- Email: [email protected]
CDKN2A promoter in human oral cancer cells and normal human oral keratinocytes
Oral Oncology 35 (1999) 516±522
www.elsevier.com/locate/oraloncology
Dierential DNA methylation of the p16 INK4A/CDKN2A promoter in human oral cancer cells and normal human oral keratinocytes D.T. Cody II a, Yuanhui Huang a, C.J. Darby a, G.K. Johnson b, F.E. Domann a,* a
Radiation Biology Graduate Program, College of Medicine, The University of Iowa, Iowa City, IA 52242, USA b Dows Institute, College of Dentistry, The University of Iowa, Iowa City, IA 52242, USA Received 21 February 1999; accepted 25 February 1999
Abstract The p16 INK4A tumor suppressor gene participates in establishing and maintaining the malignant phenotype of a variety of cancer cell lines and primary tumors. Recently it has been observed that p16 expression is lost in oral cavity cancer cell lines in the presence of a normal intact gene. To examine the role of DNA methylation as an explanation for these ®ndings, we analyzed the DNA methylation patterns of the p16 INK4A promoter in DNA isolated from primary cultures of normal human oral keratinocytes and squamous cell carcinoma (SCC-15) oral cancer cells using bisul®te genomic sequencing. Our results demonstrated striking dierences in the methylation status of the 50 CpG island of the p16 gene between normal and cancer cells. Normal human oral keratinocytes showed practically no methylation of the p16 INK4A promoter, while SCC-15 oral cancer cells showed almost complete methylation in this region. These data implicate DNA methylation as a mechanism for transcriptional silencing of the p16 INK4A gene in oral cancer cells. # 1999 Elsevier Science Ltd. All rights reserved. Keywords: Cancer; Tumor suppressor; DNA methylation; p16; Gene; AP-2; Cell cycle; INK4A; CDKN2A
1. Introduction Uncontrolled cellular proliferation is a hallmark of cancer, and abnormalities in genes that regulate the cell cycle can be found in many types of cancer including those of the oral cavity. Cell proliferation is regulated in part by the protein product of the p16 INK4A/CDKN2A (p16 ) tumor suppressor gene. p16 is involved in cell cycle regulation through the retinoblastoma (Rb) pathway, and acts at the G1/S interface [1]. The p16 protein binds to cyclin-dependent kinases (CDK) 4 and 6 inhibiting the catalytic activity of the CDK±cyclin D-1 complexes that normally mediate passage through the G1 phase of the cell cycle by phosphorylation of pRb [1]. Thus, loss of p16 protein causes loss of the capacity to inactivate the cyclin D-dependent kinase that results in the inability of the cell to activate pRb, that ultimately leads to a loss of control over cell cycle progression.
* Corresponding author. Tel.: +1-319-335-8018; fax: +1-319-3358039. E-mail address: [email protected] (F.E. Domann)
p16 has been found to be homozygously deleted in cell lines derived from lung, kidney, breast, brain and skin tumors as well as others, rivaling p53 in the universality of its involvement in tumorigenesis [1]. However, allelic loss and mutation are not the only mechanisms by which a tumor suppressor gene may become inactivated. A growing body of literature supports the idea that hypermethylation of CpG-rich sequences in tumor suppressor genes, or perhaps more importantly their upstream regulatory regions, may lead to long-term transcriptional silencing of these genes and thus contribute to tumor development. For example, promoter methylation has been shown to repress or inactivate transcription of the Rb gene [2], the O6-methylguanine± DNA methyltransferase gene [3] and the estrogen receptor gene [4]. The p16 gene promoter contains a 50 CpG island and is thus a candidate for regulation by DNA methylation. The under-expression or loss of the p16 protein product, even in a cell with a normal intact gene, can lead to failure to inactivate of the cyclin Ddependent kinases and, therefore, represents a compromise of regulated cell proliferation. Thus, silencing of this gene by DNA methylation during carcinogenesis
1368-8375/99/$ - see front matter # 1999 Elsevier Science Ltd. All rights reserved. PII: S1368-8375(99)00026-3
D.T. Cody II et al. / Oral Oncology 35 (1999) 516±522
could have dramatic eects on the natural history of cancer progression. The hypothesis that expression of the p16 gene may be regulated, in part, by changes in the methylation status of this CpG island has been substantiated in several tumor models [5±7]. With respect to oral cancer, it has recently been shown that treatment of immortalized oral cancer cell lines in which p16 was transcriptionally silent with 5-azacytidine led to reactivation of p16 transcription [8]. Since 5-azacytadine leads to DNA demethylation, these results indicate a potential role for DNA methylation in the transcriptional regulation of the p16 gene in some oral cancer cell lines and primary tumors. It is particularly interesting that the oral cavity cancer cell line squamous cell carcinoma SCC-15 has been reported to lack expression of p16 at the protein and mRNA levels despite the presence of a normal and intact gene. This ®nding begs the question of whether an epigenetic component such as DNA methylation may be playing a role in the transcriptional silencing of the p16 gene in oral cancer. In the current study we examined the methylation status of the p16 promoter region in SCC-15 cells in order to determine whether this might be a mechanism for the loss of expression of p16 in this cell line. Our ®ndings revealed a striking dierence in the DNA methylation patterns of the p16 gene between the oral cancer cell line SCC-15 and normal human oral keratinocytes (NHOKs). The implications of this ®nding may be relevant for future translational research, since novel treatment strategies directed towards cancers where DNA methylation is an important factor have been suggested and are being developed. This necessitates that we clearly de®ne the role of DNA methylation in the regulation of tumor suppressor genes in the etiology of oral cancer. 2. Materials and methods 2.1. Cell cultures Primary cultures of NHOKs were established as previously described [9]. Healthy gingival specimens discarded during clinical crown lengthening surgeries were used. Samples were obtained from individuals that did not use tobacco in any form and had no history of periodontitis or systemic conditions requiring regular use of antibiotics or non-steroidal anti-in¯ammatory drugs. The University of Iowa's Institutional Review Board approved the use of human subjects in this study. Tissue fragments were exposed to a series of washes in Dulbecco's phosphate-buered saline (DPBS) containing streptomycin (200 mg/ml), penicillin (200 IU/ ml), amphotericin B (5 mg/ml), and gentamycin (0.1 mg/ ml). The epithelium was mechanically separated from the underlying connective tissue after incubating in
517
2.4 U/ml Dispase II (Boehringer Mannheim, Indianapolis, IN) overnight at 5 C. The epithelial sheets were placed in trypsin (0.25%)/ethylenediaminetetra-acetic acid (EDTA; 1 mM) and vigorously pipetted to produce a cell suspension. Following trypsin neutralization by media containing 10% fetal bovine serum, the suspension was centrifuged at 200 g for 5 min. The pellet was resuspended in medium and seeded into a T-25 tissue culture ¯ask (Corning, Corning, NY) containing a feeder layer of mitomycin-treated 3T3 murine ®broblasts. The cells were cultured in medium comprising three parts Dulbecco's modi®ed Eagle's medium and one part Ham's F12 medium (Sigma, St. Louis, MO) and 10% fetal bovine serum (Intergen, Purchase, NY). The medium was supplemented with penicillin (100 IU/ml), streptomycin (100 mg/ml), amphotericin B (2.5 mg/ml), epidermal growth factor (10 ng/ml), cholera toxin (0.1 nM) and hydrocortisone (400 ng/ml). The cultures were kept in a 37 C, humidi®ed environment containing 5% CO2 and the medium was changed every 2±3 days. When cultures reached 75±80% con¯uence, the feeder layer was removed by treatment with 0.5 mM EDTA for 5 min at 37 C, followed by exposure to trypsin/ EDTA at 37 C for 1±2 min. Adherent keratinocytes were incubated in trypsin/EDTA for 4±5 min at 37 C or until microscopic inspection demonstrated detachment of a majority of the cells. The keratinocyte nature of the cells was con®rmed by immunohistochemical staining for high molecular weight (50±68 kD) cytokeratins (Dako Corp., Carpinteria, CA), and by histological and ultrastructural features. Human oral SCC-15 cells were obtained from American Type Culture Collection (ATCC, Rockville, MD). Cells were grown in 90% DMEM-Ham's F-12 medium (Life Technologies, Gaithersburg, MD), 0.4 mg/ml hydrocortisone, and 10% heat-inactivated fetal bovine serum containing 100 U/ml penicillin and 100 mg/ml streptomycin. The cultures were kept in a 37 C, humidi®ed environment containing 5% CO2 and the medium was changed every 2±3 days. When the cultures reached 75±80% con¯uence they were harvested by incubating in trypsin/EDTA for 4±5 min at 37 C or until microscopic inspection demonstrated detachment of the majority of the cells. 2.2. DNA isolation and bisul®te DNA modi®cation DNA was isolated from cell cultures in late logphase growth at 75±80% con¯uency. Cell monolayers were washed in PBS and lysed in 2 ml DNA lysis buer (50 ml STE (0.1 M NaCl, 10 mM Tris, pH 8.0) buer, 1 ml 0.5 M EDTA, 5 ml 10% sodium dodecyl sulfate). Proteinase K (100 ml 20 mg/ml) wase added and the samples were incubated at 60 C for 2 h. DNA was extracted with phenol and chloroform, ethanol precipitated, and re-disolved in 50 ml water.
518
D.T. Cody II et al. / Oral Oncology 35 (1999) 516±522
Bisul®te genomic sequencing was performed essentially as described [10]. Brie¯y, genomic DNA was restricted using EcoRI at 37 C for 1 h. DNA (5 mg) in 54 ml ddH2O was denatured by adding 6 ml freshly prepared 3.0 M NaOH to a ®nal concentration of 0.3 M and incubating for 1 h at 37 C. 431 ml of 3.6 M sodium bisul®te/1 mM hydroquinone was added to the mixture. The sample was gently mixed and incubated at 55 C for 14 h. DNA was desalted using the Wizard prep kit (Promega, Madison, WI) according to the manufacturer's instructions. The eluted DNA was precipitated and re-disolved in 100 ml ddH2O. Following this, 6 ml of 3 N NaOH was added and the reaction incubated at 37 C for 30 min. 26 ml of 10 M NH4OAc and 300 ml 95% EtOH was added and the reaction incubated at ÿ20 C for 20 min. The mixture was then centrifuged at 4 C for 30 min and the supernatant removed. The remaining DNA was lyophilized and resuspended in 100 ml ddH2O. 2.3. Polymerase chain reaction (PCR) ampli®cation and primer design for bisul®te-modi®ed DNA Primers were designed for bisul®te-modi®ed genomic DNA as indicated in Table 1. Ten microliters of bisul®te-modi®ed DNA was used as template for the PCR reaction. The reactions were hot started for 5 min at 95 C, then 1.25 units of DNA Taq polymerase (PerkinElmer, Norwalk, CT) was added. The ampli®cations were carried out for 35 cycles (30 s at 95 C, 30 at 65 C, 30 at 72 C) followed by terminal extension at 72 C for 4 min.
INVa-F competent E. coli cells was performed by adding 2 ml 0.5 M b-mercaptoethanol to the cells and then pipetting 2 ml of the ligation reaction into the mixture. The cells were incubated for 30 min on ice then heat shocked for 30 s at 42 C. SOC medium (250 ml) was added to the cells and the mixture was placed in an incubator shaker at 37 C, 225 rpm for 1 h. After incubation, transformed cells were plated to LB plates and incubated overnight. Colonies were picked and minipreps were examined for inserted PCR products. Plasmid DNA (0.5 mg) was subjected to sequencing in a ABI 377A ¯uorescent automated sequencing apparatus using M13 reverse primer. 3. Results The CpG structure of the human p16 promoter region and the strategy for its analysis is shown in Fig. 1. To assess the frequency and distribution of DNA methylation on these CpG dinucleotides, we used several methods involving bisul®te modi®cation of genomic DNA. Bisul®te modi®cation of DNA with subsequent PCR ampli®cation can provide two dierent readouts of a given CpG dinucleotide depending on its methylation status in the genomic DNA. If the CpG site is methylated, the cytosine will remain unchanged upon bisul®te treatment. However, if the cytosine is unmethylated, treatment with sodium bisul®te will cause a C!T conversion and the CpG will become a TpG. Therefore, if
2.4. Cloning and sequencing of PCR products PCR products were gel isolated using the Qiagen gel isolation kit (Qiagen, Valencia, CA) and cloned using a TA Cloning kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. Brie¯y, a ligation reaction was prepared using 5 ml sterile water, 1 ml 10X ligation buer, 2 ml pCR 2.0 vector (25 ng/ml), 1 ml of fresh PCR product and 1 ml T4 DNA ligase. This mixture was incubated overnight at 16 C and then the reaction was centrifuged and placed on ice. Transformation of
Fig. 1. Map plot of the p16 INK4A/CDKN2A promoter illustrating the CpG structure and regions analyzed by methylation-speci®c polymerase chain reaction (MS-PCR) (M) and bisul®te sequencing (A1, A2). Vertical tick marks indicate the positions of CpG dinucleotides across the region. Numbers above the line indicate the nucleotide base numbering scheme as de®ned in GenBank (Accession No. X94154). Al, amplicon 1; A2, amplicon 2; M, MS-PCR product. Arrow represents Hhal site at position 818.
Table 1 Design of sense and antisense polymerase chain reaction (PCR) primers to amplify bisul®te-modi®ed genomic DNA for sequence analysis of amplicons 1 and 2 of the p16 INK4A/CDKN2A promotera Primer p16F1 p16R1 p16F2 p16R2 a
DNA sequence 0
0
5 ATTAAAAGAAGAAGTTATATTTTTTTTATG 3 50 TTAACAAAAAAAAAAAACTAAACTCCTC 30 0
0
5 GTGGGGAGGAGTTTAGTTTTTTTTTTTTG 3 50 TCTAATAACCAACCAACCCCTCCTCTTTC 30
Tm ( C)
Product length (bp)
77.0 73.0
236
75.0 79.0
278
p16F1, forward primer for amplicon 1; p16R1, reverse primer for amplicon 1; p16F2, forward primer for amplicon 2; p16R2, reverse primer for amplicon 2. Tm, oligonucleotide melting temperature; bp, base pairs. See Fig. 1 for de®nition of amplicon regions.
D.T. Cody II et al. / Oral Oncology 35 (1999) 516±522
519
in a given molecule the CpG dinucleotide contains a methylated cytosine, bisul®te modi®cation would have no eect on the sequence, and a restriction enzyme with a CpG containing recognition sequence would be expected to cut. However, if the CpG contains an unmethylated cytosine, bisul®te modi®cation would cause the sequence to be converted, and the enzyme would no longer recognize this site. HhaI restriction endonuclease recognizes the sequence GCGC and is present one time in the PCR product of amplicon 1 (Fig. 1). Fig. 2 shows the results of a HhaI restriction digestion of amplicon 1 obtained from bisul®temodi®ed DNA as template. Our results indicated that in SCC-15 cells there was a methylated cytosine at this CpG site because the HhaI site is retained. The absence of a 236-bp band in SCC-15 cells indicated complete methylation of all DNA molecules at the HhaI site. In contrast, PCR products from bisul®te-modi®ed DNA from NHOK cells failed to cut with HhaI, indicating that this site was unmethylated in the genomic DNA from normal cells. Methylation-speci®c PCR (MS-PCR) is another method to examine the methylation status of CpG dinucleotides [11]. This technique uses three separate sets of primers designed to amplify unmodi®ed or bisul®te-modi®ed DNA. The dierent primers yield PCR products depending on the methylation status of the genomic DNA template. This method has the advantage of allowing the determination of the methylation status at more than one CpG dinucleotide by virtue of the fact that priming will not occur if there is a mismatch of the bases at the extending end of either the sense or antisense primers. However, this technique is unable to assess the methylation status of the sequence between the primer pairs. Nevertheless, this technique is
a good screening tool with high throughput potential. We used MS-PCR to examine a 183-bp region near the transcription initiation site of the p16 gene as seen in Fig. 1. PCR ampli®cation of bisul®te modi®ed SCC-15 DNA with primers speci®c to unmethylated DNA yielded no product, whereas primers speci®c to methylated DNA yielded a clear band of the expected length (Fig. 3). This indicates that the regions recognized by the primers in SCC-15 cells were fully methylated. In contrast, PCR ampli®cation of NHOK cells with the same sets of primers yielded PCR products only in the unmethylated lane, indicating the region was unmethylated in these cells. In order to extend these initial ®ndings, we mapped the methylation status of all the intervening CpG dinucleotides using bisul®te genomic sequencing. The primers used for PCR ampli®cation are shown in Table 1 and the regions analyzed in Fig. 1. As discussed above, if a particular CpG dinucleotide was methylated in the genome, then the cytosine would be preserved in the bisul®te reaction. Any cytosines that were unmethylated in the genome would be converted to thymines during the bisul®te reaction. Fig. 4 shows the results of the DNA methylation analysis from amplicons 1 and 2 of the p16 promoter in SCC-15 and NHOK cells. These results demonstrate almost complete methylation of the p16 promoter in SCC-15 cells, and complete hypomethylation of the same region in NHOK cells. Finally, in order to determine which cis-regulatory elements in the p16 promoter might be aected by DNA methylation of this region, we performed a search of the gene for sequences contained within the transcription factor database using the GCG Wisconsin package. Interestingly, several putative AP-2 binding sites were identi®ed that contained multiple CpG dinucleotides.
Fig. 2. The cytosine at nucleotide position 818 of the p16 INK4A promoter is methylated in squamous cell carcinomas (SCC)-15 cells but not normal human oral keratinocyte (NHOK) cells. HhaI restriction products of amplicon 1 derived from bisul®te-modi®ed DNA from SCC-15 and NHOK were resolved on a 1% agarose gel. HhaI cut the PCR product derived from SCC-15 DNA at position 818, but did not cut that of NHOK DNA (cf. lanes 2 and 4). Upper arrow, uncut polymerase chain reaction (PCR) product; lower arrow, HhaIrestricted PCR product. Lane 1, 1 kb ladder; lanes 2 and 3, PCR product from SCC-15 cells exposed or not exposed to HhaI, respectively; lanes 4 and 5, PCR product from NHOK cells exposed or not exposed to HhaI, respectively.
Fig. 3. Methylation-speci®c polymerase chain reaction (MS-PCR) of bisul®te-modi®ed squamous cell carcinoma (SCC)-15 DNA with primers speci®c to unmethylated DNA yielded no product in SCC-15, whereas primers speci®c to methylated DNA yielded a clearly detectable band of the expected length (cf. lanes 5 and 6). In contrast, ampli®cation of bisul®te-modi®ed normal human oral keratinocyte (NHOK) DNA with primers speci®c to unmethylated DNA yielded product, while primers speci®c to methylated DNA yielded no product (cf. lanes 7 and 8). Control DNA (not bisul®te modi®ed) in lanes 2±4 ampli®ed only with wild type primers as expected. Methylationspeci®c polymerase chain reaction (MS-PCR) products were resolved on a 2% agarose gel. Lane 1, 1-kb ladder. U, primer speci®c for unmethylated DNA; M, primer speci®c for methylated DNA; W, primer speci®c for wild type DNA.
520
D.T. Cody II et al. / Oral Oncology 35 (1999) 516±522
Fig. 4. Genomic bisul®te sequencing analysis revealed that squamous cell carcinoma (SCC)-15 cells were completely methylated at nearly every CpG site examined, while normal human oral keratinocyte (NHOK) cells were nearly devoid of CpG DNA methylation. Methylation status at CpG dinucleotides: *, Unmethylated cytosine; *, methylated cytosine. Horizontal rows represent individual plasmid molecules that were sequenced after polymerase chain reaction (PCR) ampli®cation and cloning of bisul®te-modi®ed DNA. The region was divided into two amplicons, Al and A2, as de®ned by the primers used for PCR ampli®cation in Table 1 and shown schematically in Fig. 1. Therefore, the horizontal rows do not represent continuous molecules. Vertical tick marks indicate relative positions of CpG dinucleotides. Numbering represents the location of bases according to the GenBank Accession No. X94154.
The dierential methylation status of one of these putative AP-2 sites in the human p16 promoter from NHOK and SCC-15 cells, respectively, are shown in Fig. 5A and B. 4. Discussion Our results demonstrated striking dierences in DNA methylation patterns between normal human oral keratinocytes and SCC-15 oral cancer cells, which helps explain the absence of p16 expression in SCC-15 cells noted by Loughran et al. [8] despite the presence of a normal p16 INK4A gene. They examined the relationship between p16 gene structure and expression in several head and neck cancer cell lines and primary cultures. They described an absence of p16 expression in all of the immortal cell lines they studied, and they were able to attribute this to homozygous deletion in about two-thirds of their samples, and transcriptional silencing in the rest. In further studies, they subjected two of the cell lines to 5-azacytidine, a known DNA demethylating agent, and noted re-expression of p16 in both cases. On the basis of these results, they suggested DNA methylation as a potential mechanism of transcriptional silencing [8]. Although they identi®ed the oral cavity cancer cell line SCC-15 as having a normal and intact
gene sequence and an absence of RNA or protein expression, SCC-15 was not subjected to 5-azacytidine treatment or further methylation analysis. However, their data implicated DNA methylation as a possible mechanism of p16 transcriptional regulation in SCC-15, and begged the question of the methylation status of the p16 promoter in this and other oral cancer cells. Our new ®ndings support and extend the work of Loughran et al. [8] by providing the ®rst direct evidence that DNA methylation is abundant in the p16 promoter of this oral cancer cell line. Nearly one third of all oral cancers have lost p16 expression but still contain a normal p16 gene, which suggests that DNA methylation at this tumor suppressor locus is an important factor in oral carcinogenesis. It seems possible that a heritable epigenetic change in the p16 INK4A/CDKN2A gene may account for its activation in dierentiating cells and similarly its suppression in cancer cells. Moreover, such a change may be elicited by dierential binding of particular transcription factors to GC-rich sequences that are differentially methylated. This has certainly been demonstrated for other genes. For example, methylation of a speci®c CpG dinucleotide in the NF-kB binding site of the HIV-1 long terminal repeat inhibits the ability of NF-kB proteins to bind this sequence [12]. Similarly, methylation of a speci®c CpG dinucleotide in the
D.T. Cody II et al. / Oral Oncology 35 (1999) 516±522
521
gene. One explanation for this ®nding is that this 71-bp sequence contains one or more cis-regulatory elements that play a major role in transcription regulation. Visual inspection of this 71-bp region identi®ed a sequence with close homology to an AP-2 consensus DNA binding site. AP-2 is a 52-kD DNA-binding protein that has been implicated in signaling terminal dierentiation [16±18] and its DNA binding is known to be aected by DNA methylation [13,14]. If this sequence represents an authentic AP-2 binding site, then it provides a mechanistic link between p16 promoter DNA methylation and transcriptional control. Interestingly, another related CDK inhibitor, p21/WAF1/CIP1, has been found to be a potently transactivated by AP-2. Taken together, these ®ndings suggest a possible mechanism by which methylation of speci®c CpG dinucleotides in DNA, as we have identi®ed in SCC-15 human oral cancer cells compared to NHOK, could aect gene expression and contribute to neoplastic progression of oral cancer. Additional studies will be required to ascertain the precise mechanism(s) underlying epigenetic gene silencing of this important tumor suppressor locus.
Fig. 5. DNA methylation within a putative AP-2 binding site in the p16 promoter occurs in oral squamous cell carcinoma (SCC-15) cells but not in normal human oral keratinocyte (NHOK) cells. (A) Nucleotide sequence analysis of bisul®te-modi®ed genomic DNA from NHOK. (B) Nucleotide sequence analysis of bisul®te-modi®ed genomic DNA from SCC-15 oral squamous cell carcinoma cells. The sequence data were obtained using M13 reverse primers, thus the presence of a ``G'' nucleotide was equivalent to a methylated ``C'' nucleotide in the genomic DNA.
promoter region of the retinoblastoma gene inhibits the DNA binding ability of the RBF-I transcription factor protein to its cognate element [2]. Finally, and perhaps most importantly for our discussion, CpG methylation of the proenkephalin gene as well as the manganese superoxide dismutase gene inhibited gene expression and DNA binding of the transcription factor AP-2 [13,14]. To determine whether a similar mechanism may account for transcriptional silencing of p16 in oral cancer, we examined the promoter region of the p16 gene for potential protein binding sites that might be negatively aected by DNA methylation. In this report we have identi®ed several putative AP-2 binding sites in the human p16 gene promoter, all of which were methylated in SCC-15 cells but unmethylated in NHOK cells. To assess the cis-regulatory elements important for transcriptional regulation, Hara et al. [15] used serial deletions of the human p16 promoter fused to a reporter gene. They noted a dramatic decrease in transcriptional activity of the promoter between the ÿ869-bp promoter and the ÿ798-bp promoter. They concluded that this 71-bp region was either directly or indirectly instrumental in regulating transcriptional activity of the p16
Acknowledgments The authors wish to acknowledge Connie Organ for technical assistance. D.T.C. received salary support from NIH training grant No. HL07344. This work was supported in part by NIH grant No. CA73612 to F.E.D.
References [1] Serrano M, Hannon GJ, Beach D. A new regulatory motif in cellcycle control causing speci®c inhibition of cyclin D/CDK4. Nature 1993;366:704±7. [2] Ohtani-Fujita N, Fujita T, Aoike A, Osifchin NE, Robbins PD, Sakai T. CpG methylation inactivates the promoter activity of the human retinoblastoma tumor-suppressor gene. Oncogene 1993;8:1063±7. [3] Harris LC, Remack JS, Brent TP. In vitro methylation of the human O6-methylguanine-DNA methyltransferase promoter reduces transcription. Biochimica et Biophysica Acta 1994; 1217:141±6. [4] Ottaviano YL, Issa JP, Parl FF, Smith HS, Baylin SB, Davidson NE. Methylation of the estrogen receptor gene CpG island marks loss of estrogen receptor expression in human breast cancer cells. Cancer Research 1994;54:2552±5. [5] Fueyo J, Gomez-Manzano C, Bruner JM, et al. Hypermethylation of the CpG island of p16/CDKN2 correlates with gene inactivation in gliomas. Oncogene 1996;13:1615±9. [6] Lo KW, Cheung ST, Leung SF, et al. Hypermethylation of the p16 gene in nasopharyngeal carcinoma. Cancer Research 1996;56:2721±5. [7] Ng MH, Chung YF, Lo KW, Wickham NW, Lee JC, Huang DP. Frequent hypermethylation of p16 and pl5 genes in multiple myeloma. Blood 1997;89:2500±6. [8] Loughran O, Malliri A, Owens D, et al. Association of CDKN2A/p16 lNK4A with human head and neck keratinocyte
522
[9] [10] [11]
[12] [13]
D.T. Cody II et al. / Oral Oncology 35 (1999) 516±522 replicative senescence: relationship of dysfunction to immortality and neoplasia. Oncogene 1996;13:561±8. Johnson GK, Organ CC. Prostaglandin E2 and interleukin-I concentrations in nicotine-exposed oral keratinocyte cultures. Journal of Periodontal Research 1997;32:447±54. Clark SJ, Harrison J, Paul CL, Frommer M. High sensitivity mapping of methylated cytosines. Nucleic Acids Research 1994;22:2990±7. Herman JG, Gra JR, Myohanen S, Nelkin BD, Baylin SB. Methylation-speci®c PCR: a novel PCR assay for methylation status of CpG islands. Proceedings of National Academy of Science 1996;93:9821±6. Bednarik DP, Duckett C, Kim SU, et al. DNA CpG methylation inhibits binding of NF-kappa B proteins to the HIV-1 long terminal repeat cognate DNA motifs. New Biologist 1991;3:969±76. Comb M, Goodman HM. CpG methylation inhibits proenkephalin gene expression and binding of the transcription factor AP-2. Nucleic Acids Research 1990;18:3975±82.
[14] Huang Y, Peng J, Oberly LW, Domann FE. Transcriptional inhibition of manganese superoxide dismutase (SOD2) gene expression by DNA methylation of the 50 CpG island. Free Radical Biology and Medicine 1997;23:314±20. [15] Hara E, Smith R, Parry D, Tahara H, Stone S, Peters G. Regulation of p16CDKN2 expression and its implications for cell immortalization and senescence. Molecular and Cellular Biology 1996;16:859±67. [16] Imagawa M, Chiu R, Karin M. Transcription factor AP-2 mediates induction by two dierent signal-transduction pathways: protein kinase C and CAMP. Cell 1987;51:251±60. [17] Williams T, Admon A, Luscher B, Tijian R. Cloning and expression of AP2, a cell-type-speci®c transcription factor that activates inducible enhancer elements. Genes and Development 1988;2:1557±69. [18] Luscher B, Mitchell PJ, Williams T, Tijian R. Regulation of transcription factor AP-2 by the morphogen retinoic acid and by second messengers. Genes and Development 1989;3:1507±17.
www.elsevier.com/locate/oraloncology
Dierential DNA methylation of the p16 INK4A/CDKN2A promoter in human oral cancer cells and normal human oral keratinocytes D.T. Cody II a, Yuanhui Huang a, C.J. Darby a, G.K. Johnson b, F.E. Domann a,* a
Radiation Biology Graduate Program, College of Medicine, The University of Iowa, Iowa City, IA 52242, USA b Dows Institute, College of Dentistry, The University of Iowa, Iowa City, IA 52242, USA Received 21 February 1999; accepted 25 February 1999
Abstract The p16 INK4A tumor suppressor gene participates in establishing and maintaining the malignant phenotype of a variety of cancer cell lines and primary tumors. Recently it has been observed that p16 expression is lost in oral cavity cancer cell lines in the presence of a normal intact gene. To examine the role of DNA methylation as an explanation for these ®ndings, we analyzed the DNA methylation patterns of the p16 INK4A promoter in DNA isolated from primary cultures of normal human oral keratinocytes and squamous cell carcinoma (SCC-15) oral cancer cells using bisul®te genomic sequencing. Our results demonstrated striking dierences in the methylation status of the 50 CpG island of the p16 gene between normal and cancer cells. Normal human oral keratinocytes showed practically no methylation of the p16 INK4A promoter, while SCC-15 oral cancer cells showed almost complete methylation in this region. These data implicate DNA methylation as a mechanism for transcriptional silencing of the p16 INK4A gene in oral cancer cells. # 1999 Elsevier Science Ltd. All rights reserved. Keywords: Cancer; Tumor suppressor; DNA methylation; p16; Gene; AP-2; Cell cycle; INK4A; CDKN2A
1. Introduction Uncontrolled cellular proliferation is a hallmark of cancer, and abnormalities in genes that regulate the cell cycle can be found in many types of cancer including those of the oral cavity. Cell proliferation is regulated in part by the protein product of the p16 INK4A/CDKN2A (p16 ) tumor suppressor gene. p16 is involved in cell cycle regulation through the retinoblastoma (Rb) pathway, and acts at the G1/S interface [1]. The p16 protein binds to cyclin-dependent kinases (CDK) 4 and 6 inhibiting the catalytic activity of the CDK±cyclin D-1 complexes that normally mediate passage through the G1 phase of the cell cycle by phosphorylation of pRb [1]. Thus, loss of p16 protein causes loss of the capacity to inactivate the cyclin D-dependent kinase that results in the inability of the cell to activate pRb, that ultimately leads to a loss of control over cell cycle progression.
* Corresponding author. Tel.: +1-319-335-8018; fax: +1-319-3358039. E-mail address: [email protected] (F.E. Domann)
p16 has been found to be homozygously deleted in cell lines derived from lung, kidney, breast, brain and skin tumors as well as others, rivaling p53 in the universality of its involvement in tumorigenesis [1]. However, allelic loss and mutation are not the only mechanisms by which a tumor suppressor gene may become inactivated. A growing body of literature supports the idea that hypermethylation of CpG-rich sequences in tumor suppressor genes, or perhaps more importantly their upstream regulatory regions, may lead to long-term transcriptional silencing of these genes and thus contribute to tumor development. For example, promoter methylation has been shown to repress or inactivate transcription of the Rb gene [2], the O6-methylguanine± DNA methyltransferase gene [3] and the estrogen receptor gene [4]. The p16 gene promoter contains a 50 CpG island and is thus a candidate for regulation by DNA methylation. The under-expression or loss of the p16 protein product, even in a cell with a normal intact gene, can lead to failure to inactivate of the cyclin Ddependent kinases and, therefore, represents a compromise of regulated cell proliferation. Thus, silencing of this gene by DNA methylation during carcinogenesis
1368-8375/99/$ - see front matter # 1999 Elsevier Science Ltd. All rights reserved. PII: S1368-8375(99)00026-3
D.T. Cody II et al. / Oral Oncology 35 (1999) 516±522
could have dramatic eects on the natural history of cancer progression. The hypothesis that expression of the p16 gene may be regulated, in part, by changes in the methylation status of this CpG island has been substantiated in several tumor models [5±7]. With respect to oral cancer, it has recently been shown that treatment of immortalized oral cancer cell lines in which p16 was transcriptionally silent with 5-azacytidine led to reactivation of p16 transcription [8]. Since 5-azacytadine leads to DNA demethylation, these results indicate a potential role for DNA methylation in the transcriptional regulation of the p16 gene in some oral cancer cell lines and primary tumors. It is particularly interesting that the oral cavity cancer cell line squamous cell carcinoma SCC-15 has been reported to lack expression of p16 at the protein and mRNA levels despite the presence of a normal and intact gene. This ®nding begs the question of whether an epigenetic component such as DNA methylation may be playing a role in the transcriptional silencing of the p16 gene in oral cancer. In the current study we examined the methylation status of the p16 promoter region in SCC-15 cells in order to determine whether this might be a mechanism for the loss of expression of p16 in this cell line. Our ®ndings revealed a striking dierence in the DNA methylation patterns of the p16 gene between the oral cancer cell line SCC-15 and normal human oral keratinocytes (NHOKs). The implications of this ®nding may be relevant for future translational research, since novel treatment strategies directed towards cancers where DNA methylation is an important factor have been suggested and are being developed. This necessitates that we clearly de®ne the role of DNA methylation in the regulation of tumor suppressor genes in the etiology of oral cancer. 2. Materials and methods 2.1. Cell cultures Primary cultures of NHOKs were established as previously described [9]. Healthy gingival specimens discarded during clinical crown lengthening surgeries were used. Samples were obtained from individuals that did not use tobacco in any form and had no history of periodontitis or systemic conditions requiring regular use of antibiotics or non-steroidal anti-in¯ammatory drugs. The University of Iowa's Institutional Review Board approved the use of human subjects in this study. Tissue fragments were exposed to a series of washes in Dulbecco's phosphate-buered saline (DPBS) containing streptomycin (200 mg/ml), penicillin (200 IU/ ml), amphotericin B (5 mg/ml), and gentamycin (0.1 mg/ ml). The epithelium was mechanically separated from the underlying connective tissue after incubating in
517
2.4 U/ml Dispase II (Boehringer Mannheim, Indianapolis, IN) overnight at 5 C. The epithelial sheets were placed in trypsin (0.25%)/ethylenediaminetetra-acetic acid (EDTA; 1 mM) and vigorously pipetted to produce a cell suspension. Following trypsin neutralization by media containing 10% fetal bovine serum, the suspension was centrifuged at 200 g for 5 min. The pellet was resuspended in medium and seeded into a T-25 tissue culture ¯ask (Corning, Corning, NY) containing a feeder layer of mitomycin-treated 3T3 murine ®broblasts. The cells were cultured in medium comprising three parts Dulbecco's modi®ed Eagle's medium and one part Ham's F12 medium (Sigma, St. Louis, MO) and 10% fetal bovine serum (Intergen, Purchase, NY). The medium was supplemented with penicillin (100 IU/ml), streptomycin (100 mg/ml), amphotericin B (2.5 mg/ml), epidermal growth factor (10 ng/ml), cholera toxin (0.1 nM) and hydrocortisone (400 ng/ml). The cultures were kept in a 37 C, humidi®ed environment containing 5% CO2 and the medium was changed every 2±3 days. When cultures reached 75±80% con¯uence, the feeder layer was removed by treatment with 0.5 mM EDTA for 5 min at 37 C, followed by exposure to trypsin/ EDTA at 37 C for 1±2 min. Adherent keratinocytes were incubated in trypsin/EDTA for 4±5 min at 37 C or until microscopic inspection demonstrated detachment of a majority of the cells. The keratinocyte nature of the cells was con®rmed by immunohistochemical staining for high molecular weight (50±68 kD) cytokeratins (Dako Corp., Carpinteria, CA), and by histological and ultrastructural features. Human oral SCC-15 cells were obtained from American Type Culture Collection (ATCC, Rockville, MD). Cells were grown in 90% DMEM-Ham's F-12 medium (Life Technologies, Gaithersburg, MD), 0.4 mg/ml hydrocortisone, and 10% heat-inactivated fetal bovine serum containing 100 U/ml penicillin and 100 mg/ml streptomycin. The cultures were kept in a 37 C, humidi®ed environment containing 5% CO2 and the medium was changed every 2±3 days. When the cultures reached 75±80% con¯uence they were harvested by incubating in trypsin/EDTA for 4±5 min at 37 C or until microscopic inspection demonstrated detachment of the majority of the cells. 2.2. DNA isolation and bisul®te DNA modi®cation DNA was isolated from cell cultures in late logphase growth at 75±80% con¯uency. Cell monolayers were washed in PBS and lysed in 2 ml DNA lysis buer (50 ml STE (0.1 M NaCl, 10 mM Tris, pH 8.0) buer, 1 ml 0.5 M EDTA, 5 ml 10% sodium dodecyl sulfate). Proteinase K (100 ml 20 mg/ml) wase added and the samples were incubated at 60 C for 2 h. DNA was extracted with phenol and chloroform, ethanol precipitated, and re-disolved in 50 ml water.
518
D.T. Cody II et al. / Oral Oncology 35 (1999) 516±522
Bisul®te genomic sequencing was performed essentially as described [10]. Brie¯y, genomic DNA was restricted using EcoRI at 37 C for 1 h. DNA (5 mg) in 54 ml ddH2O was denatured by adding 6 ml freshly prepared 3.0 M NaOH to a ®nal concentration of 0.3 M and incubating for 1 h at 37 C. 431 ml of 3.6 M sodium bisul®te/1 mM hydroquinone was added to the mixture. The sample was gently mixed and incubated at 55 C for 14 h. DNA was desalted using the Wizard prep kit (Promega, Madison, WI) according to the manufacturer's instructions. The eluted DNA was precipitated and re-disolved in 100 ml ddH2O. Following this, 6 ml of 3 N NaOH was added and the reaction incubated at 37 C for 30 min. 26 ml of 10 M NH4OAc and 300 ml 95% EtOH was added and the reaction incubated at ÿ20 C for 20 min. The mixture was then centrifuged at 4 C for 30 min and the supernatant removed. The remaining DNA was lyophilized and resuspended in 100 ml ddH2O. 2.3. Polymerase chain reaction (PCR) ampli®cation and primer design for bisul®te-modi®ed DNA Primers were designed for bisul®te-modi®ed genomic DNA as indicated in Table 1. Ten microliters of bisul®te-modi®ed DNA was used as template for the PCR reaction. The reactions were hot started for 5 min at 95 C, then 1.25 units of DNA Taq polymerase (PerkinElmer, Norwalk, CT) was added. The ampli®cations were carried out for 35 cycles (30 s at 95 C, 30 at 65 C, 30 at 72 C) followed by terminal extension at 72 C for 4 min.
INVa-F competent E. coli cells was performed by adding 2 ml 0.5 M b-mercaptoethanol to the cells and then pipetting 2 ml of the ligation reaction into the mixture. The cells were incubated for 30 min on ice then heat shocked for 30 s at 42 C. SOC medium (250 ml) was added to the cells and the mixture was placed in an incubator shaker at 37 C, 225 rpm for 1 h. After incubation, transformed cells were plated to LB plates and incubated overnight. Colonies were picked and minipreps were examined for inserted PCR products. Plasmid DNA (0.5 mg) was subjected to sequencing in a ABI 377A ¯uorescent automated sequencing apparatus using M13 reverse primer. 3. Results The CpG structure of the human p16 promoter region and the strategy for its analysis is shown in Fig. 1. To assess the frequency and distribution of DNA methylation on these CpG dinucleotides, we used several methods involving bisul®te modi®cation of genomic DNA. Bisul®te modi®cation of DNA with subsequent PCR ampli®cation can provide two dierent readouts of a given CpG dinucleotide depending on its methylation status in the genomic DNA. If the CpG site is methylated, the cytosine will remain unchanged upon bisul®te treatment. However, if the cytosine is unmethylated, treatment with sodium bisul®te will cause a C!T conversion and the CpG will become a TpG. Therefore, if
2.4. Cloning and sequencing of PCR products PCR products were gel isolated using the Qiagen gel isolation kit (Qiagen, Valencia, CA) and cloned using a TA Cloning kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. Brie¯y, a ligation reaction was prepared using 5 ml sterile water, 1 ml 10X ligation buer, 2 ml pCR 2.0 vector (25 ng/ml), 1 ml of fresh PCR product and 1 ml T4 DNA ligase. This mixture was incubated overnight at 16 C and then the reaction was centrifuged and placed on ice. Transformation of
Fig. 1. Map plot of the p16 INK4A/CDKN2A promoter illustrating the CpG structure and regions analyzed by methylation-speci®c polymerase chain reaction (MS-PCR) (M) and bisul®te sequencing (A1, A2). Vertical tick marks indicate the positions of CpG dinucleotides across the region. Numbers above the line indicate the nucleotide base numbering scheme as de®ned in GenBank (Accession No. X94154). Al, amplicon 1; A2, amplicon 2; M, MS-PCR product. Arrow represents Hhal site at position 818.
Table 1 Design of sense and antisense polymerase chain reaction (PCR) primers to amplify bisul®te-modi®ed genomic DNA for sequence analysis of amplicons 1 and 2 of the p16 INK4A/CDKN2A promotera Primer p16F1 p16R1 p16F2 p16R2 a
DNA sequence 0
0
5 ATTAAAAGAAGAAGTTATATTTTTTTTATG 3 50 TTAACAAAAAAAAAAAACTAAACTCCTC 30 0
0
5 GTGGGGAGGAGTTTAGTTTTTTTTTTTTG 3 50 TCTAATAACCAACCAACCCCTCCTCTTTC 30
Tm ( C)
Product length (bp)
77.0 73.0
236
75.0 79.0
278
p16F1, forward primer for amplicon 1; p16R1, reverse primer for amplicon 1; p16F2, forward primer for amplicon 2; p16R2, reverse primer for amplicon 2. Tm, oligonucleotide melting temperature; bp, base pairs. See Fig. 1 for de®nition of amplicon regions.
D.T. Cody II et al. / Oral Oncology 35 (1999) 516±522
519
in a given molecule the CpG dinucleotide contains a methylated cytosine, bisul®te modi®cation would have no eect on the sequence, and a restriction enzyme with a CpG containing recognition sequence would be expected to cut. However, if the CpG contains an unmethylated cytosine, bisul®te modi®cation would cause the sequence to be converted, and the enzyme would no longer recognize this site. HhaI restriction endonuclease recognizes the sequence GCGC and is present one time in the PCR product of amplicon 1 (Fig. 1). Fig. 2 shows the results of a HhaI restriction digestion of amplicon 1 obtained from bisul®temodi®ed DNA as template. Our results indicated that in SCC-15 cells there was a methylated cytosine at this CpG site because the HhaI site is retained. The absence of a 236-bp band in SCC-15 cells indicated complete methylation of all DNA molecules at the HhaI site. In contrast, PCR products from bisul®te-modi®ed DNA from NHOK cells failed to cut with HhaI, indicating that this site was unmethylated in the genomic DNA from normal cells. Methylation-speci®c PCR (MS-PCR) is another method to examine the methylation status of CpG dinucleotides [11]. This technique uses three separate sets of primers designed to amplify unmodi®ed or bisul®te-modi®ed DNA. The dierent primers yield PCR products depending on the methylation status of the genomic DNA template. This method has the advantage of allowing the determination of the methylation status at more than one CpG dinucleotide by virtue of the fact that priming will not occur if there is a mismatch of the bases at the extending end of either the sense or antisense primers. However, this technique is unable to assess the methylation status of the sequence between the primer pairs. Nevertheless, this technique is
a good screening tool with high throughput potential. We used MS-PCR to examine a 183-bp region near the transcription initiation site of the p16 gene as seen in Fig. 1. PCR ampli®cation of bisul®te modi®ed SCC-15 DNA with primers speci®c to unmethylated DNA yielded no product, whereas primers speci®c to methylated DNA yielded a clear band of the expected length (Fig. 3). This indicates that the regions recognized by the primers in SCC-15 cells were fully methylated. In contrast, PCR ampli®cation of NHOK cells with the same sets of primers yielded PCR products only in the unmethylated lane, indicating the region was unmethylated in these cells. In order to extend these initial ®ndings, we mapped the methylation status of all the intervening CpG dinucleotides using bisul®te genomic sequencing. The primers used for PCR ampli®cation are shown in Table 1 and the regions analyzed in Fig. 1. As discussed above, if a particular CpG dinucleotide was methylated in the genome, then the cytosine would be preserved in the bisul®te reaction. Any cytosines that were unmethylated in the genome would be converted to thymines during the bisul®te reaction. Fig. 4 shows the results of the DNA methylation analysis from amplicons 1 and 2 of the p16 promoter in SCC-15 and NHOK cells. These results demonstrate almost complete methylation of the p16 promoter in SCC-15 cells, and complete hypomethylation of the same region in NHOK cells. Finally, in order to determine which cis-regulatory elements in the p16 promoter might be aected by DNA methylation of this region, we performed a search of the gene for sequences contained within the transcription factor database using the GCG Wisconsin package. Interestingly, several putative AP-2 binding sites were identi®ed that contained multiple CpG dinucleotides.
Fig. 2. The cytosine at nucleotide position 818 of the p16 INK4A promoter is methylated in squamous cell carcinomas (SCC)-15 cells but not normal human oral keratinocyte (NHOK) cells. HhaI restriction products of amplicon 1 derived from bisul®te-modi®ed DNA from SCC-15 and NHOK were resolved on a 1% agarose gel. HhaI cut the PCR product derived from SCC-15 DNA at position 818, but did not cut that of NHOK DNA (cf. lanes 2 and 4). Upper arrow, uncut polymerase chain reaction (PCR) product; lower arrow, HhaIrestricted PCR product. Lane 1, 1 kb ladder; lanes 2 and 3, PCR product from SCC-15 cells exposed or not exposed to HhaI, respectively; lanes 4 and 5, PCR product from NHOK cells exposed or not exposed to HhaI, respectively.
Fig. 3. Methylation-speci®c polymerase chain reaction (MS-PCR) of bisul®te-modi®ed squamous cell carcinoma (SCC)-15 DNA with primers speci®c to unmethylated DNA yielded no product in SCC-15, whereas primers speci®c to methylated DNA yielded a clearly detectable band of the expected length (cf. lanes 5 and 6). In contrast, ampli®cation of bisul®te-modi®ed normal human oral keratinocyte (NHOK) DNA with primers speci®c to unmethylated DNA yielded product, while primers speci®c to methylated DNA yielded no product (cf. lanes 7 and 8). Control DNA (not bisul®te modi®ed) in lanes 2±4 ampli®ed only with wild type primers as expected. Methylationspeci®c polymerase chain reaction (MS-PCR) products were resolved on a 2% agarose gel. Lane 1, 1-kb ladder. U, primer speci®c for unmethylated DNA; M, primer speci®c for methylated DNA; W, primer speci®c for wild type DNA.
520
D.T. Cody II et al. / Oral Oncology 35 (1999) 516±522
Fig. 4. Genomic bisul®te sequencing analysis revealed that squamous cell carcinoma (SCC)-15 cells were completely methylated at nearly every CpG site examined, while normal human oral keratinocyte (NHOK) cells were nearly devoid of CpG DNA methylation. Methylation status at CpG dinucleotides: *, Unmethylated cytosine; *, methylated cytosine. Horizontal rows represent individual plasmid molecules that were sequenced after polymerase chain reaction (PCR) ampli®cation and cloning of bisul®te-modi®ed DNA. The region was divided into two amplicons, Al and A2, as de®ned by the primers used for PCR ampli®cation in Table 1 and shown schematically in Fig. 1. Therefore, the horizontal rows do not represent continuous molecules. Vertical tick marks indicate relative positions of CpG dinucleotides. Numbering represents the location of bases according to the GenBank Accession No. X94154.
The dierential methylation status of one of these putative AP-2 sites in the human p16 promoter from NHOK and SCC-15 cells, respectively, are shown in Fig. 5A and B. 4. Discussion Our results demonstrated striking dierences in DNA methylation patterns between normal human oral keratinocytes and SCC-15 oral cancer cells, which helps explain the absence of p16 expression in SCC-15 cells noted by Loughran et al. [8] despite the presence of a normal p16 INK4A gene. They examined the relationship between p16 gene structure and expression in several head and neck cancer cell lines and primary cultures. They described an absence of p16 expression in all of the immortal cell lines they studied, and they were able to attribute this to homozygous deletion in about two-thirds of their samples, and transcriptional silencing in the rest. In further studies, they subjected two of the cell lines to 5-azacytidine, a known DNA demethylating agent, and noted re-expression of p16 in both cases. On the basis of these results, they suggested DNA methylation as a potential mechanism of transcriptional silencing [8]. Although they identi®ed the oral cavity cancer cell line SCC-15 as having a normal and intact
gene sequence and an absence of RNA or protein expression, SCC-15 was not subjected to 5-azacytidine treatment or further methylation analysis. However, their data implicated DNA methylation as a possible mechanism of p16 transcriptional regulation in SCC-15, and begged the question of the methylation status of the p16 promoter in this and other oral cancer cells. Our new ®ndings support and extend the work of Loughran et al. [8] by providing the ®rst direct evidence that DNA methylation is abundant in the p16 promoter of this oral cancer cell line. Nearly one third of all oral cancers have lost p16 expression but still contain a normal p16 gene, which suggests that DNA methylation at this tumor suppressor locus is an important factor in oral carcinogenesis. It seems possible that a heritable epigenetic change in the p16 INK4A/CDKN2A gene may account for its activation in dierentiating cells and similarly its suppression in cancer cells. Moreover, such a change may be elicited by dierential binding of particular transcription factors to GC-rich sequences that are differentially methylated. This has certainly been demonstrated for other genes. For example, methylation of a speci®c CpG dinucleotide in the NF-kB binding site of the HIV-1 long terminal repeat inhibits the ability of NF-kB proteins to bind this sequence [12]. Similarly, methylation of a speci®c CpG dinucleotide in the
D.T. Cody II et al. / Oral Oncology 35 (1999) 516±522
521
gene. One explanation for this ®nding is that this 71-bp sequence contains one or more cis-regulatory elements that play a major role in transcription regulation. Visual inspection of this 71-bp region identi®ed a sequence with close homology to an AP-2 consensus DNA binding site. AP-2 is a 52-kD DNA-binding protein that has been implicated in signaling terminal dierentiation [16±18] and its DNA binding is known to be aected by DNA methylation [13,14]. If this sequence represents an authentic AP-2 binding site, then it provides a mechanistic link between p16 promoter DNA methylation and transcriptional control. Interestingly, another related CDK inhibitor, p21/WAF1/CIP1, has been found to be a potently transactivated by AP-2. Taken together, these ®ndings suggest a possible mechanism by which methylation of speci®c CpG dinucleotides in DNA, as we have identi®ed in SCC-15 human oral cancer cells compared to NHOK, could aect gene expression and contribute to neoplastic progression of oral cancer. Additional studies will be required to ascertain the precise mechanism(s) underlying epigenetic gene silencing of this important tumor suppressor locus.
Fig. 5. DNA methylation within a putative AP-2 binding site in the p16 promoter occurs in oral squamous cell carcinoma (SCC-15) cells but not in normal human oral keratinocyte (NHOK) cells. (A) Nucleotide sequence analysis of bisul®te-modi®ed genomic DNA from NHOK. (B) Nucleotide sequence analysis of bisul®te-modi®ed genomic DNA from SCC-15 oral squamous cell carcinoma cells. The sequence data were obtained using M13 reverse primers, thus the presence of a ``G'' nucleotide was equivalent to a methylated ``C'' nucleotide in the genomic DNA.
promoter region of the retinoblastoma gene inhibits the DNA binding ability of the RBF-I transcription factor protein to its cognate element [2]. Finally, and perhaps most importantly for our discussion, CpG methylation of the proenkephalin gene as well as the manganese superoxide dismutase gene inhibited gene expression and DNA binding of the transcription factor AP-2 [13,14]. To determine whether a similar mechanism may account for transcriptional silencing of p16 in oral cancer, we examined the promoter region of the p16 gene for potential protein binding sites that might be negatively aected by DNA methylation. In this report we have identi®ed several putative AP-2 binding sites in the human p16 gene promoter, all of which were methylated in SCC-15 cells but unmethylated in NHOK cells. To assess the cis-regulatory elements important for transcriptional regulation, Hara et al. [15] used serial deletions of the human p16 promoter fused to a reporter gene. They noted a dramatic decrease in transcriptional activity of the promoter between the ÿ869-bp promoter and the ÿ798-bp promoter. They concluded that this 71-bp region was either directly or indirectly instrumental in regulating transcriptional activity of the p16
Acknowledgments The authors wish to acknowledge Connie Organ for technical assistance. D.T.C. received salary support from NIH training grant No. HL07344. This work was supported in part by NIH grant No. CA73612 to F.E.D.
References [1] Serrano M, Hannon GJ, Beach D. A new regulatory motif in cellcycle control causing speci®c inhibition of cyclin D/CDK4. Nature 1993;366:704±7. [2] Ohtani-Fujita N, Fujita T, Aoike A, Osifchin NE, Robbins PD, Sakai T. CpG methylation inactivates the promoter activity of the human retinoblastoma tumor-suppressor gene. Oncogene 1993;8:1063±7. [3] Harris LC, Remack JS, Brent TP. In vitro methylation of the human O6-methylguanine-DNA methyltransferase promoter reduces transcription. Biochimica et Biophysica Acta 1994; 1217:141±6. [4] Ottaviano YL, Issa JP, Parl FF, Smith HS, Baylin SB, Davidson NE. Methylation of the estrogen receptor gene CpG island marks loss of estrogen receptor expression in human breast cancer cells. Cancer Research 1994;54:2552±5. [5] Fueyo J, Gomez-Manzano C, Bruner JM, et al. Hypermethylation of the CpG island of p16/CDKN2 correlates with gene inactivation in gliomas. Oncogene 1996;13:1615±9. [6] Lo KW, Cheung ST, Leung SF, et al. Hypermethylation of the p16 gene in nasopharyngeal carcinoma. Cancer Research 1996;56:2721±5. [7] Ng MH, Chung YF, Lo KW, Wickham NW, Lee JC, Huang DP. Frequent hypermethylation of p16 and pl5 genes in multiple myeloma. Blood 1997;89:2500±6. [8] Loughran O, Malliri A, Owens D, et al. Association of CDKN2A/p16 lNK4A with human head and neck keratinocyte
522
[9] [10] [11]
[12] [13]
D.T. Cody II et al. / Oral Oncology 35 (1999) 516±522 replicative senescence: relationship of dysfunction to immortality and neoplasia. Oncogene 1996;13:561±8. Johnson GK, Organ CC. Prostaglandin E2 and interleukin-I concentrations in nicotine-exposed oral keratinocyte cultures. Journal of Periodontal Research 1997;32:447±54. Clark SJ, Harrison J, Paul CL, Frommer M. High sensitivity mapping of methylated cytosines. Nucleic Acids Research 1994;22:2990±7. Herman JG, Gra JR, Myohanen S, Nelkin BD, Baylin SB. Methylation-speci®c PCR: a novel PCR assay for methylation status of CpG islands. Proceedings of National Academy of Science 1996;93:9821±6. Bednarik DP, Duckett C, Kim SU, et al. DNA CpG methylation inhibits binding of NF-kappa B proteins to the HIV-1 long terminal repeat cognate DNA motifs. New Biologist 1991;3:969±76. Comb M, Goodman HM. CpG methylation inhibits proenkephalin gene expression and binding of the transcription factor AP-2. Nucleic Acids Research 1990;18:3975±82.
[14] Huang Y, Peng J, Oberly LW, Domann FE. Transcriptional inhibition of manganese superoxide dismutase (SOD2) gene expression by DNA methylation of the 50 CpG island. Free Radical Biology and Medicine 1997;23:314±20. [15] Hara E, Smith R, Parry D, Tahara H, Stone S, Peters G. Regulation of p16CDKN2 expression and its implications for cell immortalization and senescence. Molecular and Cellular Biology 1996;16:859±67. [16] Imagawa M, Chiu R, Karin M. Transcription factor AP-2 mediates induction by two dierent signal-transduction pathways: protein kinase C and CAMP. Cell 1987;51:251±60. [17] Williams T, Admon A, Luscher B, Tijian R. Cloning and expression of AP2, a cell-type-speci®c transcription factor that activates inducible enhancer elements. Genes and Development 1988;2:1557±69. [18] Luscher B, Mitchell PJ, Williams T, Tijian R. Regulation of transcription factor AP-2 by the morphogen retinoic acid and by second messengers. Genes and Development 1989;3:1507±17.