Differential effects of ziprasidone and haloperidol on immobilization stress-induced mRNA BDNF expression in the hippocampus and neocortex of rats

Available online at www.sciencedirect.com

JOURNAL OF PSYCHIATRIC RESEARCH

Journal of Psychiatric Research 43 (2009) 274–281

www.elsevier.com/locate/jpsychires

Differential effects of ziprasidone and haloperidol on immobilization stress-induced mRNA BDNF expression in the hippocampus and neocortex of rats Sung Woo Park a, Chan Hong Lee a,b, Jung Goo Lee a,c, Sun Jung Lee a, Na Ri Kim a,b, Sang Mi Choi a,b, Young Hoon Kim a,b,* b

a Paik Institute for Clinical Research, Inje University, Busan, Republic of Korea Department of Psychiatry, School of Medicine, Inje University, Busan, Republic of Korea c Department of Psychiatry, Dong Suh Mental Hospital, Masan, Republic of Korea

Received 19 February 2008; received in revised form 6 May 2008; accepted 26 May 2008

Abstract Recent in vivo and in vitro experiments have demonstrated that second-generation antipsychotic drugs (SGAs) might have neuroprotective effects. Ziprasidone is a SGA that is efficacious in the treatment of schizophrenia. In this study, we sought to analyze the effects of ziprasidone on the expression of the neuroprotective protein brain-derived neurotrophic factor (BDNF) in the rat hippocampus and neocortex, with or without immobilization stress. The effect of ziprasidone (2.5 mg/kg) on the expression of BDNF mRNA was determined by in situ hybridization in tissue sections from the rat hippocampus and neocortex. Haloperidol (1.0 mg/kg) was used for comparison. Haloperidol strongly decreased the expression of BDNF mRNA in both the hippocampal and cortical regions, with or without immobilization stress (p < 0.01). In contrast, the administration of ziprasidone significantly attenuated the immobilization stress-induced decrease in BDNF mRNA expression in the rat hippocampus and neocortex (p < 0.01). Ziprasidone exhibited differential effects on BDNF mRNA expression in the rat hippocampus and neocortex. These results suggest that ziprasidone might have a neuroprotective effect by recovering stress-induced decreases in BDNF mRNA expression. Ó 2008 Elsevier Ltd. All rights reserved. Keywords: Ziprasidone; Haloperidol; Brain-derived neurotrophic factor; Stress; Hippocampus; Neocortex

1. Introduction Recent neuroimaging studies have shown histological evidence for a neurodegenerative process in schizophrenia. Enlarged cerebral ventricles and cerebral gray matter deficits were among the most consistent neuroimaging findings in patients with schizophrenia (Harvey et al., 1993; Lim et al., 1996; Weinberger et al., 1979; Wright et al., 1999,

*

Corresponding author. Present address: Department of Neuropsychiatry, Inje University, Busan Paik Hospital, 633-165 Gaegum-dong, Jin-gu, Busan 614-735, Republic of Korea. Tel.: +82 51 890 6190; fax: +82 51 894 6709. E-mail address: [email protected] (Y.H. Kim). 0022-3956/$ - see front matter Ó 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.jpsychires.2008.05.010

2000). These studies indicated that changes in neuronal plasticity, such as alterations in neuronal proliferation and migration, and enhanced cell vulnerability are involved in schizophrenia. Brain-derived neurotrophic factor (BDNF), the most abundant neurotrophin in the brain, regulates neuronal cell survival, differentiation, synaptic strength and morphology (Ghosh et al., 1994). Increased levels of BDNF are associated with improved learning and memory, and decreased levels of BDNF play a role in age-related memory deficits (Croll et al., 1998). Furthermore, recent studies have shown that the levels of BDNF are decreased in the plasma and postmortem brains of patients with schizophrenia, suggesting that alteration of BDNF expression plays a role in the pathogenesis of the disease (Durany et al., 2001; Tan et al., 2005).

S.W. Park et al. / Journal of Psychiatric Research 43 (2009) 274–281

There is increasing evidence that antipsychotics have differential effects on the levels BDNF (Angelucci et al., 2000, 2005; Chlan-Fourney et al., 2002; Parikh et al., 2004). In contrast to the first-generation antipsychotic (FGA) haloperidol, the second-generation antipsychotic (SGA) olanzapine was associated with reduced loss of cortical gray matter and reduced ventricular enlargement in patients with first-episode psychosis (Lieberman et al., 2005). Another study also demonstrated a greater reduction in hippocampal volume in haloperidol-treated patients than in patients treated with SGAs, indicating that SGAs cause less brain deterioration than FGAs (Chakos et al., 2005). Moreover, an in vivo study in rats showed that chronic exposure to haloperidol, but not risperidone, results in impaired spatial learning performance (Terry et al., 2003). These findings suggest that SGAs may have superior therapeutic efficacy in the treatment of cognitive deficits than FGAs (Kinon and Lieberman, 1996). However, the Clinical Antipsychotic Trials of Intervention Effectiveness (CATIE) trial reported that there was no difference in the cognitive effects of FGAs and SGAs (Keefe et al., 2007). SGAs also failed to show significant efficacy with respect to neurocognition when compared with FGAs (Manschreck and Boshes, 2007). Moreover, some SGAs may increase the risk of developing the metabolic syndrome (Nasrallah, 2006; Newcomer, 2007). Therefore, it can be postulated that the neuroprotective effect of SGAs constitutes a notable difference between FGAs and SGAs. SGAs have neuroprotective effects and are related to neuroplastic processes, including neuronal cell growth and survival. Therefore, investigation of the regulation of BDNF expression and localization may provide a better understanding of the molecular mechanisms underlying the comparative efficacy and safety of FGAs and SGAs. SGAs, including olanzapine and clozapine, are known to up-regulate the levels of BDNF, whereas the FGA haloperidol is known to down-regulate the level of BDNF in the rat brain (Bai et al., 2003). Our previous study showed that quetiapine is able to reverse the stress-induced decrease in the levels of BDNF in the hippocampus and neocortex (Park et al., 2006). However, whether ziprasidone affects BDNF expression in the rat brain is unclear. Ziprasidone is a SGA and has unique receptor profiles including high-affinity serotonin 5-HT2A receptor antagonism, potent agonist activity at 5-HT1A receptors, and relatively high affinity for 5-HT and noradrenaline transporters (Versiani, 2006). An immobilization stress model was used in the presnent study because it is known that the expression of BDNF in the rat hippocampus is reduced in response to acute and repeated immobilization stress (Scaccianoce et al., 2003). In the present study, we aimed to investigate the effects of subchronic administration of ziprasidone on BDNF mRNA expression in the rat hippocampus and cortex, as those regions are most often associated with cognitive performance in both animals and humans. Haloperidol treatment was used for comparison.

275

2. Material and methods 2.1. Animals and drug administration All animal manipulation were performed in accordance with the animal care guidelines of the US National Institutes of Health (NIH publication No. 23-85, revised 1996) and the Korean Academy of Medical Science. All experiments involving animals were approved by the Committee for Animal Experimentation and the Institutional Animal Laboratory Review Board of Inje Medical College (approval No. 2006-011). Male Sprague–Dawley rats (KOATECH Lab, Pyeongtaek, Korea) weighing 250– 300 g were used. The rats were housed three per cage in a room maintained at 21 °C with a 12-h/12-h light-dark cycle with food and water freely available. After 7 days of acclimatization, the rats were randomly divided into six groups of six rats each. The first group (Vehicle) received 0.4% glacial acetic acid as a vehicle (1 mg/kg, i.p.) without immobilization stress. The second (Haloperidol) and third (Ziprasidone) groups received haloperidol (1 mg/kg, i.p.) and ziprasidone (2.5 mg/kg, i.p.), respectively, at the same volume as the vehicle without immobilization stress. The doses of these drugs were selected on the basis of previous animal studies (Abdul-Monim et al., 2006; Bai et al., 2003; Fell et al., 2005) and were in agreement with the published reports concerning the occupancy of dopamine receptors. The doses of haloperidl and ziprasidone were calculated based on studies by Schotte et al. (1993) and Barth et al. (2006), respectively. The fourth group (Vehicle + Stress) received the vehicle at 09:00. One hour later, the rats were completely immobilized for 2 h (from 10:00 to 12:00) in specially designed plastic restraint tubes (dimension: 20 cm high, 7 cm diameter). The rats in the fifth (Haloperidol + Stress) and sixth (Ziprasidone + Stress) groups received haloperidol (1 mg/kg, i.p.) and ziprasidone (2.5 mg/kg, i.p.), respectively, and were then immobilized in the same way as the rats in the fourth group. These procedures were repeated once daily for 3 weeks and were based on a previous study in which BDNF expression was reduced by immobilization (Xu et al., 2002). Ziprasidone was generously supplied by Pfizer Pharmaceuticals (New York, NY, USA), and haloperidol was purchased from Sigma (St. Louis, MO, USA). 2.2. Cloning of rat BDNF DNA fragments PCR was used to generate rat BDNF fragments. Sense (GAAGATCGATGACCATC CTTTTCCTT) and antisense (ACATGGATCCACTATCTTCCCCTTTTAAT) BDNF oligonucleotide primers corresponded to exon 5, which codes for the pro-BDNF peptide and the mature BDNF peptide. PCR was performed on 500 ng of rat genomic BDNF using Taq polymerase (Bio-Rad, CA, USA). The PCR conditions were as follows: one cycle of pre-denaturation at 94 °C for 4 min; 30 cycles of denaturation at 94 °C for 1 min, annealing at 57 °C for 1 min, and elonga-

276

S.W. Park et al. / Journal of Psychiatric Research 43 (2009) 274–281

tion at 72 °C for 2 min; and one cycle of post-elongation at 72 °C for 10 min. DNA fragments of the expected size (750 base pairs) were cloned into pGEM-T (Promega, WI, USA). The identity of the rat BDNF clones was confirmed by dideoxynucleotide sequencing. 2.3. In situ hybridization Analysis of BDNF mRNA by in situ hybridization was conducted as previously described (Park et al., 2006). Rats were sacrificed 24 h after the last immobilization session. Each rat was deeply anesthetized with pentobarbital (75 mg/kg, i.p.) and transcardially perfused with ice-cold phosphate-buffered saline (PBS, pH 7.4), followed by icecold 4% paraformaldehyde in PBS, the brains were removed, post-fixed in the same fixative for 2 h, and then cryoprotected in 15% sucrose–PBS overnight. The brains were then frozen by immersion in isopentane cooled to 80 °C and stored at this temperature until use. Serial tissue sections were cut on a cryostat (10–20 lm). A BDNF cRNA probe of 750 base pairs was labeled with digoxigenin-11-UTP using a DIG RNA labeling kit (Roche, Penzberg, Germany). After ethanol dehydration, sections were hybridized in hybridization buffer with 200 ng/ml of either an antisense or sense BDNF cRNA probe using T7 or SP6 RNA polymerase. Hybridization was performed overnight at 58 °C. After RNase A treatment (20 lg/ml) at room temperature, the nonspecifically bound probe was washed away in several post-hybridization steps in a shaking water bath, starting in 2 SSC and ending with a high-stringency wash in 0.1 SSC at 60 °C. A final wash in 0.5 SSC was carried out at room temperature. The bound probe was then detected with 1:500 alkaline phosphatase-conjugated anti-digoxigenin anti-body, with color developed in a BCIP/NBT solution using a DIG Detection Kit (Roche). For each animal, adjacent sections were hybridized with sense and antisense probes, but no specific hybridization was observed using sense probles, and therefore this data is not shown. 2.4. Quantification of BDNF mRNA hybridization signals Quantitative analysis of slides for BDNF mRNA was performed using image analysis software (Image-Pro Plus version 3.0). The highest levels of BDNF mRNA were found in the hippocampus (CA1, CA3 and dentate gyrus), and cortical areas, such as the parietal cortex, piriform cortex and cingulated cortex, showed high to intermediate levels of BDNF mRNA (Conner et al., 1997). In our previous study (Park et al., 2006), we reported that immobilization stress dramatically decreased the level of BDNF mRNA expression in the parietal and piriform cortices. Therefore, we selected three hippocampal (CA1 and CA3 pyramidal cells and dentate gyrus granule cell layers) and two cortical (parietal and piriform cortex) areas for in situ hybridization. In addition, the effects of various treatment conditions on BDNF expression can be detected

simultaneously because these regions exist in the same tissue sections. Images were captured using an Olympus (Japan) microscope fitted with a digital camera (Nikon, Japan). The number of cells in the purple-colored (labeled) area was counted by outlining a box in the area of interest, and an equivalent area was outlined with a box for each sample. Background expression was subtracted, such that the density of stained cells was calculated as follows and designated as optical density: (area of positive expression negative expression)/number of cells. For each animal, optical density measurements from both sides of 10 individual sections were analyzed, yielding 20 measurements, from which the mean was calculated. These means were expressed as relative intensity where the vehicle control was arbitrarily assigned a value of 100%. 2.5. Statistical analysis Two-way ANOVA was performed to determine the individual and interactive effects of drug administration and immobilization stress on the levels of BDNF mRNA. Dunnett’s test or a t-test was used for post-hoc comparison when appropriate. Values were considered significant at p < 0.05. 3. Results Photomicroscopic images of BDNF mRNA expression in the hippocampal and cortical regions of the rats in the six groups are shown in Fig. 1 and Fig. 2, respectively. The results of two-way ANOVA are summarized in Table 1. The antipsychotic drugs and immobilization stress each had significant effects on the levels of BDNF mRNA in the hippocampus and parietal cortex (all p < 0.01), but not in the piriform cortex (p = 0.058). Significant interactions were found in both the hippocampal and cortical regions (all p < 0.001). Quantitative analysis of BDNF mRNA expression showed significant results in the CA1, CA3, and dentate gyrus areas of the hippocampus (Fig. 3). Post-hoc testing revealed that chronic immobilization stress significantly decreased BDNF mRNA expression in the three regions of the hippocampus (CA1 = 38%, CA3 = 33%, and dentate gyrus = 40%; all p < 0.01). Subchronic haloperidol treatment significantly decreased the level of BDNF expression in the three regions, as compared to the vehicle-treated controls, regardless of the stress condition (without stress: CA1 = 34%, CA3 = 39%, and dentate gyrus = 45%; all p < 0.01; with stress: CA1 = 40%, CA3 = 39%, and dentate gyrus = 46%; all p < 0.01). However, ziprasidone completely reversed the immobilization stress-induced decrease in BDNF mRNA levels (CA1 = 36%, CA3 = 22%, and dentate gyrus = 24%; all p < 0.01). Subchronic ziprasidone treatment did not affect the expression of BDNF in the absence of immobilization stress. In the neocortex, chronic immobilization stress reduced BDNF mRNA expression by 24% in the parietal cortex

S.W. Park et al. / Journal of Psychiatric Research 43 (2009) 274–281

277

Fig. 1. Photomicroscopic image of BDNF mRNA expression in the rat hippocampus. Rats were given a daily injection of vehicle, haloperidol (1 mg/kg), and/or ziprasidone (2.5 mg/kg) for 21 days with or without immobilization stress (2 h daily for 3 weeks). The six conditions shown are the Vehicle (A), Haloperidol (B), Ziprasidone (C), Vehicle + Stress (D), Haloperidol + Stress (E), and Ziprasidone + Stress (F) administrations. Low-magnification (40, scale bar = 300 lm) photomicrographs show BDNF mRNA expression in the hippocampus (top row). High-magnification (400, scale bar = 30 lm) photomicrographs show detailed changes in the CA1, CA3, and dentate gyrus (DG) regions.

Fig. 2. Photomicroscopic images of BDNF mRNA expression in the rat neocortex. Rats were given a daily injection of vehicle, haloperidol (1 mg/kg), and/or ziprasidone (2.5 mg/kg) for 21 days with or without immobilization stress (2 h daily for 3 weeks). The images represent the parietal cortex and piriform cortex. Scale bar = 200 lm.

and 21% in the piriform cortex (all p < 0.01) in comparison to the vehicle-treated controls (Fig. 4). Compared to the vehicle-treated controls, subchronic haloperidol treatment without immobilization stress decreased the BDNF mRNA levels in the two cortical regions (parietal cortex = 27%, piriform cortex = 23%; all p < 0.01), and this result did

not differ from the effect of haloperidol treatment with stress (parietal cortex = 26%, piriform cortex = 28%; all p < 0.01). However, the administration of ziprasidone alone had no effect on BDNF mRNA expression, and the stress-induced decrease in BDNF levels was attenuated by subchronic administration of ziprasidone in the two

278

S.W. Park et al. / Journal of Psychiatric Research 43 (2009) 274–281

Table 1 Summary of two-way analysis of variance

CA1 CA3 Dentate gyrus Parietal cortex Piriform cortex

Haloperdiol

Ziprasidone

Stress

F

p

F

p

F

23.1 59.53 91.06 24.85 35.8

<0.001 <0.001 <0.001 <0.001 <0.001

28.95 7.22 13 8.26 3.63

<0.001 0.007 <0.001 0.004 0.058

31.4 57.15 89.33 12.04 25.22

Haloperidol  Stress

Ziprasidone  Stress

p

F

p

F

p

<0.001 <0.001 <0.001 <0.001 <0.001

18.52 19.36 55.06 18.04 10.35

<0.001 <0.001 <0.001 <0.001 <0.001

18.4 16.12 27.16 16.89 15.33

<0.001 <0.001 <0.001 <0.001 <0.001

Fig. 3. Quantitative analysis of BDNF mRNA in the rat hippocampus. Rats were given a daily injection of vehicle, haloperidol (1 mg/kg), and/or ziprasidone (2.5 mg/kg) for 21 days with or without immobilization stress (2 h daily for 3 weeks). The levels of BDNF mRNA in the CA1, CA3, and dentate gyrus were determined by quantitative densitometry. Three fields from each section and 15 sections from each animal were counted. The results are expressed as the percentage of vehicle control levels and represent the mean ± SEM. of six animals per group. *p < 0.01 vs. vehicle controls; p < 0.01 vs. Vehicle + Stress animals.

Fig. 4. Quantitative analysis of BDNF mRNA in the rat neocortex. Rats were given a daily injection of vehicle, haloperidol (1 mg/kg), and/or ziprasidone (2.5 mg/kg) for 21 days with or without immobilization stress (2 h daily for 3 weeks). The levels of BDNF mRNA in the parietal cortex and piriform cortex were determined by quantitative densitometry. Three fields from each section and 15 sections from each animal were counted. The results are expressed as the percentage of vehicle control levels and represent the mean ± SEM. of six animals per group. *p < 0.01 vs. vehicle controls; p < 0.01 vs. Vehicle + Stress animals.

S.W. Park et al. / Journal of Psychiatric Research 43 (2009) 274–281

regions (parietal cortex = 16%, piriform cortex = 13%; all p < 0.01). 4. Discussion The main findings of the present study were that subchronic administration of ziprasidone, but not haloperidol, significantly attenuated the immobilization stress-induced decrease in BDNF mRNA expression in the rat hippocampus and cortex. However, ziprasidone had no effect on the mRNA expression of BDNF in the absence of immobilization stress. In contrast, subchronic haloperidol treatment strongly reduced the mRNA expression of BDNF in these regions in the absence of stress. The results of the present study revealed that haloperidol decreased the level of BDNF mRNA expression in the rat hippocampus and neocortex under basal conditions. Some of these findings were in agreement with those of a previous study that assessed the levels of BDNF mRNA in the hippocampus after 28 days of treatment with clozapine, olanzapine, and haloperidol (Bai et al., 2003). However, haloperidol did not alter the expression of BDNF under stressful conditions. Some studies have found that acute administration of MK-801, an NMDA receptor antagonist, reduces the hippocampal expression of BDNF, and this effect was exacerbated by haloperidol but normalized by olanzapine or quetiapine (Fumagalli et al., 2003, 2004). In the present study, haloperidol did not have a negative impact on the immobilization stress-induced downregulation of BDNF. This effect of haloperidol might vary according to the duration of treatment (acute vs. subchronic) or animal model employed (MK-801 vs. immobilization stress). The haloperidol-induced reduction in BDNF may increase neurotoxicity, most likely due to a potent dopamine D2 receptor blockade, through oxidative stress resulting from increased monoaminergic metabolism, downregulation of antioxidant defense, and the free radical metabolite of haloperidol (Mahadik and Mukherjee, 1996; Parikh et al., 2003). This haloperidol-induced neurotoxicity has been suggested to underlie the pathogenesis of tardive dyskinesia and cognitive deficits in patients with schizophrenia (Lohr et al., 1990). Our results indicate that, similar to our own previous study with quetiapine (Park et al., 2006), subchronic ziprasidone administration was able to reverse the stressinduced decrease in BDNF expression, not only in the hippocampus but also in the neocortex. A previous study also showed that quetiapine increased the expression of BDNF in the dentate gyrus the of the rat hippocampus under basal conditions. On the other hand, this effect was not observed with the administration of ziprasidone alone. This suggests that unlike quetiapine, ziprasidone may only be a regulator of BDNF under stressful conditions. However, further research is required to confirm this finding. In a previous study, Terry et al. (2006) reported the effects of different durations (7, 14, 45, and 90 days) of oral

279

treatment with haloperidol (2 mg/kg/day) or ziprasidone (12 mg/kg/day) on nerve growth factor (NGF) and choline acetyltransferase (ChAT) levels in the rat hippocampus. In their study, both antipsychotic drugs produced time-dependent deleterious effects on NGF, cholinergic markers (i.e. important neurobiological substrates of memory), and cognitive function, although chronic administration of ziprasidone seemed to be somewhat superior to haloperidol due to less pronounced behavioral effects and a more delayed appearance of neurochemical deficits. Interestingly, treatment with either haloperidol or ziprasidone notably increased NGF and ChAT immunoreactivity at 7 and 14 days of treatment. However, NGF and ChAT immunoreactivity were markedly reduced after 45 days of haloperidol exposure but returned to control levels after ziprasidone treatment. After 90 days of exposure to either haloperidol or ziprasidone, the levels of NGF and ChAT were significantly lower than the control levels. The effect of various durations of antipsychotic treatment could be very important in supporting the idea that SGAs are beneficial and superior to FGAs. Differential timedependent effects of haloperidol and ziprasidone on BDNF levels have not yet been reported. One study showed that 45 days of chronic haloperidol (2 mg/kg) treatment markedly reduced BDNF protein levels, but no such effect was observed with olanzapine (10 mg/kg) (Parikh et al., 2004). This discrepancy might be attributable to the difference in the experimental paradigms (i.e. the dosage, duration of administration, and method of analysis for levels of protein vs. expression of mRNA) used in the present and previous study. Most SGAs have a higher affinity for serotonin 5-HT2A receptors than dopamine D2 receptors (Meltzer et al., 2003). Among these agents, ziprasidone and quetiapine have partial 5-HT1A receptor agonist activity (NewmanTancredi et al., 1998). The 5-HT1A receptor was recently suggested as a promising target for antipsychotic treatment (Millan, 2000). 5-HT1A receptor agonists provide neuroprotection in animal models of stroke and traumatic brain injury (Kline et al., 2001; Prehn et al., 1991), and they can improve negative symptoms and cognitive deficits in patients with schizophrenia by stimulating the release of dopamine in the prefrontal cortex (Ichikawa and Meltzer, 1999). The effectiveness of 5-HT1A agonists in ameliorating cognitive impairment in schizophrenia was consistent with the 5-HT1A partial agonist properties of several SGAs, including clozapine, quetiapine, and ziprasidone (Ichikawa et al., 2001; Newman-Tancredi et al., 1998). It was also reported that clozapine, ziprasidone, and aripiprazole, but not haloperidol, protect against kainic acid-induced lesions of the mouse striatum through activation of 5HT1A receptors (Cosi et al., 2005). The mechanism underlying 5-HT1A agonist-induced neuroprotection is still not fully understood, but it might involve activation of G protein-mediated signal transduction pathways, such as the phosphatidylinositol 3-kinase (PI-3K) pathway and/or the mitogen-activated protein kinase kinase (MAPKK)

280

S.W. Park et al. / Journal of Psychiatric Research 43 (2009) 274–281

pathway, which are activated up on binding of the neurotrophic factors NGF and BDNF to tyrosine kinase A and B receptors (Garnovskaya et al., 1996; Raymond et al., 1999; Yao and Cooper, 1995). The effects of these drugs on BDNF expression may influence their therapeutic effect. BDNF play an important role in the long-term potentiation of hippocampal neurons and in learning and memory, which are related to cognitive functions (Hall et al., 2000; Liu et al., 2000). Data on ziprasidone in other animal models of schizophrenia, e.g. phencyclidine (PCP), have been reported (Abdul-Monim et al., 2006). In this study, PCP, an NMDA antagonist, caused significant impairment of a reversal-learning paradigm, and acute ziprasidone (2.5 mg/kg) resulted in significant attenuation of the impairment induced by PCP in reversal phase performance. In contrast to this effect, acute administration of haloperidol (0.05 mg/kg) failed to significantly reverse the PCP-induced cognitive impairment. Therefore, it would be of interest to investigate whether the effect observed in our animal model also occurs in the PCP model. This study is an extension of our previously published study on the effects of quetiapine on BDNF (Park et al., 2006). This study is also the first report on the differential effects of ziprasidone and haloperidol on BDNF mRNA expression in both hippocampal and cortical regions in rats, with and without immobilization stress. However, a limitation of the present study was that the levels of the BDNF protein were not examined. Additional studies that include Western blot analysis or ELISA are needed to strengthen the findings of the present work. In addition, pro-BDNF levels and the expression of trkB, BDNF’s high affinity receptor, should be investigated in future studies, along with the effects of various durations of ziprasidone exposure. Conflict of interest statement All the authors declare that they have no conflicts of interest. Contributors Park S.W. organized the study and wrote the manuscript. Kim YH designed the study, wrote the protocol, and supervised the procedures of the study. Hong CH performed BDNF expression and statistical analysis. Lee JG performed the literature review and provided guidance on subsequent drafts. Lee SJ, Kim NR, and Choi SM contributed to animal experiment. All authors approved the final manuscript. Role of funding source This work was supported by a Korea Research Foundation Grant funded by the Korean Government (MOEHRD) (KRF-2005-041-E00241). The MOEHRD had no further role in study design; in the collection, anal-

ysis and interpretation of data; in the writing of the report; and in the decision to submit the paper for publication. Acknowledgement The support of MOEHRD is acknowledged. References Abdul-Monim Z, Reynolds GP, Neill JC. The effect of atypical and classical antipsychotics on sub-chronic PCP-induced cognitive deficits in a reversal-learning paradigm. Behavioural Brain Research 2006;169:263–73. Angelucci F, Mathe AA, Aloe L. Brain-derived neurotrophic factor and tyrosine kinase receptor TrkB in rat brain are significantly altered after haloperidol and risperidone administration. Journal Neuroscience Research 2000;60:783–94. Angelucci F, Aloe L, Iannitelli A, Gruber SH, Mathe AA. Effect of chronic olanzapine treatment on nerve growth factor and brainderived neurotrophic factor in the rat brain. European Neuropsychopharmacology 2005;15:311–7. Bai O, Chlan-Fourney J, Bowen R, Keegan D, Li XM. Expression of brain derived neurotrophic factor mRNA in rat hippocampus after treatment with antipsychotic drugs. Journal Neuroscience Research 2003;71:127–31. Barth VN, Chernet E, Martin LJ, Need AB, Rash KS, Morin M, et al. Comparison of rat dopamine D2 receptor occupancy for a series of antipsychotic drugs measured using radiolabeled or nonlabeled raclopride tracer. Life Sciences 2006;78:3007–12. Chakos MH, Schobel SA, Gu H, Gerig G, Bradford D, Charles C, et al. Duration of illness and treatment effects on hippocampal volume in male patients with schizophrenia. The British Journal of Psychiatry 2005;186:26–31. Chlan-Fourney J, Ashe P, Nylen K, Juorio AV, Li XM. Differential regulation of hippocampal BDNF mRNA by typical and atypical antipsychotic administration. Brain Research 2002;954:11–20. Conner JM, Lauterborn JC, Yan Q, Gall CM, Varon S. Distribution of brain-derived neurotrophic factor (BDNF) protein and mRNA in the normal adult rat CNS: evidence for anterograde axonal transport. The Journal of Neuroscience 1997;17:2295–313. Cosi C, Waget A, Rollet K, Tesori V, Newman-Tancredi A. Clozapine, ziprasidone and aripiprazole but not haloperidol protect against kainic acid-induced lesion of the striatum in mice, in vivo: Role of 5-HT1A receptor activation. Brain Research 2005;1043:32–41. Croll SD, Ip NY, Lindsay RM, Wiegand SJ. Expression of BDNF and trkB as a function of age and cognitive performance. Brain Research 1998;812:200–8. Durany N, Michel T, Zochling R, Boissl KW, Cruz-Sanchez FF, Riederer P, et al. Brain-derived neurotrophic factor and neurotrophin 3 in schizophrenic psychoses. Schizophrenia Research 2001;52:79–86. Fell MJ, Gibson R, McDermott E, Sisodia G, Marshall KM, Neill JC. Investigation into the effects of the novel antipsychotic ziprasidone on weight gain and reproductive function in female rats. Behavioural Brain Research 2005;160:338–43. Fumagalli F, Molteni R, Roceri M, Bedogni F, Santero R, Fossati C, et al. Effect of antipsychotic drugs on brain-derived neurotrophic factor expression under reduced N-methyl-D-aspartate receptor activity. Journal of Neuroscience Research 2003;72:622–8. Fumagalli F, Molteni R, Bedogni F, Gennarelli M, Perez J, Racagni G, et al. Quetiapine regulates FGF-2 and BDNF expression in the hippocampus of animals treated with MK-801. Neuroreport 2004;15:2109–12. Garnovskaya MN, Van Biesen T, Hawe B, Casanos Ramos S, Lefkowitz JR, Raymond JR. Ras-dependent activation of fibroblast mitogenactivated protein kinase by 5-HT1A receptor via a G protein beta gamma-subunit-initiated pathway. Biochemistry 1996;35:13716–22.

S.W. Park et al. / Journal of Psychiatric Research 43 (2009) 274–281 Ghosh A, Carnahan J, Greenberg ME. Requirement for BDNF in activity dependent survival of cortical neurons. Science 1994;263:1618–23. Hall J, Thomas KL, Everitt BJ. Rapid and selective induction of BDNF expression in the hippocampus during contextual learning. Nature Neuroscience 2000;3:533–5. Harvey I, Ron MA, Du Boulay G, Wicks D, Lewis SW, Murray RM. Reduction of cortical volume in schizophrenia on magnetic resonance imaging. Psychological Medicine 1993;23:591–604. Ichikawa J, Meltzer HY. Relationship between dopaminergic and serotonergic neuronal activity in the frontal cortex and the action of typical and atypical antipsychotic drugs. European Archives Psychiatry and Clinical Neuroscience 1999;249:90–8. Ichikawa J, Ishii H, Bonaccorso S, Fowler WL, O’Laughlin IA, Meltzer HY. 5-HT(2A) and D(2) receptor blockade increases cortical DA release via 5-HT(1A) receptor activation: a possible mechanism of atypical antipsychotic-induced cortical dopamine release. Journal of Neurochemistry 2001;76:1521–31. Keefe RS, Bilder RM, Davis SM, Harvey PD, Palmer BW, Gold JM, et al. Neurocognitive effects of antipsychotic medications in patients with chronic schizophrenia in the CATIE Trial. Archives of General Psychiatry 2007;64:633–47. Kinon BJ, Lieberman JA. Mechanisms of action of atypical antipsychotic drugs: critical analysis. Psychopharmacology (Berl) 1996;124:2–34. Kline AE, Yu J, Horvath E, Marion DW, Dixon CE. The selective 5HT(1A) receptor agonist Repinotan HCl attenuates histopathology and spatial learning deficits following traumatic brain injury in rats. Neuroscience 2001;106:547–55. Lieberman JA, Tollefson GD, Charles C, Zipursky R, Sharma T, Kahn RS, et al. HGDH Study Group. Antipsychotic drug effects on brain morphology in first-episode psychosis. Archives of General Psychiatry 2005;62:361–70. Lim KO, Tew W, Kushner M, Chow K, Matsumoto B, DeLisi LE. Cortical gray matter volume deficit in patients with first-episode schizophrenia. The American Journal of Psychiatry 1996;153:1548–53. Liu D, Diorio J, Day JC, Francis DD, Meaney MJ. Maternal care, hippocampal synaptogenesis and cognitive development in rats. Nature Neuroscience 2000;3:799–806. Lohr JB, Kuczenski R, Bracha HS, Moir M, Jeste DV. Increased indices of free radical activity in the cerebrospinal fluid of patients with tardive dyskinesia. Biological Psychiatry 1990;28:535–9. Mahadik SP, Mukherjee S. Free radical pathology and antioxidant defense in schizophrenia: a review. Schizophrenia Research 1996;19:1–8. Manschreck TC, Boshes RA. The CATIE schizophrenia trial: results, impact, controversy. Harvard Review of Psychiatry 2007;15:245–58. Meltzer HY, Li Z, Kaneda Y, Ichikawa J. Serotonin receptors: their key role in drugs to treat schizophrenia. Progress in Neuro-Psychopharmacology and Biological Psychiatry 2003;27:1159–72. Millan MJ. Improving the treatment of schizophrenia: focus on serotonin (5-HT) (1A) receptors. The Journal of Pharmacology and Experimental Therapeutics 2000;295:853–61. Nasrallah HA. Metabolic findings from the CATIE trial and their relation to tolerability. CNS Spectrums 2006;11:32–9. Newcomer JW. Metabolic considerations in the use of antipsychotic medications: a review of recent evidence. The Journal of Clinical Psychiatry 2007;68:20–7. Newman-Tancredi A, Gavaudan S, Conte C, Chaput C, Touzard M, Verriele L, et al. Agonist and antagonist actions of antipsychotic

281

agents at 5-HT1A receptors: a [35S]GTPgammaS binding study. European Journal of Pharmacology 1998;355:245–56. Parikh V, Evans DR, Khan MM, Mahadik SP. Nerve growth factor in never medicated first-episode psychotic and medicated chronic schizophrenic patients: possible implications for treatment outcome. Schizophrenia Research 2003;60:117–23. Parikh V, Khan MM, Mahadik SP. Olanzapine counteracts reduction of brain derived neurotrophic factor and TrkB receptors in rat hippocampus produced by haloperidol. Neuroscience Letters 2004;356:135–9. Park SW, Lee SK, Kim JM, Yoon JS, Kim YH. Effects of quetiapine on the brain-derived neurotrophic factor expression in the hippocampus and neocortex of rats. Neuroscience Letters 2006;402:25–9. Prehn JH, Backhauss C, Karkoutly C, Nuglisch J, Peruche B, Rossberg C, et al. Neuroprotective properties of 5-HT1A receptor agonists in rodent models of focal and global cerebral ischemia. European Journal of Pharmacology 1991;203:213–22. Raymond JR, Mukhin YV, Gettys TW, Garnovskaya MN. The recombinant 5-HT1A receptor: G protein coupling and signaling pathways. British Journal of Pharmacology 1999;127:1751–64. Scaccianoce S, Del Bianco P, Caricasole A, Nicoletti F, Catalani A. Relationship between learning, stress and hippocampal brain-derived neurotrophic factor. Neuroscience 2003;121:825–8. Schotte A, Janssen PF, Megens AA, Leysen JE. Occupancy of central neurotransmitter receptors by risperidone, clozapine and haloperidol, measured ex vivo by quantitative autoradiography. Brain Research 1993;631:191–202. Tan YL, Zhou DF, Zhang XY. Decreased plasma brain-derived neurotrophic factor levels in schizophrenic patients with tardive dyskinesia: association with dyskinetic movements. Schizophrenia Research 2005;74:260–70. Terry Jr AV, Hill WD, Parikh V, Waller JL, Evans DR, Mahadik SP. Differential effects of haloperidol, risperidone, and clozapine exposure on cholinergic markers and spatial learning performance in rats. Neuropsychopharmacology 2003;28:300–9. Terry Jr AV, Parikh V, Gearhart DA, Pillai A, Hohnadel E, Warner S, et al. Time-dependent effects of haloperidol and ziprasidone on nerve growth factor, cholinergic neurons, and spatial learning in rats. The Journal of Pharmacology and Experimental Therapeutics 2006;318:709–24. Versiani M. Ziprasidone in bipolar disorder. Expert Opinion on Pharmacotherapy 2006;7:1221–8. Weinberger DR, Torrey EF, Neophytides AN, Wyatt RJ. Structural abnormalities in the cerebral cortex of chronic schizophrenic patients. Archives of General Psychiatry 1979;36:935–9. Wright IC, Ellison ZR, Sharma T, Friston KJ, Murray RM, McGuire PK. Mapping of gray matter changes in schizophrenia. Schizophrenia Research 1999;35:1–14. Wright IC, Rabe-Hesketh S, Woodruff PW, David AS, Murray RM, Bullmore ET. Meta-analysis of regional brain volumes in schizophrenia. The American Journal of Psychiatry 2000;157:16–25. Xu H, Qing H, Lu W, Keegan D, Richardson JS, Chlanf-Fourney J, et al. Quetiapine attenuates the immobilization stress-induced decrease of brain-derived neurotrophic factor expression in rat hippocampus. Neuroscience Letters 2002;321:65–8. Yao R, Cooper MG. Requirement of phosphatidylinositol-3 kinase in the prevention of apoptosis by nerve growth factor. Science 1995;267:2003–6.