Paul, S.M., 1995. Regional expression and cellular localization of the Na(+)-dependent inorganic phosphate cotransporter of rat brain. J. Neurosci. 15, 5789–5799. Sakata-Haga, H., Kanemoto, M., Maruyama, D., Hoshi, K., Mogi, K., Narita, M., Okado, N., Ikeda, Y., Nogami, H., Fukui, Y., Kojima, I., Takeda, J., Hisano, S., 2001. Differential localization and colocalization of two neurontypes of sodium-dependent inorganic phosphate cotransporters in rat forebrain. Brain Res. 902, 143–155. Salinovich, O., Montelaro, R.C., 1986. Reversible staining and peptide mapping of proteins transferred to nitrocellulose after separation by sodium dodecylsulfate-polyacrylamide gel electrophoresis. Anal. Biochem. 156, 341– 347. Schafer, M.K., Varoqui, H., Defamie, N., Weihe, E., Erickson, J.D., 2002. Molecular cloning and functional identification of mouse vesicular glutamate transporter 3 and its expression in subsets of novel excitatory neurons. J. Biol. Chem. 277, 50734–50748. Schousboe, A., Meier, E., Drejer, J., Hertz, L., 1989. Preparation of primary cultures of mouse (rat) cerebellar granule cells. In: A Dissection and Tissue Culture Manual of the Nervous System, Alan R. Liss, New York, pp. 203–206. Smith, P.K., Krohn, R.I., Hermanson, G.T., Mallia, A.K., Gartner, F.H., Provenzano, M.D., Fujimoto, E.K., Goeke, N.M., Olson, B.J., Klenk, D.C., 1985. Measurement of protein using bicinchoninic acid. Anal. Biochem. 150, 76–85.
O.E. Hallberg et al. / Neurochemistry International 48 (2006) 579–585 Towbin, H., Staehelin, T., Gordon, J., 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. U.S.A. 76, 4350–4354. Varoqui, H., Schafer, M.K., Zhu, H., Weihe, E., Erickson, J.D., 2002. Identification of the differentiation-associated Na+/PI transporter as a novel vesicular glutamate transporter expressed in a distinct set of glutamatergic synapses. J. Neurosci. 22, 142–155. Waagepetersen, H.S., Sonnewald, U., Larsson, O.M., Schousboe, A., 2000. A possible role of alanine for ammonia transfer between astrocytes and glutamatergic neurons. J. Neurochem. 75, 471–479.
585
Wilson, N.R., Kang, J., Hueske, E.V., Leung, T., Varoqui, H., Murnick, J.G., Erickson, J.D., Liu, G., 2005. Presynaptic regulation of quantal size by the vesicular glutamate transporter VGLUT1. J. Neurosci. 25, 6221–6234. Wojcik, S.M., Rhee, J.S., Herzog, E., Sigler, A., Jahn, R., Takamori, S., Brose, N., Rosenmund, C., 2004. An essential role for vesicular glutamate transporter 1 (VGLUT1) in postnatal development and control of quantal size. Proc. Natl. Acad. Sci. U.S.A. 101, 7158–7163. Zhang, N., Ottersen, O.P., 1993. In search of the identity of the cerebellar climbing fiber transmitter: immunocytochemical studies in rats. Can. J. Neurol. Sci. 20 (Suppl. 3), S36–S42.
Differential development of vesicular glutamate transporters in brain: An in vitro study of cerebellar granule cells Olof Ehlers Hallberg a,b, Inger Lise Bogen a,b,1, Trine Reistad c,1, Kristin Huse Haug a,b, Marianne S. Wright d, Frode Fonnum b, S. Ivar Walaas a,b,* a
Department of Biochemistry, Institute of Basic Medical Sciences, University of Oslo, P.O. Box 1112, Blindern, N-0317 Oslo, Norway b Molecular Neurobiology Research Group, Faculty of Medicine, University of Oslo, N-0317 Oslo, Norway c Norwegian Defence Research Establishment, N-2027 Kjeller, Norway d Department of Pediatric Research, Rikshospitalet University Hospital, N-0027 Oslo, Norway Received 20 October 2005; received in revised form 22 December 2005; accepted 22 December 2005 Available online 3 March 2006
Abstract The cerebellar granule cells have been extensively used for studies on metabolism, neurotransmission and neurotoxicology, since they can easily be grown in cultures. However, knowledge about the development of different proteins essential for synaptic transmission in these cells is lacking. This study has characterized the developmental profiles of the vesicular glutamate transporters (VGLUTs) and the synaptic vesicle proteins synapsins and synaptophysin in cerebellar granule cells and in co-cultures containing both granule cells and astrocytes. The protein levels of VGLUT2 decreased by approximately 70% from days 2 to 7 in vitro, whereas the levels of VGLUT1 increased by approximately 95%. Protein levels of synapsin I, synapsin IIIa and synaptophysin showed a developmental pattern similar to VGLUT1 while synapsin II and VGLUT3 were absent. The mRNA expressions of VGLUT1 and VGLUT2 were in accordance with the protein levels. The results indicate both that cerebellar granule cells are mature at approximately 7 days in vitro, and that the up-regulation of VGLUT1 and down-regulation of VGLUT2 in cerebellar granule cells are both independent of surrounding astrocytes and neuronal input. The results of this study are discussed in relation to general developmental profiles of VGLUTs in other brain regions. # 2006 Elsevier Ltd. All rights reserved. Keywords: Cerebellar granule cells; Co-culture; Development; Synapsin; Vesicular glutamate transporters
The cerebellar granule cells account for about half of the total number of neurons found in the brain. The granular cells constitute a broad single layer in the cerebellar cortex, from where they can easily be dissected (Lowry, 1953) and even be isolated by cell fractionation (Balazs et al., 1972). The external germinal layer of the cerebellum forms a swamp-like structure at birth, which migrates and gives rise to the granular cell layer between postnatal days 7 and 15 (p7–p15) with a peak at days p10–p11 (Schousboe et al., 1989). This postnatal development, taken together with the fact that different cell types in the cerebellum develop at different times, has made it possible to isolate the granule cells as primary neuronal cultures. In the intact cerebellum, the granule cells are innervated by the mossy fibers which originate in, e.g. the pontine nuclei, the spinal cord and the vestibular system. The granule cell axons, designated * Corresponding author. Tel.: +47 22 85 11 28; fax: +47 22 85 14 36. E-mail address: [email protected] (S.I. Walaas). 1 These authors contributed equally. 0197-0186/$ – see front matter # 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.neuint.2005.12.027
parallel fibers, directly contact and activate the Purkinje cells, which constitute the only output from the cerebellar cortex and project inhibitory fibers to the deep cerebellar nuclei. While Purkinje cells employ gamma-aminobutyrate (GABA) as their inhibitory transmitter, both mossy fibers as well as parallel fibers and climbing fibers use L-glutamate as their main transmitter (Zhang and Ottersen, 1993). The process of glutamate uptake into synaptic vesicles is energy requiring, and also depends on a proton pump and a low concentration of chloride ions (Fonnum et al., 1998). At present, three vesicular glutamate transporters (VGLUT1, VGLUT2 and VGLUT3) have been identified and characterized within a family of Na/Pi transporters (Fremeau et al., 2001; Gras et al., 2002; Ni et al., 1994). The three transporters share more than 70% amino acid sequence identity and accumulate glutamate with similar bioenergetical and pharmacological characteristics (Hisano, 2003). Cultures of cerebellar granule cells have been extensively used to study brain metabolism (Waagepetersen et al., 2000), neurotoxicity (Fonnum and Lock, 2004; Marini et al., 1989) and
580
O.E. Hallberg et al. / Neurochemistry International 48 (2006) 579–585
synaptic mechanisms and development (Barberis et al., 2005; Dittman and Regehr, 1997). Despite this, a complete characterization of pre- and postsynaptic transporters and receptors in the synapse during development in vitro is lacking. A comparison of development in vitro and in vivo would help us to evaluate whether isolated granule cells retain their biological properties in vitro. From in vivo studies we know that VGLUT1, VGLUT2 and VGLUT3 show distinct localizations and developmental profiles in the cerebellum. In this study, we have investigated the development of the three VGLUT proteins, the synapsins and synaptophysin in granule cell cultures and co-cultures. Our data indicate that the cerebellar granule cells in vitro mimic the development seen in situ, supporting the use of this preparation for functional and toxicological in vitro studies. Our results are compared to the general developmental profiles of VGLUTs in other brain regions. 1. Experimental procedures 1.1. Animals Seven-day-old Wistar rat pups were used for preparation of cerebellar granule cells and co-culture of granule cells and astrocytes. Animals were treated according to the Norwegian Animal Welfare Act and the European Communities Council Directive of 24 November 1986 (86/609/EEC). Efforts were made to minimize animal suffering and to reduce the number of animals used.
1.2. Antibodies Antiserum against VGLUT1 was raised in rabbits against a synthetic 15 amino acid peptide (STVQPPRPPPPVRDY) derived from the C-terminal part of the published sequence of brain Na+-dependent inorganic phosphate cotransporter 1 (BNPI-1) (Ni et al., 1994) as previously described by Bogen et al. (2006). Primary antibodies against VGLUT2 and VGLUT3 were obtained from Chemicon (Temecula, CA, USA), antibody against synaptophysin was obtained from Sigma Immuno Chemicals (St. Louis, MO, USA), antibodies against synapsin Ia/b and synapsin IIa/b were obtained from Stressgen Biotechnologies (San Diego, CA, USA), while antibody against synapsin IIIa was obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Secondary anti-rabbit Ig horseradish peroxidase (HRP) and anti-mouse Ig HRP were obtained from Amersham Biosciences (Buckinghamshire, UK), while secondary antiguinea pig Ig HRP and anti-goat Ig HRP were obtained from Santa Cruz Biotechnology.
1.3. Preparation of cerebellar granule cells and co-culture Primary cultured neurons from rat cerebellum were isolated mainly as previously described (Schousboe et al., 1989). The cerebella from 7-day-old pups were dissected under sterile conditions and the brain tissue was then mechanically dissected from the meninges, trypsinized and chopped in buffered solution. The cells were seeded (106 cells/ml) in basal Eagle’s medium (containing 10% heat inactivated fetal bovine serum, 25 mM KCl, 2 mM L-glutamine, 100 IU/ml penicillin and 100 mg/ml streptomycin) and plated into 50 mm cell culture dishes that had been coated previously with poly-L-lysine (10 mg/ ml). These cells were designated ‘‘co-cultures’’ of granule cells and astrocytes. For preparation of cerebellar granule cells, the procedure was performed as described above, with the addition of cytosine b-D-arabinofuranoside (final concentration 2.5 mg/ml) 16–22 h after seeding in order to prevent growth of astrocytes. Both granule cells and co-cultures were grown at 37 8C with 5% CO2. Images of granule cells were taken on days 2, 5, 7, 9 and 12 in vitro with an Olympus IMT-2 light microscope connected to an Olympus Camedia C5060 camera.
1.4. Quantification of synaptic proteins Granule cells and co-cultures of granule cells and astrocytes were harvested 2, 5, 7, 9 or 12 days after seeding. The cells were washed twice with PBS, 150 ml lysis buffer (PBS with 1% sodium dodecyl sulphate) was added and cells were harvested with a cell scrape. The cell lysate was boiled for 2 min and stored at 40 8C before analysis. After protein determination (BCA protein assay, Pierce, Rockford, IL, USA; Smith et al., 1985), sample buffer was added (final concentration 2% sodium dodecyl sulphate, 10% glycerol, 50 mM Tris/HCl (pH 6.8), 0.25% bromophenol blue, 0.1 M dithiothreitol) and samples were boiled for 5 min. Equal amounts of total protein (5 or 10 mg/lane) were subjected to sodium dodecyl sulphate-polyacrylamide gel electrophoresis on 10% polyacrylamide gels. The separated proteins were electrophoretically transferred overnight (Towbin et al., 1979) to nitrocellulose membranes (0.2 mm pore size, BioRad, CA, USA) and stained with 0.2% Ponceau S (Salinovich and Montelaro, 1986). Individual proteins were quantified by immunoblotting with different primary antibodies, employing enhanced chemiluminescence Plus reagent (Amersham) for detection. The signals were visualized on Hyperfilm MP (Amersham) and scanned in a desktop scanner (Scan Jet 3c, Hewlett Packard, Houston, TX, USA) at 400 dpi. Densitometric quantifications were analyzed in Adobe Photoshop (Version 6.0). Immunoblotting was performed in duplicates from four to five separately prepared batches of granule cell cultures or co-cultures.
1.5. Total RNA preparation and reverse transcription Total RNA from three independent preparations of cerebellar granule cell cultures, harvested on days 2 and 7 after seeding, was isolated using the RNeasy Mini KitTM (Qiagen Sciences, Valencia, CA, USA), treated with DNase I (Qiagen GmbH, Hilden, Germany) and RNAguard (Amersham Biosciences, Piscataway, NJ, USA). RNA fractions exhibited a ratio of OD260/OD280 between 1.8 and 2.0, and RNA concentration was assayed using OD260-values. 2.5 mg RNA was reverse transcribed using the High-Capacity cDNA Archive Kit (Applied Biosystem Inc., Foster City, CA, USA) with random hexamers as primers. The cDNA was kept frozen at 20 8C until use for real-time PCR analysis.
1.6. Real-time PCR A one-step RT-PCR was performed in separate tubes containing 20 ng RNA for both target genes and endogenous control. The following specific primers for rat VGLUT1 and rat VGLUT2 and the housekeeping gene rat peptidyl prolyl isomerase A (PPIA), synthesized by Invitrogen, were used at 600 nM: VGLUT1 (GenBank accession no. NM_053859) 50 -GCAGTTTCCAGGACCTCCACT (sense), 50 -CAAGAGGCAGTTGAGAAGGAGAG (antisense); VGLUT2 (GenBank accession no. NM_053427) 50 -GGTATTTGGTCTGTTTGGTGTCCT (sense), 50 -CAGCACAGCAAGGGTTATGGT (antisense); and PPIA (GenBank accession no. NM_017101) 50 -GAAGCATACAGGTCCTGGCAT (sense), 50 TCACTTTCCCAAAGACCACA (antisense). Expression of VGLUT1, VGLUT2 and PPIA was analyzed using the SYBR Green PCR Master mix (Applied Biosystems) in an ABI PRISM1 7000 Sequence Detection System (Applied Biosystems) employing universal instrument settings with an annealing/extension temperature of 60 8C for 1 min (40 repeats). Two separate cDNA preparations from three independent preparations of granular cell cultures, followed by three independent PCR analyses with duplicate samples, were performed. Samples were compared using relative threshold cycle (CT) values, with PPIA as the endogenous control. The fold increase or decrease was determined relative to the expression on day 7 in vitro after normalizing to PPIA using 2DDCT (Livak and Schmittgen, 2001), where DCT is (VGLUT1 CT or VGLUT2 CT) (PPIA CT) and DDCT is (DCT day 2) (DCT day 7). Efficiency curves with different primer and template concentrations were performed (data not shown).
2. Results 2.1. Development of VGLUT1 and VGLUT2 in cerebellar granule cells and co-cultures Light-microscopic images of cerebellar granule cells show extensive networks of axons and dendrites from day 7 in vitro
O.E. Hallberg et al. / Neurochemistry International 48 (2006) 579–585
581
Fig. 1. Images of development of cerebellar granular cells. Images were taken on days 2, 5, 7, 9 and 12 in vitro (DIV), using an Olympus IMT-2 light microscope connected to an Olympus Camedia C5060 camera.
(Fig. 1). Representative immunoblots of VGLUT1 and VGLUT2 in cerebellar granule cells (Fig. 2) show a progressive increase of VGLUT1 during development and a decrease of VGLUT2. In the following experiments, 7 DIV was set arbitrarily as 100%. VGLUT1 levels were approximately 5% (of 7 DIV) at 2 DIV, approximately 25% at 5 DIV and then increased approximately 75% from days 5 to 7 in vitro (Fig. 3A). In contrast to VGLUT1, VGLUT2 showed an approximately 70% decrease from 2 DIV to 7 DIVand continuously decreasing levels towards 12 DIV (25% of 2 DIV) (Fig. 3B). VGLUT3 could not be detected at any developmental stage. Similar analyses were performed in cerebellar co-cultures, where VGLUT1 and VGLUT2 followed the same development patterns as in granule cell cultures (Fig. 4A and B). However, the increase in VGLUT1 levels appeared earlier in co-culture compared to granule cells with approximately 85% of 7 DIV level at 5 DIV. Analysis of VGLUT2 in co-culture showed an almost eight-fold decrease from 2 DIV to 12 DIV. Finally, the concentrations of VGLUT1 and VGLUT2 in the two different types of cultures at 7 DIV were compared. The levels of VGLUT1 in co-culture reached approximately 35% of those in granule cell cultures, whereas VGLUT2 reached approximately 40%.
that synapsin I, synapsin IIIa and synaptophysin levels increase during development (Fig. 3C–E), similar to VGLUT1. The same developmental patterns were seen in co-cultures (Fig. 4C–E). Synapsin II could not be detected at any of the developmental stages tested.
2.2. Development of synapsins and synaptophysin in cerebellar granule cells and co-cultures Studies of the development of the general synaptic markers synapsins and synaptophysin in cerebellar granule cells showed
Fig. 2. Representative immunoblots showing protein levels of VGLUT1 and VGLUT2 in cerebellar granule cells at different development stages. Notice the prominent difference between in vitro days 2 and 7.
Fig. 3. Quantitative development of vesicular proteins in cerebellar granule cells. Levels of VGLUT1 (A), VGLUT2 (B), synaptophysin (C), synapsin I (D) and synapsin IIIa (E) in cerebellar granule cells were determined by quantitative immunoblotting on in vitro days 2, 5, 7, 9 and 12 and are expressed as percent of mean levels from in vitro day 7. Data shown are mean S.E.M. from four to five separately prepared batches of granule cells, performed in duplicates. Note different y-axes.
582
O.E. Hallberg et al. / Neurochemistry International 48 (2006) 579–585
Fig. 5. mRNA expression of VGLUT1 and VGLUT2 in cerebellar granule cells. The mRNA expression of VGLUT1 and VGLUT2 in granule cells was quantified by real time PCR on in vitro days (DIV) 2 and 7. Data shown are expressed as percent of mean level from 7 DIV for VGLUT1 and VGLUT2, respectively. Note that the amount of mRNA encoding VGLUT1 was at least 1000- and 7000-fold higher than that of VGLUT2, measured at 2 DIV and 7 DIV, respectively.
Fig. 4. Quantitative development of vesicular proteins in cerebellar co-culture of granule cells and astrocytes. Levels of VGLUT1 (A), VGLUT2 (B), synaptophysin (C), synapsin I (D) and synapsin IIIa (E) in cerebellar co-culture were determined by quantitative immunoblotting on in vitro days 2, 5, 7, 9 and 12 and are expressed as percent of mean levels from in vitro day 7. Data shown are mean S.E.M. from four to five separately prepared batches of co-cultures, performed in duplicates. Note different y-axes.
2.3. Transcriptional regulation of VGLUT1 and VGLUT2 in cerebellar granule cells RT-PCR analysis showed that the mRNA concentration of VGLUT1 increased approximately two-fold from 2 DIV to 7 DIV, whereas the mRNA concentration of VGLUT2 decreased by approximately 60% from 2 DIV to 7 DIV (Fig. 5). The amount of mRNA encoding VGLUT1 was approximately 1000-fold higher at 2 DIV than that encoding VGLUT2 (DCT VGLUT1 0.2, DCT VGLUT2 10) and approximately 7000-fold higher at 7 DIV (DCT VGLUT1 1.1, DCT VGLUT2 11.7). 3. Discussion 3.1. Development and distribution of VGLUTs, synapsins and synaptophysin in cerebellar granule cells and cocultures In the intact, adult cerebellum, the different VGLUTs show distinct distributions. Mossy fibers are heterogeneous and many of them coexpress VGLUT1 and VGLUT2 (Hioki et al., 2003). In contrast, parallel fibers appear to express VGLUT1 only,
whereas climbing fibers are immunoreactive for VGLUT2 (Fremeau et al., 2001; Hioki et al., 2003). In this study, we have characterized the development of VGLUT1 and VGLUT2, as well as the general synaptic markers synapsin I, synapsin IIIa and synaptophysin in granule cell cultures and co-cultures. Our findings indicate a synchronized up-regulation of VGLUT1 and down-regulation of VGLUT2 protein levels in the developing cerebellar granule cells. These results are in agreement with studies performed on parallel fibers in rodents in vivo, which showed a subtype switch from VGLUT2 to VGLUT1 during early postnatal development. VGLUT2 was present during the first postnatal days, the level peaked at p7 and then declined dramatically (14-fold) towards adulthood (Miyazaki et al., 2003). Our results on protein levels were confirmed by RT-PCR analysis of the mRNA encoding VGLUT1 and VGLUT2. VGLUT1 expression was up-regulated and VGLUT2 downregulated from 2 DIV to 7 DIV. These studies also allowed us to demonstrate the strong quantitative dominance of VGLUT1 in granule cells in vitro, with VGLUT1 mRNA levels being more than 1000-fold higher than VGLUT2 mRNA at 2 DIV, and increasing to reach 7000-fold higher VGLUT1 mRNA levels at 7 DIV. A similar dramatic difference in VGLUT1 and VGLUT2 mRNA expression was observed in neocortical circuits (De Gois et al., 2005). In our study we did not find quantifiable levels of VGLUT3 in the granule cells at any time point (2–12 DIV). VGLUT3 expression in the cerebellum has been controversial for some time. VGLUT3 mRNA was first claimed to be present (Fremeau et al., 2002) and then not to be present (Gras et al., 2002; Schafer et al., 2002) in the granular, molecular and Purkinje cell layers. None of the groups could detect VGLUT3 protein by immunohistochemistry. Recent investigations have indicated that cerebellar deep nuclei stain heavily for VGLUT3 during early development (p0 and p4), and that transient levels of VGLUT3 may occur in GABAergic neurons in the cerebellum during early postnatal life (Boulland et al., 2004; Gras et al., 2005).
O.E. Hallberg et al. / Neurochemistry International 48 (2006) 579–585
It is interesting to compare the development of synapsin I, synaptophysin and VGLUT1, since all these proteins show a prominent increase almost simultaneously during development. Our results confirm a previous developmental study in cerebellar granule cells where glutamate vesicular release was shown to develop in parallel with synaptophysin (EhrhartBornstein et al., 1991). Synapsin IIIa showed a similar pattern during the first days in vitro with continuous increase during late development. Recent results showed how the development of VGLUT1 is coordinated with functional vesicle cycling (Wilson et al., 2005). Also, the organization of docked and reserve synaptic vesicle pools shows a dramatic change at the time when VGLUT1 expression is turned up (Mozhayeva et al., 2002), which may be necessary in the developing glutamatergic synapse. When comparing the levels of both VGLUTs, synapsins and synaptophysin in granule cell cultures and co-cultures at 7 DIV, we found lower levels of all proteins in co-cultured cells. Possible mechanisms for this difference could include higher cell mortality in co-cultures than in granule cell cultures, or an inhibition of granule cell development by astrocytes in coculture. 3.2. Distribution of VGLUTs in other parts of the brain VGLUT1 and VGLUT2 have an essentially complementary distribution in the adult brain, although a slight overlap is seen (Fremeau et al., 2001; Kaneko et al., 2002; Sakata-Haga et al., 2001). High levels of VGLUT1 are found in the cortex, with the exception of layer IV which contains VGLUT2 (Fremeau et al., 2001; Varoqui et al., 2002). Most terminals in the synaptic fields in the dentate gyrus, hippocampus, striatum and thalamus stain for VGLUT1, while very low levels are detected in the pons/ medulla (Bellocchio et al., 1998; Fremeau et al., 2001). In contrast, the highest levels of VGLUT2 are found in pons and brainstem, thalamus, hypothalamus and striatum, while lower levels are found in the cortex and hippocampus (Fremeau et al., 2001; Herzog et al., 2001; Varoqui et al., 2002). The ventral striatum, which is innervated by both VGLUT1- and VGLUT2expressing neurons, shows complementary distribution of the two transporters (Hartig et al., 2003). The mRNA encoding VGLUT1 is expressed in the cerebral cortex and hippocampus (Fremeau et al., 2001; Sakata-Haga et al., 2001; Varoqui et al., 2002). In contrast, VGLUT2 transcripts are expressed only in layers IV and VI of cortex, while regions in the brainstem and diencephalon express almost exclusively VGLUT2 (Fremeau et al., 2001; Herzog et al., 2001; Ni et al., 1995). VGLUT3 is expressed in much more restricted cell populations compared to VGLUT1 and VGLUT2 (Gras et al., 2002). Even more strikingly, VGLUT3 is found in populations of non-glutamatergic cells such as cholinergic interneurons in the striatum and nucleus accumbens, GABAergic interneurons in the cortex, hippocampus and interpeduncular nucleus, and in serotonergic neurons of the raphe nuclei (Fremeau et al., 2002; Gras et al., 2002; Schafer et al., 2002).
583
3.3. Development of VGLUTs in other parts of the brain Expression of the VGLUT genes is age-dependent. Immunoblots of embryonic brain showed low levels of VGLUT1 at days 15 and 18, more pronounced levels of VGLUT2 were seen at day 18. VGLUT3 staining was not found at these embryonic stages (Boulland et al., 2004). VGLUT1 immunoreactivity is barely seen at birth but increases dramatically during postnatal development. In the first postnatal week, VGLUT1 expression is particularly striking in the deep layer of the cerebral cortex, the hippocampus, striatum and the olfactory bulbs (Boulland et al., 2004; Gras et al., 2005). Levels of VGLUT1 increase towards adulthood in the thalamus and hypothalamus reaching adult values around p15 (Boulland et al., 2004; Gras et al., 2005). VGLUT2 levels at birth have been found to represent about 40–50% of the maximum (Boulland et al., 2004; Gras et al., 2005), with high levels seen in the thalamus, hypothalamus, midbrain and pons. Towards adult age, VGLUT2 levels decline in several regions, such as the cortex, hippocampus and cerebellum (Boulland et al., 2004; Gras et al., 2005). VGLUT3 levels are high at birth (20–60% of adult values) and show a bimodal developmental profile, peaking around P10, decreasing until P15 and raising again towards adulthood (Boulland et al., 2004; Gras et al., 2005). 3.4. Subtype switch of VGLUTs The vesicular uptake of glutamate in rat brain increases from birth to 30 days of age (Christensen and Fonnum, 1992). This indicates a close connection between increasing VGLUT1 levels and an increase in uptake activity. Moreover, phenotypic characterization of VGLUT1-deficient mice has shown that the animals live for about 2 weeks after birth without major abnormalities, but then die between p18 and p21 unless specific care is provided (Fremeau et al., 2004; Wojcik et al., 2004). Thus, VGLUT1 becomes essential for survival at the time of the developmental switch from VGLUT2 to VGLUT1 in the CNS (Miyazaki et al., 2003). Further, several general synaptic properties evolve during postnatal VGLUT1 up-regulation. The probability of transmitter release shows a major decrease during this period (Bolshakov and Siegelbaum, 1995), and it has been suggested that VGLUT isoforms may correlate with the glutamate release probability (Fremeau et al., 2004). This proposal was, however, not supported by in vitro experiments, arguing the possibility that the VGLUT isoform determines or has a major role in determining the release probability of the neuron (Wojcik et al., 2004). Findings of VGLUT1 and VGLUT2 prenatally and high levels of VGLUT2 and VGLUT3 during early postnatal development are particularly interesting, considering that synaptogenesis takes place after p7 in rats (Aghajanian and Bloom, 1967; Gras et al., 2005). It has been proposed that the high early postnatal level of VGLUT2, and perhaps also VGLUT3, is important for the need for continuous activation of NMDA receptors to stimulate cell migration and differentiation and synaptic remodeling (Boulland et al., 2004).
584
O.E. Hallberg et al. / Neurochemistry International 48 (2006) 579–585
In conclusion, we have shown that cerebellar granule cells are mature on day 7 in vitro. Our studies have also shown that the switch between VGLUT1 and VGLUT2, previously found in vivo, occurs in vitro in granular cell culture without synaptic input from mossy fiber terminals and surrounding astrocytes. Hence, isolated cultures of these cells retain a number of genetic and functional properties, making them suitable for brain studies in vitro. References Aghajanian, G.K., Bloom, F.E., 1967. The formation of synaptic junctions in developing rat brain: a quantitative electron microscopic study. Brain Res. 6, 716–727. Balazs, R., Hajos, F., Michaelson, I.A., Tapia, R., Wilkin, G., 1972. Isolation of a fraction from rat cerebellum enriched in nerve terminals of one single type (mossy-fibre terminals). Biochem. J. 128, 81P–82P. Barberis, A., Lu, C., Vicini, S., Mozrzymas, J.W., 2005. Developmental changes of GABA synaptic transient in cerebellar granule cells. Mol. Pharmacol. 67, 1221–1228. Bellocchio, E.E., Hu, H., Pohorille, A., Chan, J., Pickel, V.M., Edwards, R.H., 1998. The localization of the brain-specific inorganic phosphate transporter suggests a specific presynaptic role in glutamatergic transmission. J. Neurosci. 18, 8648–8659. Bogen, I.L., Boulland, J.L., Mariussen, E., Wright, M.S., Fonnum, F., Kao, H.T., Walaas, S.I., 2006. Absence of synapsin I and II is accompanied by decreases in vesicular transport of specific neurotransmitters. J. Neurochem. 96, 1458–1466. Bolshakov, V.Y., Siegelbaum, S.A., 1995. Regulation of hippocampal transmitter release during development and long-term potentiation. Science 269, 1730–1734. Boulland, J.L., Qureshi, T., Seal, R.P., Rafiki, A., Gundersen, V., Bergersen, L.H., Fremeau Jr., R.T., Edwards, R.H., Storm-Mathisen, J., Chaudhry, F.A., 2004. Expression of the vesicular glutamate transporters during development indicates the widespread corelease of multiple neurotransmitters. J. Comp. Neurol. 480, 264–280. Christensen, H., Fonnum, F., 1992. The ontogeny of the uptake systems for glutamate, GABA, and glycine in synaptic vesicles isolated from rat brain. Neurochem. Res. 17, 457–462. De Gois, S., Schafer, M.K., Defamie, N., Chen, C., Ricci, A., Weihe, E., Varoqui, H., Erickson, J.D., 2005. Homeostatic scaling of vesicular glutamate and GABA transporter expression in rat neocortical circuits. J. Neurosci. 25, 7121–7133. Dittman, J.S., Regehr, W.G., 1997. Mechanism and kinetics of heterosynaptic depression at a cerebellar synapse. J. Neurosci. 17, 9048–9059. Ehrhart-Bornstein, M., Treiman, M., Hansen, G.H., Schousboe, A., Thorn, N.A., Frandsen, A., 1991. Parallel expression of synaptophysin and evoked neurotransmitter release during development of cultured neurons. Int. J. Dev. Neurosci. 9, 439–447. Fonnum, F., Fykse, E.M., Roseth, S., 1998. Uptake of glutamate into synaptic vesicles. Prog. Brain Res. 116, 87–101. Fonnum, F., Lock, E.A., 2004. The contributions of excitotoxicity, glutathione depletion and DNA repair in chemically induced injury to neurones: exemplified with toxic effects on cerebellar granule cells. J. Neurochem. 88, 513–531. Fremeau Jr., R.T., Burman, J., Qureshi, T., Tran, C.H., Proctor, J., Johnson, J., Zhang, H., Sulzer, D., Copenhagen, D.R., Storm-Mathisen, J., Reimer, R.J., Chaudhry, F.A., Edwards, R.H., 2002. The identification of vesicular glutamate transporter 3 suggests novel modes of signaling by glutamate. Proc. Natl. Acad. Sci. U.S.A. 99, 14488–14493. Fremeau Jr., R.T., Troyer, M.D., Pahner, I., Nygaard, G.O., Tran, C.H., Reimer, R.J., Bellocchio, E.E., Fortin, D., Storm-Mathisen, J., Edwards, R.H., 2001. The expression of vesicular glutamate transporters defines two classes of excitatory synapse. Neuron 31, 247–260.
Fremeau Jr., R.T., Voglmaier, S., Seal, R.P., Edwards, R.H., 2004. VGLUTs define subsets of excitatory neurons and suggest novel roles for glutamate. Trends Neurosci. 27, 98–103. Gras, C., Herzog, E., Bellenchi, G.C., Bernard, V., Ravassard, P., Pohl, M., Gasnier, B., Giros, B., El Mestikawy, S., 2002. A third vesicular glutamate transporter expressed by cholinergic and serotoninergic neurons. J. Neurosci. 22, 5442–5451. Gras, C., Vinatier, J., Amilhon, B., Guerci, A., Christov, C., Ravassard, P., Giros, B., El Mestikawy, S., 2005. Developmentally regulated expression of VGLUT3 during early post-natal life. Neuropharmacology 49, 901–911. Hartig, W., Riedel, A., Grosche, J., Edwards, R.H., Fremeau Jr., R.T., Harkany, T., Brauer, K., Arendt, T., 2003. Complementary distribution of vesicular glutamate transporters 1 and 2 in the nucleus accumbens of rat: relationship to calretinin-containing extrinsic innervation and calbindin-immunoreactive neurons. J. Comp. Neurol. 465, 1–10. Herzog, E., Bellenchi, G.C., Gras, C., Bernard, V., Ravassard, P., Bedet, C., Gasnier, B., Giros, B., El Mestikawy, S., 2001. The existence of a second vesicular glutamate transporter specifies subpopulations of glutamatergic neurons. J. Neurosci. 21, RC181. Hioki, H., Fujiyama, F., Taki, K., Tomioka, R., Furuta, T., Tamamaki, N., Kaneko, T., 2003. Differential distribution of vesicular glutamate transporters in the rat cerebellar cortex. Neuroscience 117, 1–6. Hisano, S., 2003. Vesicular glutamate transporters in the brain. Anat. Sci. Int. 78, 191–204. Kaneko, T., Fujiyama, F., Hioki, H., 2002. Immunohistochemical localization of candidates for vesicular glutamate transporters in the rat brain. J. Comp. Neurol. 444, 39–62. Livak, J.K., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2DDCT method. Methods 25, 402– 408. Lowry, O.H., 1953. The quantitative histochemistry of the brain. J. Histochem. 6, 420–428. Marini, A.M., Schwartz, J.P., Kopin, I.J., 1989. The neurotoxicity of 1-methyl4-phenylpyridinium in cultured cerebellar granule cells. J. Neurosci. 9, 3665–3672. Miyazaki, T., Fukaya, M., Shimizu, H., Watanabe, M., 2003. Subtype switching of vesicular glutamate transporters at parallel fibre-Purkinje cell synapses in developing mouse cerebellum. Eur. J. Neurosci. 17, 2563–2572. Mozhayeva, M.G., Sara, Y., Liu, X., Kavalali, E.T., 2002. Development of vesicle pools during maturation of hippocampal synapses. J. Neurosci. 22, 654–665. Ni, B., Rosteck Jr., P.R., Nadi, N.S., Paul, S.M., 1994. Cloning and expression of a cDNA encoding a brain-specific Na(+)-dependent inorganic phosphate cotransporter. Proc. Natl. Acad. Sci. U.S.A. 91, 5607–5611. Ni, B., Wu, X., Yan, G.M., Wang, J., Paul, S.M., 1995. Regional expression and cellular localization of the Na(+)-dependent inorganic phosphate cotransporter of rat brain. J. Neurosci. 15, 5789–5799. Sakata-Haga, H., Kanemoto, M., Maruyama, D., Hoshi, K., Mogi, K., Narita, M., Okado, N., Ikeda, Y., Nogami, H., Fukui, Y., Kojima, I., Takeda, J., Hisano, S., 2001. Differential localization and colocalization of two neurontypes of sodium-dependent inorganic phosphate cotransporters in rat forebrain. Brain Res. 902, 143–155. Salinovich, O., Montelaro, R.C., 1986. Reversible staining and peptide mapping of proteins transferred to nitrocellulose after separation by sodium dodecylsulfate-polyacrylamide gel electrophoresis. Anal. Biochem. 156, 341– 347. Schafer, M.K., Varoqui, H., Defamie, N., Weihe, E., Erickson, J.D., 2002. Molecular cloning and functional identification of mouse vesicular glutamate transporter 3 and its expression in subsets of novel excitatory neurons. J. Biol. Chem. 277, 50734–50748. Schousboe, A., Meier, E., Drejer, J., Hertz, L., 1989. Preparation of primary cultures of mouse (rat) cerebellar granule cells. In: A Dissection and Tissue Culture Manual of the Nervous System, Alan R. Liss, New York, pp. 203–206. Smith, P.K., Krohn, R.I., Hermanson, G.T., Mallia, A.K., Gartner, F.H., Provenzano, M.D., Fujimoto, E.K., Goeke, N.M., Olson, B.J., Klenk, D.C., 1985. Measurement of protein using bicinchoninic acid. Anal. Biochem. 150, 76–85.
O.E. Hallberg et al. / Neurochemistry International 48 (2006) 579–585 Towbin, H., Staehelin, T., Gordon, J., 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. U.S.A. 76, 4350–4354. Varoqui, H., Schafer, M.K., Zhu, H., Weihe, E., Erickson, J.D., 2002. Identification of the differentiation-associated Na+/PI transporter as a novel vesicular glutamate transporter expressed in a distinct set of glutamatergic synapses. J. Neurosci. 22, 142–155. Waagepetersen, H.S., Sonnewald, U., Larsson, O.M., Schousboe, A., 2000. A possible role of alanine for ammonia transfer between astrocytes and glutamatergic neurons. J. Neurochem. 75, 471–479.
585
Wilson, N.R., Kang, J., Hueske, E.V., Leung, T., Varoqui, H., Murnick, J.G., Erickson, J.D., Liu, G., 2005. Presynaptic regulation of quantal size by the vesicular glutamate transporter VGLUT1. J. Neurosci. 25, 6221–6234. Wojcik, S.M., Rhee, J.S., Herzog, E., Sigler, A., Jahn, R., Takamori, S., Brose, N., Rosenmund, C., 2004. An essential role for vesicular glutamate transporter 1 (VGLUT1) in postnatal development and control of quantal size. Proc. Natl. Acad. Sci. U.S.A. 101, 7158–7163. Zhang, N., Ottersen, O.P., 1993. In search of the identity of the cerebellar climbing fiber transmitter: immunocytochemical studies in rats. Can. J. Neurol. Sci. 20 (Suppl. 3), S36–S42.