Differential effects of progestogens, by type and regimen, on estrogen-metabolizing enzymes in human breast cancer cells

Maturitas 56 (2007) 142–152

Differential effects of progestogens, by type and regimen, on estrogen-metabolizing enzymes in human breast cancer cells Bing Xu 1 , Jo Kitawaki ∗ , Hisato Koshiba, Hiroaki Ishihara, Miyo Kiyomizu, Mariko Teramoto, Yui Kitaoka, Hideo Honjo Department of Obstetrics and Gynecology, Kyoto Prefectural University of Medicine, Graduate School of Medical Science, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566, Japan Received 15 March 2006; received in revised form 30 June 2006; accepted 5 July 2006

Abstract Objectives: To investigate the in vitro effects of five progestogens commonly used in hormone replacement therapy (HRT) on estrogen-metabolizing enzymes in human breast cancer cells. Methods: The human hormone-dependent breast cancer cell lines T47D, MCF-7, and MCF-7aro were cultured with estradiol (E2 ) and progestogens. The mRNA levels of estrogen-metabolizing enzymes were determined by RT-PCR or Northern blot, and enzyme activities by radiolabeled substrates. Cell proliferation was measured by bromodeoxyuridine incorporation. In vitro models for continuous combined regimen (CCR) and sequential combined regimen (SCR) were established to mimic the in vivo conditions of HRT. Results: Medroxyprogesterone acetate (MPA) plus E2 (10−8 M) stimulated the mRNA levels and activities of estrogen-activating enzymes aromatase (at 10−8 M MPA), 17␤-hydroxysteroid dehydrogenase type 1 (17␤HSD1) (at 10−6 M), and sulfatase (at 10−8 to 10−6 M) compared to E2 only. Progesterone also stimulated enzyme activity, but to a lower magnitude. Levonorgestrel, norethindrone, and dienogest showed no enzyme stimulation. The estrogen-inactivating enzymes 17␤-hydroxysteroid dehydrogenase type 2 and sulfotransferase were not affected by any of the progestogens tested. However, all the progestogens (at 10−8 to 10−6 M) inhibited E2 -stimulated cell proliferation. While increased aromatase and 17␤HSD1 activities were observed in the CCR model, no significant enzyme stimulation was observed in the SCR model. Conclusions: The present study suggested that progestogens exert different actions on estrogen-metabolizing enzymes in breast cancer cells dependent on the specific progestogen and regimen used. Further studies are needed to elucidate whether MPA, a progestogen currently used in HRT, leads to a higher risk of breast cancer development than other progestogens. © 2006 Elsevier Ireland Ltd. All rights reserved. Keywords: Hormone replacement therapy; Breast cancer cells; Progestogen; Estrogen-metabolizing enzyme

∗

Corresponding author. Tel.: +81 75 251 5560; fax: +81 75 212 1265. E-mail address: [email protected] (J. Kitawaki). 1 Present address: Department of Obstetrics and Gynecology, The Medical School Hospital of Qingdao University, Qingdao 266003, P.R. China 0378-5122/$ – see front matter © 2006 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.maturitas.2006.07.003

B. Xu et al. / Maturitas 56 (2007) 142–152

1. Introduction While the role of progestogens in endometrial protection has been well accepted in studies of hormone replacement therapy (HRT), whether progestogens reduce or enhance the risk of breast cancer remains controversial. Recently, the Women’s Health Initiative (WHI) study, the first randomized, prospective, controlled trial, reported a 26% increase in the relative risk of breast cancer for combined estrogen–progestogen when compared with a placebo [1]. The Million Women Study, the largest observational study reported to date, also reported a significant increase in breast cancer risk with the estrogen–progestogen combination [2]. However, another arm of WHI study, the estrogen trial, showed that estrogen alone administered to hysterectomized women did not increase the risk of breast cancer [3], although the precise effect of estrogenalone remains unclear. Thus, there is clearly a need to urgently reevaluate the role of progestogens in HRT with regard to breast cancer risk. Although a number of in vitro studies using breast cancer cell lines have been reported, results have been inconsistent as it appears that whether progestogens inhibit or stimulate cancer cell proliferation can depend on the culture conditions, cell type, and the specific progestogen tested [4–11]. One of the major confounding factors is that while most of the large-scale clinical trials have used medroxyprogesterone acetate (MPA) as the progestogen, the studies have not necessarily compared differences between progestogen types, duration of use, and specific regimens. It is now well accepted that increased local estrogen levels are associated with both the onset and growth of breast cancer. Tissue concentrations of estradiol (E2 ) in breast cancer are 10 times higher than that found in plasma [12]. Breast cancer tissues also contain increased activity and expression of estrogen-activating enzymes, such as aromatase [13,14], 17␤-hydroxysteroid dehydrogenase type 1 (17␤HSD1) [15,16], and sulfatase (STS) [17–19], compared to the estrogen-inactivating enzymes 17␤hydroxysteroid dehydrogenase type 2 (17␤HSD2) and sulfotransferase (EST). Therefore, we decided to conduct an in vitro study to examine the hypothesis that particular progestogens enhance the risk of carcinogenesis through the stimulation of estrogen-activating enzymes in breast cancer cells. We tested proges-

143

terone (P4 ) and MPA, as well as three other synthetic progestogens, dienogest (DNG), norethindrone (NET) and levonorgestrel (LNG), used in oral contraceptives. We also investigated the effects of progestogens on the E2 -stimulated cell proliferation of breast cancer cells. Furthermore, to mimic HRT in vivo, we established in vitro models for a continuous combined regimen (CCR) and a sequential combined regimen (SCR) and investigated the relationship between the schedule of progestogen administration and breast cancer risk.

2. Materials and methods 2.1. Chemicals [6,7-3 H]estrone (E1 ), [6,7-3 H]E2 , [6,7-3 H]estrone3-sulfate (E1 S), [4-14 C]E1 , [4-14 C]E2 , [4-14 C]E1 S and [1␤-3 H]androstenedione were purchased from New England Nuclear-Dupont (Boston, MA). Nonlabeled steroids were purchased from Nacalai Tesque, Kyoto, Japan. 2.2. Cell culture The human breast cancer cell lines T47D and MCF7 were obtained from the American Type Culture Collection (Rockville, MD, USA). MCF-7aro [20] that had been transfected with aromatase was generously provided by Dr. Shiuan Chen (City of Hope National Medical Center, Duarte, CA, USA). We confirmed by RT-PCR analysis that the cell lines expressed ER, PR-A and PR-B. Cells were grown in a humidified atmosphere of 5% CO2 –95% air at 37 ◦ C in RPMI 1640 medium (Nacalai Tesque) for T47D or Eagle’s Minimal Essential Medium (MEM, Nacalai Tesque) supplemented with non-essential amino acids, 1% sodium pyruvate, and 2 mM l-glutamine for MCF-7 and MCF7aro. Growth media were supplemented with 10% fetal bovine serum (FBS) (Invitrogen Life Technologies, Inc., Carlsbad, CA), penicillin (100 U/mL), streptomycin (100 ␮g/mL), amphotericin (0.25 ␮g/mL) and phenol red. Approximately 1.0 × 105 cells were seeded into 35-mm dishes and cultured until subconfluent. The cells were rinsed with serum-free medium twice and cultured for 24 h in phenol red-free medium with 10% dextran charcoal-treated FBS (Invitrogen Life Tech-

144

B. Xu et al. / Maturitas 56 (2007) 142–152

Table 1 Summary of oligonucleotide primers used for RT-PCR Gene

Primer sequence (5 –3 )

PCR product size (bp)

GAPDH

FWD: TGAACGGGAAGCTCACTGG REV: TCCACCACCCTGTTGCTGTA

983

Aromatase

FWD: CAAGGTTATTTTGATGCATGG REV: TTCTAAGGCTTTGCGCATGAC

484

17␤HSD1

FWD: AGGCTTATGCGAGAGTCTGG REV: CATGGCGGTGACGTAGTTGG

349

17␤HSD2

FWD: CTGAGGAATTGCGAAGAACC REV: GAAGTCCTTGCTGGCTAACG

593

STS

FWD: GAACACTGAGACTCCGTTCCT REV: CTTTATAGATCCCATTACTTCCGCC

275

EST

FWD: GTGTACCACAATGAATTCTGA REV: GTAAAGAAAGACCTTCTTAGATCT

911

nologies, Inc.). The cells were then incubated in phenol red-free medium containing 10% dextran charcoaltreated FBS and test steroids for 72 h unless otherwise indicated. Steroids were dissolved in ethanol, with a final concentration of ethanol in each dish of 0.1%. Control dishes received vehicle only. 2.3. RNA isolation and RT-PCR Cells in 35-mm culture dishes were gently rinsed twice with RPMI 1640 or MEM and total RNA isolated using TRIzol (Invitrogen Life Technologies, Inc.). First strand cDNA from total RNA was synthesized using SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen Life Technologies, Inc.) and oligo(deoxythymidine) primers. Each PCR mixture comprised 1 ␮L first strand cDNA, 0.8 ␮M each primer (as in Table 1), 0.2 mM dNTP, and 1.25 units Taq polymerase (Takara Premix Ex Taq; Takara Biochemicals, Inc., Tokyo, Japan) in a total volume of 50 ␮L buffer provided by the manufacturer. Reactions were performed at 95 ◦ C for 30 s, 58 ◦ C for 30 s, and 72 ◦ C for 30 s. PCR products were electrophoresed in 2% agarose gels and stained with ethidium bromide. Band intensities were measured with a densitometer. Relative change in STS mRNA level was assessed by a semiquantitative RT-PCR method as described previously [21]. As transcript intensity increased exponentially up to 30 cycles for STS and 27 cycles for GAPDH before reaching a plateau, we measured STS transcript inten-

sity after 30 cycles relative to that of GAPDH after 27 cycles to compare initial mRNA levels. 2.4. Northern blot analysis mRNA levels of aromatase and 17␤HSD1 were measured by Northern blotting as described previously [22]. Briefly, total RNA was electrophoresed in 1% agarose/formaldehyde gels and transferred onto nylon membranes (Hybond N+ ; Amersham Pharmacia Biotech, Piscataway, NJ) by capillary blotting, and UV cross-linked. Membranes were prehybridized for 1 h at 65 ◦ C in 0.5 M Na2 HPO4 /H3 PO4 buffer (pH 7.2) containing 1 mM EDTA and 7% SDS. Radiolabeled probes for aromatase, 17␤HSD1, and GAPDH were amplified by RT-PCR from cDNA fragments obtained from term placental tissues. DNA bands were excised from agarose gels and extracted using a NucleoTrap DNA purification kit (BD Clontech, Palo Alto, CA). Aliquots of the DNA products were sequenced by the dye terminator method using a model 100 DNA analyzer (PE Applied Biosystems, Inc., Foster City, CA), and the sequences for aromatase and 17␤HSD1 confirmed to be identical to reported sequences in the Genbank data bank. Probes were radiolabeled with [␣-32 P] dCTP using a Random primer plus extension labeling system (NEN Life Science Products, Boston, MA). After hybridization for 48 h at 60 ◦ C, membranes were washed three times for 5 min each at 65 ◦ C, followed by a wash for 15 min at 65 ◦ C in 0.04 M Na2 HPO4 /H3 PO4

B. Xu et al. / Maturitas 56 (2007) 142–152

buffer (pH 7.2) containing 1% SDS. The autoradiographic signals were quantified by densitometry analysis using a bioimaging analyzer (BAS 2000; Fujix, Tokyo, Japan). 2.5. Enzyme assays Aromatase activity was determined by the tritiated water method [23] as previously described [24], with modifications. Cells in 35-mm culture dishes were gently rinsed twice with MEM and incubated for 30 min at 37 ◦ C in a humidified atmosphere of 5% CO2 –95% air with 0.5 mL of medium containing [1␤3 H]androstenedione (4.8 × 105 dpm, 300 pmol). Reactions were stopped by transferring the medium to a test tube containing 2 mL chloroform. Steroids were extracted twice with 2 mL chloroform, 0.5 mL 5% charcoal added to the aqueous phase, and incubated at 37 ◦ C for 30 min under shaking. Mixtures were centrifuged at 800 g for 10 min and supernatants filtered through cotton-packed glass pipettes. The amount of [3 H]-water in each eluate was assessed by 1␤elimination mechanism (75% release into water) [23]. This tritiated water method was validated according to the product isolation method as previously described [24], and the data showed good agreement. For assays for 17␤HSD1, 17␤HSD2, STS, and EST, cells in 35-mm culture dishes were gently rinsed twice with RPMI 1640 or MEM and incubated for 60 min at 37 ◦ C in a humidified atmosphere of 5% CO2 –95% air with 0.5 mL medium containing the respective radiolabeled substrates. The substrates used were [6,7-3 H]E1 (1.8 × 106 dpm, 37 ␮M), [6,7-3 H]E2 (1.3 × 106 dpm, 37 ␮M), [6,7-3 H]E1 S (2.0 × 106 dpm, 37 ␮M), or [4-14 C]E1 (1.0 × 105 dpm, 37 ␮M). Reactions were stopped by transferring the medium to test tubes containing 2 mL diethyl ether and the corresponding carrier steroids: [4-14 C]E2 (1.3 × 104 dpm) and nonradioactive E1 and E2 (0.2 mg each) for 17␤HSD1, [4-14 C]E1 (2.1 × 104 dpm) and nonradioactive E1 and E2 (0.2 mg each) for 17␤HSD2, [4-14 C]E1 (1.0 × 105 dpm) and nonradioactive E1 and E1 S (0.2 mg each) for STS, and [6,7-3 H]E1 S (2.0 × 106 dpm) and nonradioactive E1 and E1 S (0.2 mg each) for EST. Organic phases were extracted three times with diethyl ether, and steroids isolated by thin-layer chromatography using Silicagel 60 F254 (0.25 mm; E. Merck, Darmstadt, Germany) in a system of benzene–ethyl acetate (1:1,

145

v/v) for 17␤HSD1, 17␤HSD2 and STS, and ethyl acetate–methanol–ammonia (75:25:2, v/v/v) for EST. Enzyme activities of 17␤HSD1, 17␤HSD2, STS, and EST were calculated according to the ratios of E2 , E1 , E1 , and E1 S formed, respectively. Radioactivity of a dish containing no cells was subtracted from each count, although this control level was usually negligible. The enzyme assays were validated as previously described [22]. Protein concentrations were determined using a Bio-Rad protein assay kit (Bio-Rad, Hercules, CA) with bovine serum albumin as the standard. 2.6. Cell proliferation assay Cell proliferation was determined by incorporation of bromodeoxyuridine (BrdU) using a BrdU Cell Proliferation Assay kit (EMD Biosciences Inc., Darmstadt, Germany). Approximately 1.0 × 104 cells were seeded into a 96-well dish and cultured for 24 h. Cells were rinsed with serum-free medium twice, cultured for 24 h in phenol red-free medium with 10% dextran charcoaltreated FBS, and then incubated in phenol red-free medium containing 10% dextran charcoal-treated FBS and test steroids for 72 h. After rinsing the cells with serum-free medium twice, BrdU incorporation was determined according to the manufacturer’s instructions. Absorbance was read at dual wavelengths of 450–540 nm using an ELISA plate reader (Model 550, Bio-Rad). 2.7. Statistics Differences in enzyme activity and mRNA expression level were analyzed by one-factor ANOVA, followed by multiple comparisons using Dunnett’s procedure. Data were expressed as mean ± S.E.M., with P < 0.05 considered to be statistically significant.

3. Results 3.1. Effects of progestogens on estrogen-metabolizing enzymes The mRNA level and activity of aromatase in the MCF-7aro cells were determined after incubation of MCF-7aro cells with each one of five progestogens (10−8 , 10−7 or 10−6 M) in the presence

146

B. Xu et al. / Maturitas 56 (2007) 142–152

of E2 (10−8 M) for 24–96 h. Preincubation with MPA (10−8 M) and E2 for 72 h resulted in a 3.0- and 2.9fold increase in aromatase mRNA level and activity, respectively, compared to the control and were significantly greater (P < 0.01) than levels observed in cells incubated with E2 only. P4 (10−6 M) plus E2 also showed increased mRNA levels (2.0-fold) and activity (1.8-fold), which was likewise significantly higher (P < 0.01) than observed in cells treated with E2 only. However, E2 only or E2 plus any concentration of DNG, NET, or LNG did not significantly stimulate aromatase (Fig. 1). In T47D cells, preincubation with MPA (10−6 M) and E2 (10−8 M) for 72 h resulted in a 2.8-fold and 3.4-fold increase in 17␤HSD1 mRNA level and activity, respectively, compared to control cells. These levels were significantly higher (P < 0.01) than those observed in T47D cells incubated with E2 only. However, E2 only or E2 plus any concentrations of P4 , DNG, NET or LNG did not significantly stimulate 17␤HSD1 (Fig. 2). Similarly, in MCF-7 cells, preincubation with MPA (10−8 , 10−7 and 10−6 M) plus E2 (10−8 M) for 72 h resulted in 10.0–14.9-fold and 2.7–3.0-fold increases

in STS mRNA and activity, respectively, compared to control cells. These levels were significantly higher (P < 0.01) than in cells treated with E2 only. Preincubation with P4 (10−8 , 10−7 and 10−6 M) plus E2 also showed increases in STS mRNA level (3.2–5.9fold) and activity (1.5–1.9-fold) that were significantly higher (P < 0.05) than that observed after preincubation with E2 only. However, E2 only or E2 plus any concentration of DNG, NET or LNG did not significantly stimulate STS (Fig. 3). In contrast, mRNA levels and activities of 17␤HSD2 and EST, responsible for the inactivation of estrogenic activity, were lower by one order magnitude than the corresponding reverse enzyme activities. None of the progestogens tested significantly altered 17␤HSD2 and EST mRNA levels or enzyme activities (data not shown). 3.2. Effects of progestogens on cell proliferation Cell proliferation, as assessed by BrdU incorporation, was determined for MCF-7 cells after incubation for 72 h with or without E2 and progestogen in phenol red-free medium containing 10% dextran

Fig. 1. Levels of aromatase mRNA expression and activity in MCF-7aro cells after 72-h treatment with E2 (10−8 M) and progestogen (10−8 to 10−6 M). Levels of mRNA were determined by Northern blotting and the numbers above bands represent the relative ratio of band intensities of aromatase/GAPDH compared with the control group. Enzyme activity was determined by the tritiated water method and expressed as percentage of control. Values represent mean ± S.E.M. of duplicate determinations of three independent experiments. * P < 0.01 vs. E2 value.

B. Xu et al. / Maturitas 56 (2007) 142–152

147

Fig. 2. Levels of 17␤HSD1 mRNA expression and activity in T47D cells after 72-h treatment with E2 (10−8 M) and progestogen (10−8 to 10−6 M). Levels of mRNA were determined by Northern blotting and the numbers above bands represent the relative ratio of band intensities of 17␤HSD1/GAPDH compared with the control group. Enzyme activity was determined by the conversion of [3 H] E1 to E2 and expressed as percentage of control. Values represent mean ± S.E.M. of duplicate continuous determinations of three independent experiments. * P < 0.01 vs. E2 value.

Fig. 3. Levels of STS mRNA expression and activity in MCF-7 cells after 72-h treatment with E2 (10−8 M) and progestogen (10−8 to 10−6 M). Levels of mRNA were determined by RT-PCR and the numbers above bands represent the relative ratio of band intensities of STS/GAPDH compared with the control group. Enzyme activity was determined by the conversion of [3 H] E1 S to E1 and expressed as percentage of control. Values represent mean ± S.E.M. of duplicate continuous determinations of three independent experiments. * P < 0.01, # P < 0.05 vs. E2 value.

148

B. Xu et al. / Maturitas 56 (2007) 142–152

Fig. 4. Inhibition of E2 -stimulated proliferation of MCF-7 breast cancer cells by progestogens. MCF-7 cells were cultured in phenol red-free medium containing 10% dextran charcoal-treated FBS with or without E2 and progestogen for 72 h. After rinsing the cells, BrdU incorporation was determined. Values represent mean ± S.E.M. of duplicate continuous determinations of three independent experiments. * P < 0.01 vs. E2 (10−8 M) value.

charcoal-treated FBS. While E2 (10−8 M) significantly stimulated BrdU incorporation vs. control (P < 0.01), the concomitant addition of a progestogen (P4 , MPA, DNG, NET, or LNG at 10−8 to 10−6 M) significantly inhibited BrdU incorporation (P < 0.01) (Fig. 4).

MPA (10−6 M) plus E2 (10−8 M) for 72 or 96 h (CCR in Fig. 5C), but not in the SCR model (SCR in Fig. 5C). No attenuation of 17␤HSD1 activity was observed after 24 h steroid-free culture following CCR (CCR-SF in Fig. 5C) or SCR (SCR-SF in Fig. 5C).

3.3. Effects of MPA in sequential and continuous combined regimen models

4. Discussion

To approximate the in vivo conditions of HRT, we established models of SCR and CCR. SCR was represented by an incubation protocol in which cells were pretreated with E2 followed by 24- or 48-h incubation with E2 and MPA (SCR in Fig. 5A). For CCR, cells were stimulated by E2 plus MPA throughout the entire treatment period (CCR in Fig. 5A). Increased aromatase activity was observed in the CCR model, in which MCF-7aro cells were treated with MPA (10−8 M) plus E2 (10−8 M) for 72 or 96 h (CCR in Fig. 5B). In contrast, aromatase activity was not stimulated in the SCR model (SCR in Fig. 5B). To simulate the effect of a break between hormonal treatments, enzyme assays were performed after steroid-free culture for 24 h following CCR and SCR. However, no attenuation of aromatase activity was observed after CCR (CCR-SF in Fig. 5B) or SCR (SCR-SF in Fig. 5B). Similarly, 17␤HSD1 activity was stimulated only in the CCR model, in which T47D cells were treated with

Based on the findings that high local estrogen concentrations in breast tissue increased breast cancer risk, we investigated the effect of progestogens on estrogenmetabolizing enzymes in breast cancer cell lines. Of the five main enzymes involved in estrogen metabolism, aromatase, 17␤HSD1, and STS increase estrogenic activity, while 17␤HSD2 and EST decrease estrogenic activity. In breast cancer tissues, aromatase activity is often elevated relative to surrounding normal breast and adipose tissues [13,14], and the activities of 17␤HSD1 [15,16] and STS [17–19] are higher than the activities of 17␤HSD2 and EST that catalyzed the respective reverse reactions. Together, these factors lead to hyperestrogenic conditions in breast cancer tissues. In the present study, MPA, in the presence of E2 , stimulated both the mRNA levels and activities of estrogen-activating enzymes aromatase, 17␤HSD1, and STS, but had negligible effect on estrogeninactivating enzymes 17␤HSD2 and EST. These results

B. Xu et al. / Maturitas 56 (2007) 142–152

149

suggested that MPA stimulated transcription of the estrogen-activating enzyme genes and enhanced local estrogenic activity. It should be noted that this effect was based on enzyme induction rather than simple interaction between steroids and enzyme catalytic sites. P4 with E2 had similar effects on the enzymes, although at a lower magnitude compared with MPA. In contrast to the stimulatory effects of MPA, the other progestogens DNG, LNG, and NET did not significantly stimulate the estrogen-activating enzymes. A possible explanation for the differences between progestogens is their different structural and functional characteristics. Synthetic progestogens can be classified into two major subtypes, such that MPA is a 17␣-hydroxyprogesterone derivative that possesses glucocorticoid-like as well as progestational activity, but has less of an androgenic effect. In contrast, DNG, LNG, and NET are 19nortestosterone derivatives that exhibit higher affinities to the androgen receptor than MPA. Individual synthetic progestogens bind with different affinities to various steroid receptors, such as the progesterone receptor, androgen receptor, mineralocorticoid receptor, and glucocorticoid receptor, thereby exerting complex actions on target tissues [25]. However, regardless of enzyme stimulation, our present study showed that in the presence of E2 all the progestogens tested, including MPA and P4 , inhibited the E2 -stimulated proliferation of breast cancer cells. It is interesting to speculate on the apparently conflicting findings between enzyme stimulation and proliferation inhibition by MPA. While MPA may inhibit proliferation, it does not necessarily follow that MPA

Fig. 5. (A) In vitro models for sequential combined regimens (SCR) and continuous combined regimens (CCR). For the SCR model, the incubation protocol involved pretreating cells with E2 followed by 24- or 48-h incubation with E2 plus MPA. For the CCR model, cells were stimulated by E2 plus MPA throughout treatment. To observe the after-effects of the steroids, activity was assayed after steroidfree culture for 24 h following SCR (SCR-SF) and CCR (CCR-SF). Cells incubated without steroids (NT) or with E2 only (E) were used as controls. (B) Lack of aromatase stimulation in the SCR model contrasts with stimulation observed in the CCR model. Aromatase activity was stimulated in the CCR model, in which MCF-7aro cells

were treated with MPA (10−8 M) plus E2 (10−8 M) for 72–96 h (P < 0.01). In contrast, no significant aromatase stimulation was observed in the SCR model, in which cells were pretreated with E2 followed by 24- or 48-h incubation with E2 plus MPA. No attenuation of aromatase activity was observed after CCR (CCR-SF) or SCR (SCR-SF). (C) Lack of 17␤HSD1 stimulation in the SCR model contrasts with stimulation observed in the CCR model. 17␤HSD1 activity was stimulated in the CCR model, in which T47D cells were treated with MPA (10−6 M) plus E2 (10−8 M) for 72–96 h (P < 0.01). In contrast, no significant stimulation was observed in the SCR model, in which cells were pretreated with E2 followed by 24- or 48-h incubation with E2 plus MPA. No attenuation of 17␤HSD1 activity was observed after CCR (CCR-SF) or SCR (SCR-SF). Data are expressed as the percentage of the control group (non-treated cells). Values represent mean ± S.E.M. of duplicate continuous determinations of three independent experiments. * P < 0.01 vs. E2 value.

150

B. Xu et al. / Maturitas 56 (2007) 142–152

would suppress the development of cancer in the breast, such that the hyperestrogenic conditions induced by MPA may cause an increased risk of developing cancer despite the inhibited proliferation. Although our in vitro data cannot be applied directly to clinical findings, it appears likely that compared with DNG, LNG and NET, MPA may induce a hyperestrogenic condition locally in breast tissues when used in combination with E2 in HRT, such that MPA may not be the best option as the progestogen for HRT. Since clinical studies mostly involved cases that used MPA, data from studies that examined other types of progestogens are very limited. While the WHI study examined the combination of conjugated equine estrogens plus MPA [1], the Million Women Study [2] that also demonstrated an increased risk of breast cancer with the combined use of estrogens and progestogens found little variation between the progestogens used (MPA, NET, or norgestrel/LNG). In a French cohort study of 3175 women [26], 83% of HRT users received mainly a transdermal E2 gel formulation, 58% received oral micronized P4 , and fewer than 3% used MPA. Interestingly, this study failed to detect an increased risk of breast cancer. More data from both clinical and experimental studies are required to investigate the use of different progestogens in HRT. Based on previous in vitro studies, the question as to whether progestogens are inhibitory or stimulatory has remained controversial. With regard to the effects of progestogens on estrogen-metabolizing enzymes, stimulation of the estrogen-activating enzyme 17␤HSD1 by MPA, LNG, NET, NET acetate [27], and the synthetic progestogen ORG2058 [28] have been reported. By contrast, Pasqualini et al. have claimed in a series of studies that various progestogens including MPA and P4 had inhibitory effects on STS and 17␤HSD1 [29,30]. For the roles of progestogens on cell proliferation, Hofseth et al. [31] performed a cross-sectional observational study using benign breast biopsies and showed that postmenopausal HRT with estrogen plus MPA was associated with greater breast epithelial cell proliferation and cell density than HRT with estrogen alone or no HRT. Also, of the studies using breast cancer cell lines, some have shown inhibition by progestogens and some have shown stimulation [4–11]. This inconsistency may be due to variations in culture conditions, cell types, and progestogens examined. For instance, when limited to the effect of MPA

on E2 -stimulated proliferation, most studies showed inhibition [5,8,9,11], whereas Franke and Vermes [10] showed stimulation. Another important issue is whether breast cancer risk is affected by the schedule of progestogen administration. In the present study, we developed in vitro models for SCR and CCR that mimicked HRT conditions in vivo. We also tested the effect of a break period, with no steroids given following SCR or CCR. Our results revealed that while estrogen-activating enzyme activities were fully stimulated by CCR, the enzymes were not significantly upregulated in SCR. Short steroidfree intervals following CCR or SCR treatments did not attenuate enzyme activities. Thus, our data suggested that SCR may lead to reduced breast cancer risk compared with CCR, such that a certain duration of MPA administration may be required to increase the risk of breast cancer. Therefore, the minimal duration sufficient for the protection of endometrium would be theoretically the optimal period for progestogen use in SCR. Also, it appears that a short interval without steroid exposure following HRT does not reduce the risk. Seeger et al. [11] showed that for cell proliferation assays, various progestogens at relatively low concentrations showed inhibition in a CCR model but not in an SCR model, suggesting that the CCR was more favorable than SCR in reducing cancer risk. This discrepancy may be due to the apparently conflicting effects of progestogens on estrogen-activating enzymes and cell proliferation. In terms of clinical trials, few studies have been sufficiently well designed to compare SCR and CCR. The WHI study [1] showed an increased risk of breast cancer for CCR. The Million Women Study [2] also showed an increased risk, but with little difference between SCR and CCR. A prospective Danish study [32] showed an increased risk for current HRT use, with a significantly higher likelihood of developing estrogen-receptor positive breast cancer under a CCR than an SCR, and the Danish Nurse Cohort study [33] also showed that for current users of combined HRT with NET acetate/LNG, a CCR was associated with a higher risk of breast cancer than an SCR. In summary, our in vitro study suggested that progestogens exert different effects on estrogenmetabolizing enzymes in breast cancer cell lines depending on the specific progestogen, duration of use, and regimen. MPA, a progestogen currently used in

B. Xu et al. / Maturitas 56 (2007) 142–152

HRT, may play an opposing role in the enzyme regulation and cell proliferation with regard to the risk of breast cancer. Further studies are needed to elucidate whether MPA leads to a higher risk of breast cancer development via the stimulation of estrogen-activating enzymes than other progestogens.

[10] [11]

[12]

Acknowledgements We are grateful to Dr. Shiuan Chen of the City of Hope National Medical Center, Duarte, CA, for providing the MCF-7aro cells. This work was supported in part by a Grant-in-Aid for Scientific Research (16790965) from the Ministry of Education, Culture, Sports, Science, and Technology, Japan. References [1] Writing Group for the Women’s Health Initiative Investigators. Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results from the Women’s Health Initiative randomized controlled trial. JAMA 2002;288: 321–3. [2] Beral V, Million Women Study Collaborators. Breast cancer and hormone-replacement therapy in the Million Women Study. Lancet 2003;362:419–27. [3] Women’s Health Initiative Steering Committee. Effects of conjugated equine estrogen in postmenopausal women with hysterectomy: the Women’s Health Initiative randomized controlled trial. JAMA 2004;291:1701–12. [4] Schatz RW, Soto AM, Sonnenschein C. Effects of interaction between estradiol-17␤ and progesterone on the proliferation of cloned breast tumor cells (MCF-7 and T47D). J Cell Physiol 1985;124:386–90. [5] Poulin R, Baker D, Poirier D, Labrie F. Multiple actions of synthetic ’progestins’ on the growth of ZR-75-1 human breast cancer cells: an in vitro model for the simultaneous assay of androgen, progestin, estrogen, and glucocorticoid agonistic and antagonistic activities of steroids. Breast Cancer Res Treat 1991;17:197–210. [6] van der Burg B, Kalkhoven E, Isbrucker L, de Laat SW. Effects of progestins on the proliferation of estrogen-dependent human breast cancer cells under growth factor-defined conditions. J Steroid Biochem Mol Biol 1992;42:457–65. [7] Catherino WH, Jeng MH, Jordan VC. Norgestrel and gestodene stimulate breast cancer cell growth through an oestrogen receptor mediated mechanism. Br J Cancer 1993;67:945–52. [8] Cappelletti V, Miodini P, Fioravanti L, Di Fronzo G. Effect of progestin treatment on estradiol-and growth factor-stimulated breast cancer cell lines. Anticancer Res 1995;15:2551–5. [9] Schoonen WG, Joosten JW, Kloosterboer HJ. Effects of two classes of progestagens, pregnane and 19-nortestosterone

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

151

derivatives, on cell growth of human breast tumor cells: I. MCF7 cell lines. J Steroid Biochem Mol Biol 1995;55:423–37. Franke HR, Vermes I. Differential effects of progestogens on breast cancer cell lines. Maturitas 2003;46(Suppl. 1):S55–8. Seeger H, Wallwiener D, Mueck AO. The effect of progesterone and synthetic progestins on serum- and estradiol-stimulated proliferation of human breast cancer cells. Horm Metab Res 2003;35:76–80. Miller WR. Aromatase activity in breast tissue. J Steroid Biochem Mol Biol 1991;39:783–90. James VH, McNeill JM, Lai LC, Newton CJ, Ghilchik MW, Reed MJ. Aromatase activity in normal breast and breast tumor tissues: in vivo and in vitro studies. Steroids 1987;50: 269–79. Yue W, Wang JP, Hamilton CJ, Demers LM, Santen RJ. In situ aromatization enhances breast tumor estradiol levels and cellular proliferation. Cancer Res 1998;58:927–32. Pollow K, Boquoi E, Baumann J, Schmidt-Gollwitzer M, Pollow B. Comparison of the in vitro conversion of estradiol-17 beta to estrone of normal and neoplastic human breast tissue. Mol Cell Endocrinol 1977;6:333–48. Gunnarsson C, Olsson BM, Stal O, Southeast Sweden Breast Cancer Group. Abnormal expression of 17␤-hydroxysteroid dehydrogenases in breast cancer predicts late recurrence. Cancer Res 2001;61:8448–51. Tseng L, Mazella J, Lee LY, Stone ML. Estrogen sulfatase and estrogen sulfotransferase in human primary mammary carcinoma. J Steroid Biochem 1983;19:1413–7. Chetrite GS, Cortes-Prieto J, Philippe JC, Wright F, Pasqualini JR. Comparison of estrogen concentrations, estrone sulfatase and aromatase activities in normal, and in cancerous, human breast tissues. J Steroid Biochem Mol Biol 2000;72:23–7. Suzuki T, Nakata T, Miki Y, et al. Estrogen sulfotransferase and steroid sulfatase in human breast carcinoma. Cancer Res 2003;63:2762–70. Zhou DJ, Pompon D, Chen SA. Stable expression of human aromatase complementary DNA in mammalian cells: a useful system for aromatase inhibitor screening. Cancer Res 1990;50:6949–54. Koshiba H, Kitawaki J, Teramoto M, et al. Expression of allograft inflammatory factor-1 in human eutopic endometrium and endometriosis: possible association with progression of endometriosis. J Clin Endocrinol Metab 2005;90:529–37. Kitawaki J, Koshiba H, Ishihara H, Kusuki I, Tsukamoto K, Honjo H. Progesterone induction of 17␤-hydroxysteroid dehydrogenase type 2 during the secretory phase occurs in the endometrium of estrogen-dependent benign diseases but not in normal endometrium. J Clin Endocrinol Metab 2000;85:3292–6. Bellino FL, Osawa Y. Localization of estrogen synthetase in the chorionic villus fraction after homogenization of human term placenta. J Clin Endocrinol Metab 1977;44:699–707. Kitawaki J, Fukuoka M, Yamamoto T, Honjo H, Okada H. Contribution of aromatase to the deoxyribonucleic acid synthesis of MCF-7 human breast cancer cells and its suppression by aromatase inhibitors. J Steroid Biochem Mol Biol 1992;42: 267–77.

152

B. Xu et al. / Maturitas 56 (2007) 142–152

[25] Schindler AE, Campagnoli C, Druckmann R, et al. Classification and pharmacology of progestins. Maturitas 2003;46(Suppl. 1):S7–S16. [26] de Lignieres B, de Vathaire F, Fournier S, et al. Combined hormone replacement therapy and risk of breast cancer in a French cohort study of 3175 women. Climacteric 2002;5:332–40. [27] Coldham NG, James VH. A possible mechanism for increased breast cell proliferation by progestins through increased reductive 17␤-hydroxysteroid dehydrogenase activity. Int J Cancer 1990;45:174–8. [28] Poutanen M, Moncharmont B, Vihko R. 17␤-hydroxysteroid dehydrogenase gene expression in human breast cancer cells: regulation of expression by a progestin. Cancer Res 1992;52:290–4. [29] Pasqualini JR, Chetrite G, Nguyen BL, et al. Estrone sulfatesulfatase and 17␤-hydroxysteroid dehydrogenase activities: a hypothesis for their role in the evolution of human breast cancer from hormone-dependence to hormone-independence. J Steroid Biochem Mol Biol 1995;53:407–12.

[30] Pasqualini JR, Caubel P, Friedman AJ, Philippe JC, Chetrite GS. Norelgestromin as selective estrogen enzyme modulator in human breast cancer cell lines. Effect on sulfatase activity in comparison to medroxyprogesterone acetate. J Steroid Biochem Mol Biol 2003;84:193–8. [31] Hofseth LJ, Raafat AM, Osuch JR, Pathak DR, Slomski CA, Haslam SZ. Hormone replacement therapy with estrogen or estrogen plus medroxyprogesterone acetate is associated with increased epithelial proliferation in the normal postmenopausal breast. J Clin Endocrinol Metab 1999;84: 4559–65. [32] Tjonneland A, Christensen J, Thomsen BL, et al. Hormone replacement therapy in relation to breast carcinoma incidence rate ratios: a prospective Danish cohort study. Cancer 2004;100:2328–37. [33] Stahlberg C, Pedersen AT, Lynge E, et al. Increased risk of breast cancer following different regimens of hormone replacement therapy frequently used in Europe. Int J Cancer 2004;109:721–7.