Differential expression of chemokines and chemokine receptors during microglial activation and inhibition

Journal of Neuroimmunology 149 (2004) 1 – 9 www.elsevier.com/locate/jneuroim

Differential expression of chemokines and chemokine receptors during microglial activation and inhibition Sergey G. Kremlev *, Rebecca L. Roberts, Charles Palmer Department of Pediatrics, Division of Newborn Medicine, H085, The Milton S. Hershey Medical Center, The College of Medicine, P.O. Box 850, Hershey, PA 17033-0850, USA Received 11 July 2003; received in revised form 12 November 2003; accepted 12 November 2003

Abstract Intrauterine infection produces an inflammatory response in the fetus characterized by increased inflammatory cytokines in the fetal brain and activation of brain microglial cells. Intrauterine infection can release bacterial cell wall products into the fetal circulation. Lipopolysaccharides (LPS) are derived from the cell walls of gram negative organisms. The degree of microglial cell activation may influence the extent of brain injury following an inflammatory stimulus. Chemokines, which are released by activated microglia, regulate the influx of inflammatory cells to the brain. Accordingly, therapeutic strategies that reduce the extent of chemokine expression in microglial cells may prove neuroprotective. Minocycline (MN), a semisynthetic tetracycline derivative, protects brain against global and focal ischemia in rodents and inhibits microglial cell activation. To determine if minocycline can reduce the production of chemokines and chemokine receptors in response to LPS, microglial-like BV-2 and HAPI cells were cultured in the presence or absence of 100 ng/ml of LPS. Enzymelinked immunosorbent assay (ELISA) and semi-quantitative RT-PCR were used to examine changes in inflammatory chemokines (macrophage inflammatory protein-1 (MIP-1a), regulated upon activation, normal T cell expressed and secreted (RANTES), and inducible protein-10 (IP-10)) and chemokine receptor (C-C chemokine receptor 5 (CCR5) and C-X-C chemokine receptor 3 (CXCR3)) production, respectively. We found that in both cell lines chemokine release after 4-, 8-, and 16-h exposure to LPS was significantly higher compared to non-exposed cells for all the chemokines measured, P < 0.001. Minocycline inhibited chemokine release of LPS-stimulated BV-2 cells. There was even greater inhibition (up to 50%) of mRNA expression after exposure to LPS ( P < 0.001). We conclude that endotoxin enhanced the expression of chemokines and chemokine receptors in microglial-like cell lines. Modulation of this expression was achieved with minocycline. Recognition of the mechanisms whereby minocycline exerts its anti-inflammatory effect on microglia may uncover specific targets for pharmacologic intervention. D 2004 Published by Elsevier B.V. Keywords: Microglia; Chemokine; Chemokine receptor; Inflammation

1. Introduction Exposure to infection in utero elicits an inflammatory response characterized by cytokinemia (Duggan et al., 2001), vasculitis of the umbilical blood vessels (Leviton et al., 1976b), and increased levels of inflammatory cytokines in the periventricular white matter (Ling et al., 2002). Babies who are at greater risk of developing an adverse outcome are

Abbreviations: RANTES, regulated upon activation, normal T cell expressed and secreted; MIP-1a, macrophage inflammatory protein-1; IP10, inducible protein-10; CXCR3, C-X-C chemokine receptor 3; CCR5, C-C chemokine receptor 5; LPS, lipopolysaccharide. * Corresponding author. Tel.: +1-717-531-6106; fax: +1-717-5318985. E-mail address: [email protected] (S.G. Kremlev). 0165-5728/$ - see front matter D 2004 Published by Elsevier B.V. doi:10.1016/j.jneuroim.2003.11.012

those born to mothers who have an infection of the placenta (chorioamnionitis) (Verma et al., 1997; Murphy et al., 1995; Bejar et al., 1988, 1992; Leviton et al., 1976a). In attempts to model exposure to intrauterine infection, systemic lipopolysaccharide (LPS) administration in laboratory rats induces increased production of IL-1h and TNFa in fetal rat brain (Cai et al., 2000). In areas of white matter injury, microglia stain positive for inflammatory cytokines TNFa and IL-6 (Yoon et al., 1997b), suggesting that microglia may play an important role in the pathogenesis of injury. Activated microglia are capable of secreting neurotoxins, including free radicals (Giulian et al., 1993). Cell culture experiments have shown that immature oligodendrocytes are particularly vulnerable to free radicals (reviewed in Volpe, 1997). To test the role of intrauterine infection as a cause of fetal brain injury in vivo, Yoon et al. (1997a) developed a model

2

S.G. Kremlev et al. / Journal of Neuroimmunology 149 (2004) 1–9

Table 1 Primer pairs utilized in RT-PCR cDNA

Primer pair

Product size, bp

CCR5

TAGCAGATGACCATGACAAGTAGGG AACCTGGCCATCTCTGACCTGCTCT CACACAGGGATGGCTGAGTTCTACT AGGCCAGAGGCGTTTTCGAGCTATG CTCAGTGTAGCCCAGGATGC ACCACCATGGAGAAGGCTGG

431

CXCR3 GAPDH

651 528

in which fetal rabbits were exposed to intrauterine infection and showed that some rabbits developed areas of necrosis in the white matter. This evidence implicates the brain response to inflammation as central to the production of injury. Elucidating the sequence of events that lead to the brain response to inflammation may offer therapeutic opportunities. Thus, the evidence for a significant role for microglia in brain injury is compelling. A major unresolved issue is the identification of factors involved in attracting and activation of microglia. Findings of increased sensitivity to brain injury in TNF receptor knockout mice and of increased ischemic tolerance with IL-1 treatment (Bruce et al., 1996; Ohtsuki et al., 1996) indicate a potential neuroprotective role for proinflammatory cytokines. However, inflammatory chemokines like regulated upon activation, normal T cell expressed and secreted (RANTES) induce a rapid increase of TNFa that may activate the extrinsic pathway to apoptosis (Fischer et al., 2001), while in other studies NF-nB activation prevents neuronal apoptosis in vitro (Cheng et al., 1994; Barger et al., 1995; Mattson et al., 1995; Tamatani et al., 1999). Multiple proteins including chemokine receptor CXCR4, GDF5, and caspase activator Nod-1 have all been implicated in the initial steps of LPS recognition and signaling. LPS and lipoarabinomannan rapidly activated mitogen-activated protein kinase (MAPK), as well as NF-kB. Thus, signal cascade(s) activated by LPS via different proteins diverge, and therefore activate distinct cellular responses in immune cells (reviewed in Dobrovolskaia and Vogel, 2002). We hypothesized that exposure to bacterial cell wall products like LPS increase the production of chemokines and chemokine receptors in microglia. In the current study, we focused on the examination of several proinflammatory proteins, including macrophage inflammatory protein-1 (MIP-1a), RANTES, inducible protein-10 (IP-10), and chemokine receptor C-X-C chemokine receptor 3 (CXCR3) that are potentially important for the regulation of the movement of macrophage/microglial cells into the damaged area. Chemokines are a group of cytokines that induce movement of some cells including microglia (Luster, 1998). Some chemokines signal proinflammatory effects while others promote healing. Chemokines are divided into four families and interact with receptors that have seven-G protein coupled transmembrane domains (Baggiolini, 1998). In central nervous system (CNS), there is limited understanding as to the cellular sources of chemokine

production, or even which cells have chemokine receptors. It is feasible that the degree of CNS damage following injury is associated with microglial cell activation (Giulian and Vaca, 1993); methods to reduce microglial cell activation pharmacologically have been shown to be protective (Giulian and Robertson, 1990). Minocycline (MN) inhibits microglial activation, and is neuroprotective in global brain ischemia (Yrjanheikki et al., 1998, 1999; Arvin et al., 2002). MN is a semisynthetic second-generation tetracycline. It has a superior penetration

Fig. 1. The properties of chemokine release by microglial-like BV-2 cells. Cells were incubated with graded doses of LPS (0.1 – 1000.0 ng/ml) for 16 h. LPS untreated cells used as a control. *—Values are significantly different ( P < 0.001) from control values (no LPS). The data are the mean of six experiments F S.E.M. A significant increase in MIP-1a (A), RANTES (B), and IP-10 (C) production was found.

S.G. Kremlev et al. / Journal of Neuroimmunology 149 (2004) 1–9

3

Fig. 2. The kinetics of MIP-1a and RANTES release by microglial-like BV-2 cells. BV-2 cells were cultivated with a fixed concentration of LPS (100.0 ng/ml) and assayed for MIP-1a (A) and RANTES (B) at defined intervals. *—Values are significantly different ( P < 0.001) from control values (no LPS). The data are the mean of six experiments F S.E.M. Time-dependent increase of MIP-1a and RANTES release is shown.

through the blood –brain barrier. MN exerts anti-inflammatory effects that are distinct from its antimicrobial action. We hypothesized that one of the MN mechanisms of action could be to reduce the microglial cell production of inflammatory chemokines and chemokine receptors following exposure to bacterial cell wall components like LPS. In this report, we compared a well described mouse microglial-like cell line, BV-2 (Blasi et al., 1990; Bocchini et al., 1992), and a recently characterized spontaneously occurring, immortalized microglial cell line; a highly aggressive proliferating cell type (HAPI cells), derived from newborn rat brain primary microglia-enriched cultures (Cheepsunthorn et al., 2001a,b). The objectives of this study were to determine if microglial cells produce chemokines and chemokine receptors in response to LPS stimulation and also to determine if this response could be inhibited with MN. To achieve these aims we subjected microglial-like cell lines to LPS treatment in vitro and determined levels of proinflammatory chemokine/chemokine receptor produc-

tion. We also treated LPS-stimulated BV-2 and HAPI cells with graded concentrations of MN. We demonstrated a similarity in dose- and time-dependent activation of BV-2 and HAPI microglial-like cells by LPS followed by chemokine/chemokine receptor production. Furthermore, treatment with MN significantly decreased LPS-induced chemokine release and chemokine receptor expression by both our mouse and rat cell lines.

2. Materials and methods 2.1. Cell culture BV-2 cells, a microglial-like mouse cell line, were a generous gift of Dr. Steven W. Levison (Hershey Medical Center, Hershey, PA). HAPI cells, a microglial-like rat cell line, were a generous gift of Dr. James R. Connor (Hershey Medical Center, Hershey, PA). Cells were thawed and

Fig. 3. Regulation of chemokine receptor mRNA expression by LPS. BV-2 cells were cultured in the presence of FBS with (+) or without ( ) LPS (100 ng/ml) and assayed for GAPDH, CCR5, and CXCR3 mRNA expression at defined intervals. An increase in expression of CXCR3 mRNA levels was found 30 min – 4 h after stimulation. CXCR3 mRNA levels once increased after 30 min of stimulation were consistently high for the 1- and 4-h time points. No differences in mRNA CCR5 expression were found during LPS stimulation. A representative gel of three experiments is shown.

4

S.G. Kremlev et al. / Journal of Neuroimmunology 149 (2004) 1–9

bovine serum (FBS; Atlanta Biologicals, Norcross, GA), heat inactivated at 56 jC for 30 min, 2 mM L-glutamine (Sigma) and 1  Pen-Strep (Sigma). Cells were passaged every 2 – 3 days to a density of 1  105 cells/ml. To begin the experiment, the media were removed and fresh 5% FBS supplemented DMEM was added to the cells. Untreated cells in 5% FBS supplemented DMEM were used as control. Cells, BV-2 or HAPI, were seeded into 24-well plates (Corning Costar) at density 5  104 cells/well and treated with LPS (Sigma) and MN (Sigma) as described in the text. The plates were incubated in a tissue culture incubator at 37 jC in an atmosphere of 5% CO2/95% air for the listed period of time. The viability was 95 –98% as determined by trypan blue exclusion. Cells from each single well were withdrawn for RNA extraction. Aliquots of supernatants obtained from each single well were used for ELISA. 2.2. Enzyme-linked immunosorbent assay (ELISA) MIP-1a, RANTES, and IP-10 were assayed by ELISA developed with the commercially available matching pairs of antibodies and appropriate standards (R&D; Minneapolis, MN). Data are expressed as the mean chemokine concentration per ml from replicate determinations F S.E.M. Fig. 4. The properties of chemokine release by microglial-like HAPI cells. Cells were incubated with graded doses of LPS (0.1 – 1000.0 ng/ml) for 16 h. LPS untreated cells used as a control. *—Values are significantly different ( P < 0.001) from control values (no LPS). The data are the mean of four experiments F S.E.M. A significant increase ( P < 0.001) similar to the increase in MIP-1a (A) and RANTES (B), found with microglial-like BV-2 cells, is shown.

passaged until logarithmic growth was achieved. Cell cultures were maintained in 25 – 75 cm2 tissue culture flasks (Corning Costar, Corning, NY) at a concentration of 5 – 9  105 cells/ml, in the growth medium recommended by the American Type Culture Collection (ATCC), consisting of DMEM (Sigma, St. Louis, MO), supplemented with 5% fetal

2.3. RNA extraction and RT-PCR Total RNA was extracted by single step preparation using RNAzolk B reagent (TEL-TEST, Friendswood, TX) following the manufacturer’s instructions. Total RNA from each single well was reverse transcribed into cDNA using AMV Reverse Transcriptase and oligo(dT)15 primer (Promega, Madison, WI). Replicated samples (first strand cDNA equivalent of 10 ng of total RNA) from each single well were amplified individually with a gene-specific primer pair (Table 1). Amplification was performed in a PTC-200 Peltier Thermal Cycler (MJ Research, Waltham, MA). An initial denaturation (2 min at 94

Fig. 5. The kinetics of MIP-1a and RANTES release by microglial-like HAPI cells. HAPI cells were cultivated with fixed concentration of LPS (100.0 ng/ml) and assayed for MIP-1a (A) and RANTES (B) at defined intervals. *—Values are significantly different ( P < 0.05) from control values (no LPS). The data are the mean of four experiments F S.E.M. Time-dependent increase of MIP-1a and RANTES release similar to those described for BV-2 cells was found.

S.G. Kremlev et al. / Journal of Neuroimmunology 149 (2004) 1–9

jC) was followed by a number of PCR cycles (32 – 38) that was changed, depending on the samples, to yield a linear increase of PCR products before reaching plateau, annealing (55 jC for 1 min) and extension (72 jC for 2 min), and a 10min extension at 72 jC. Each experiment included two negative controls – PCR mixture alone, and a cDNA synthesis mixture from which RNA had been omitted. RT-PCR products were electrophoresed on 1.5% agarose gels, which were stained with ethidium bromide and photographed. Photographs were scanned by using an image analysis system (Gel Doc 1000; Bio-Rad, Hercules, CA) conducted by Molecular Analyst Ver. 1.4 (Bio-Rad). The density of the C-C chemokine receptor 5 (CCR5) and CXCR3 bands were normalized relative to GAPDH bands amplified from the same cDNA.

5

(Fig. 3). Untreated cells expressed detectable amounts of CCR5 and CXCR3. However, exposure to LPS induced an additional increase in expression of CXCR3 at all time points measured. CXCR3 mRNA levels once increased after 30 min of stimulation were consistently high for the 1-h time point and peaked at 4 h of LPS stimulation. No differences in mRNA CCR5 expression were found during the LPS treatment.

2.4. Statistics Data were analyzed by using the Student’s t-test, whereby P < 0.05 indicated that the value of the test sample was significant.

3. Results 3.1. Characterization of chemokine/chemokine receptor response by microglial-like BV-2 cells treated with LPS To determine if LPS alters the release or the expression of the chemokines or their receptors, we incubated BV-2 cells in medium containing 0.1, 1.0, 10.0, 100.0, and 1000.0 (ng/ml) LPS, or for controls, LPS-free medium. 3.2. MIP-1a, RANTES, and IP-10 After 16 h of incubation with graded concentrations of LPS supernatants were obtained and assayed for MIP-1a (A), RANTES (B), and IP-10 (C) release (Fig. 1). A dosedependent significant increase ( P < 0.001) was found for all examined chemokines production. The kinetics of MIP1a and RANTES release by microglial BV-2 cells stimulated with LPS is shown in Fig. 2. BV-2 cells were cultured with 100 ng/ml of LPS as described above. Supernatants were obtained and assayed for MIP-1a (A) and RANTES (B). At 4-, 8-, and 16-h a significant increase ( P < 0.001) in MIP-1a and RANTES production was found in the presence of LPS. The highest level of MIP-1a and RANTES in the media was detected at 16 h at a concentration of 1508 F 129 and 1250 F 381 pg/ml, respectively. 3.3. CCR5 and CXCR3 In these experiments, BV-2 cells were cultured in the presence or absence of LPS (100.0 ng/ml) and assayed for CCR5 and CXCR3 mRNA expression at defined intervals

Fig. 6. MN regulation of LPS-induced chemokine production by microgliallike BV-2 cells. BV-2 cells were cultivated with fixed concentration of LPS (100.0 ng/ml) for 16 h in the presence or absence of graded concentrations of MN and assayed for MIP-1a (A), RANTES (B), and IP-10 (C) release. *—Values are significantly different ( P < 0.05) from LPS-stimulated values. The data are the mean of three experiments F S.E.M. A significant inhibition of MIP-1a and RANTES release after 16 h exposure to LPS is shown, while no significant differences in IP-10 release were determined.

6

S.G. Kremlev et al. / Journal of Neuroimmunology 149 (2004) 1–9

3.4. HAPI cells secrete pro-inflammatory chemokines, MIP1a and RANTES, in response to LPS Previously, it was shown that LPS-treated HAPI cells increase transcript production as well as the secretion of the inflammatory cytokines such as TNFa. To determine if HAPI cells are also able to produce inflammatory chemokines in response to LPS, they were grown in 5% serum containing medium (untreated control) or 5% serum containing medium supplemented with graded concentrations of LPS, as described above. At 16 h, the media was collected for the determination of MIP-1a and RANTES. The results are shown in Fig. 4. In these experiments, untreated cells release very low amounts of MIP-1a (A) and undetectable levels of RANTES (B). Exposure to the graded concentrations of LPS (0.1 – 1000.0 ng/ml) showed a clear-cut relationship between the amounts of MIP-1a and RANTES released, and concentrations of LPS. The kinetics of chemokine release by HAPI cells in response to LPS (100.0 ng/ml) is shown in Fig. 5. Secretion of both measured chemokines, MIP-1a (A) and RANTES (B), into the media at 4-, 8-, and 16-h time points were similar to those shown for BV-2 cells (Fig. 2). The highest level of MIP-1a and RANTES in the media was detected at 16 h at a concentration of 1621 F 74 and 1074 F 53 pg/ml, respectively. 3.5. MN regulation of LPS-induced chemokine/chemokine receptor production To determine whether treatment with MN can modify LPS-induced chemokine/chemokine receptor response, BV2 cells were cultured in media containing 100.0 ng/ml LPS, graded doses of MN (0.2 –20 AM), or for controls, LPS-free medium. As shown in Fig. 6, MIP-1a (A) and RANTES (B) release after 16 h exposure to LPS was significantly and dose-dependently inhibited by MN treatment. No significant differences in LPS-induced IP-10 (C) release were found during the MN treatment. After 16 h of incubation in the presence of LPS, MCP-1a and RANTES release as well as an expression of CXCR3 after 4 h of incubation with LPS was significantly higher as compared to non-exposed BV-2 Table 2 Chemokine release and chemokine receptor mRNA expression by BV-2 cells under the influence of LPS and treatment with minocycline Proteina MIP-1a RANTES mRNAb CXCR3 a

No LPS

LPS

PS + MN

% Inhibition

259 F 25 128 F 30

1856 F 33 1421 F 196

1634 F 56 1200 F 149

12 16

0.9 F 0.34

9.24 F 1.14

3.88 F 1.51

58

Chemokine release (pg/ml F S.D.) after 16 h exposure to 100 ng/ml of LPS and 2 AM of MN ( P < 0.001). b CXCR3 mRNA expression (CXCR3/GAPDH ratio F S.D.) after 4 h exposure to 100 ng/ml of LPS and 20 AM of MN ( P < 0.001).

Fig. 7. MN regulation of LPS-induced chemokine production by microgliallike HAPI cells. Cells were cultivated with fixed concentration of LPS (100.0 ng/ml) for 16 h in the presence or absence of 20 AM concentrations of MN and assayed for MIP-1a (A) and RANTES (B) release. *—Values are significantly different ( P < 0.001) from control values (no LPS). **— Values are significantly different ( P < 0.001) from LPS-stimulated values. The data are the mean of three experiments F S.E.M. A significant inhibition of MIP-1a and RANTES release after 16 h exposure to LPS is shown.

cells, P < 0.001 (Table 2). Interestingly, inhibition of message for IP-10 receptor, CXCR3, with MN appeared greater than the inhibition of release we found for all three chemokines (Table 2). Next, we evaluated the ability of MN to inhibit chemokine release by HAPI cells. HAPI cells were treated with 100.0 ng/ ml of LPS for 16 h in the presence or absence of 20 AM of MN (Fig. 7). As has been described for BV-2 cells, under these conditions, MIP-1a (A) and RANTES (B) release was significantly higher as compared to non-exposed HAPI cells, P < 0.001. MN inhibited the release of proinflammatoary chemokines close to the same extent found for BV-2 cells.

4. Discussion In the present study, we investigated the ability of LPS to stimulate pro-inflammatory chemokine release and up-regulate the chemokine receptors. Our data demonstrated that treatment of microglial-like cells, BV-2 and HAPI, with LPS increased chemokine release (MIP-1a, RANTES, and IP10), and chemokine receptor gene expression (CXCR3). We

S.G. Kremlev et al. / Journal of Neuroimmunology 149 (2004) 1–9

also demonstrated that treatment of LPS-stimulated BV-2 and HAPI microglial cells with MN repressed the above mentioned LPS-induced chemokine/chemokine receptor production. Evidence supporting the involvement of inflammatory cytokines and chemokines in CNS injury is well documented (Liu and Ju, 1994; Liu et al., 1994; Yamasaki et al., 1995; Iadecola and Ross, 1997; Uno et al., 1997; MalekAhmadi, 1998; Floyd et al., 1999). Previous studies have established an up-regulation of pro-inflammatory cytokine mRNA expression levels in the brain microglial and neuronal cells in response to a peripheral administration of LPS (Breder et al., 1994; Buttini and Boddeke, 1995; Quan et al., 1997, 1998; Vallieres and Rivest, 1997; Nadeau and Rivest, 1999a,b). The role of proinflammatory chemokines and their receptors, in microglia-mediated neurodegeneration or neuroprotection in injured CNS is poorly defined. The magnitude to which both BV-2 and HAPI microglial cells respond to LPS is different with respect to certain chemokines and chemokine receptors. We found that microglial cells produce approximately two times more MIP-1a in response to LPS, compared to RANTES. The profiles of MIP-1a and RANTES are considerably different from untreated BV-2 cells (control cells, no LPS). Without LPS, there is no observable increase in the amount of this chemokine released over time. In contrast, there is enhanced MIP-1a release from BV-2 cells over time (Fig. 2). In addition, the present studies reveal that BV-2 microglia cells display dissimilar LPS-stimulated profiles with respect to the level of CCR5 and CXCR3 gene expression. No changes in CCR5 gene expression levels were found, whereas CXCR3 levels were increased within 0.5 h of LPS treatment. It is interesting to note that in human monocytes and dendritic cells LPS stimulation down regulated IL-10 induced C-C chemokine receptors and lowered monocyte capacity to bind and to respond to MCP-1 chemotactically (Sozzani et al., 1998a,b). This action of LPS is specific in that C-X-C chemokine receptors were unaffected (Sica et al., 1997). These differences between the basal expression of CCR5 by mouse microglial BV-2 cells and human monocytes can be explained by different cell properties and the different culture conditions (long-term cultivation of BV-2 cells and treatment with LPS alone, without IL-10, vs. short-term isolated cultures of human cells) used in our investigation. The main finding of this study is that inhibition of microglial activation by MN decreased pro-inflammatory chemokine release and chemokine receptor expression. In cultures of microglial-like cells, BV-2 and HAPI, treated with MN, LPS stimulated chemokine release was significantly decreased, compared with those that were treated by LPS only (Figs. 6 and 7). Similar results were found for chemokine receptor, CXCR3, stimulated by LPS and significantly inhibited in the presence of MN (Table 2). Inhibition of microglial activation using MN has also been demonstrated in vitro (Tikka and Koistinaho, 2001; Tikka

7

et al., 2001) and in other experimental models of acute and chronic brain insults (Yrjanheikki et al., 1998, 1999; Tikka and Koistinaho, 2001; Tikka et al., 2001) and results, presumably, from the blockade of p38 mitogen-activated protein kinase (p38 MAPK) (Tikka et al., 2001). It is believed that activated microglia exert cytotoxic effects in the brain through two very different and yet complementary processes. First, they can act as a phagocyte, which involves direct cell-to-cell contacts. Second, they are capable of releasing a large variety of potentially harmful substances (Banati et al., 1993). Consistent with the notion that MN inhibits the ability of microglia to respond to injury, we show that MN not only decreased the release of pro-inflammatory chemokines, but also substantially inhibited proinflammatory chemokine receptors. This would likely reduce the chemotactic response of the microglial cells and so reduce the number of microglial cells that accumulate in injured brain tissue. A drug that reduces expression of chemokine receptors on the cell surface would thus be extremely valuable for neuroprotection and treating brain inflammation and neuronal death. In this context, it is worth mentioning that MN, which is protective in global brain ischemia (Yrjanheikki et al., 1998) and in a mouse model of Huntington disease (Chen et al., 2000), appears to do so by abating iNOS expression and activity. We have shown here that MN decreases CXCR3 gene expression, as well as MIP-1a and RANTES release. MN has been shown to be neuroprotective in various models of stroke and neurodegenerative disease (Yrjanheikki et al., 1998, 1999; Tikka et al., 2001; Tikka and Koistinaho, 2001). This study shows that microglial like cells will secrete chemokines and express message for chemokine receptors following LPS stimulation. This study also found that MN will inhibit this response by the microglia following LPS stimulation. Accordingly, we believe that there may be a role for MN like anti-inflammatory agents in the management of patients who may have been exposed to inflammatory stimuli, like infection. Thus, we conclude that BV-2 and HAPI cells provide an alternative model to primary microglial cell cultures and that HAPI cells may be considered as a unique model of rat derived newborn microglial cells. Acknowledgements This research was funded by NIH grant HD30704-09. We thank Dr. J.R. Connor and Dr. S.W. Levison for supplying HAPI and BV-2 cell lines. References Arvin, K.L., Han, B.H., Du, Y., Lin, S.Z., Paul, S.M., Holtzman, D.M., 2002. Minocycline markedly protects the neonatal brain against hypoxic – ischemic injury. Ann. Neurol. 52, 54 – 61.

8

S.G. Kremlev et al. / Journal of Neuroimmunology 149 (2004) 1–9

Baggiolini, M., 1998. Chemokines and leukocyte traffic. Nature 392, 565 – 568. Banati, R.B., Gehrmann, J., Schubert, P., Kreutzberg, G.W., 1993. Cytotoxicity of microglia. Glia 7, 111 – 118. Barger, S.W., Horster, D., Furukawa, K., Goodman, Y., Krieglstein, J., Mattson, M.P., 1995. Tumor necrosis factors alpha and beta protect neurons against amyloid beta-peptide toxicity: evidence for involvement of a kappa B-binding factor and attenuation of peroxide and Ca2+ accumulation. Proc. Natl. Acad. Sci. U. S. A. 92, 9328 – 9332. Bejar, R., Wozniak, P., Allard, M., Benirschke, K., Vaucher, Y., Goen, R., Berry, C., Schragg, P., Villegas, I., Resnik, R., 1988. Antenatal origin of neurologic damage in newborn infants. Am. J. Obstet. Gynecol. 159, 357 – 363. Bejar, R.F., Vaucher, Y.E., Benirschke, K., Berry, C.C., 1992. Postnatal white matter necrosis in preterm infants. J. Perinatol. 12, 3 – 8. Blasi, E., Barluzzi, R., Bocchini, V., Mazzolla, R., Bistoni, F., 1990. Immortalization of murine microglial cells by a v-raf/v-myc carrying retrovirus. J. Neuroimmunol. 27, 229 – 237. Bocchini, V., Mazzolla, R., Barluzzi, R., Blasi, E., Sick, P., Kettenmann, H., 1992. An immortalized cell line expresses properties of activated microglial cells. J. Neurosci. Res. 31, 616 – 621. Breder, C.D., Hazuka, C., Ghayur, T., Klug, C., Huginin, M., Yasuda, K., Teng, M., Saper, C.B., 1994. Regional induction of tumor necrosis factor alpha expression in the mouse brain after systemic lipopolysaccharide administration. Proc. Natl. Acad. Sci. U. S. A. 91, 11393 – 11397. Bruce, A.J., Boling, W., Kindy, M.S., Peschon, J., Kraemer, P.J., Carpenter, M.K., Holtsberg, F.W., Mattson, M.P., 1996. Altered neuronal and microglial responses to excitotoxic and ischemic brain injury in mice lacking TNF receptors. Nat. Med. 2, 788 – 794. Buttini, M., Boddeke, H., 1995. Peripheral lipopolysaccharide stimulation induces interleukin-1 beta messenger RNA in rat brain microglial cells. Neuroscience 65, 523 – 530. Cai, Z.W., Pan, Z.L., Pang, Y., Evans, O.B., Rhodes, P.G., 2000. Cytokine induction in fetal rat brains and brain injury in neonatal rats after maternal lipopolysaccharide administration. Pediatr. Res. 47, 64 – 72. Cheepsunthorn, P., Palmer, C., Menzies, S., Roberts, R.L., Connor, J.R., 2001a. Hypoxic/ischemic insult alters ferritin expression and myelination in neonatal rat brains. J. Comp. Neurol. 431, 382 – 396. Cheepsunthorn, P., Radov, L., Menzies, S., Reid, J., Connor, J.R., 2001b. Characterization of a novel brain-derived microglial cell line isolated from neonatal rat brain. Glia 35, 53 – 62. Chen, M., Ona, V.O., Li, M., Ferrante, R.J., Fink, K.B., Zhu, S., Bian, J., Guo, L., Farrell, L.A., Hersch, S.M., Hobbs, W., Vonsattel, J.P., Cha, J.H., Friedlander, R.M., 2000. Minocycline inhibits caspase-1 and caspase-3 expression and delays mortality in a transgenic mouse model of Huntington disease. Nat. Med. 6, 797 – 801. Cheng, J., Zhou, T., Liu, C., Shapiro, J.P., Brauer, M.J., Kiefer, M.C., Barr, P.J., Mountz, J.D., 1994. Protection from Fas-mediated apoptosis by a soluble form of the Fas molecule. Science 263, 1759 – 1762. Dobrovolskaia, M.A., Vogel, S.N., 2002. Toll receptors, CD14, and macrophage activation and deactivation by LPS. Microbes Infect. 4, 903 – 914. Duggan, P.J., Maalouf, E.F., Watts, T.L., Sullivan, M.H., Counsell, S.J., Allsop, J., Al-Nakib, L., Rutherford, M.A., Battin, M., Roberts, I., Edwards, A.D., 2001. Intrauterine T-cell activation and increased proinflammatory cytokine concentrations in preterm infants with cerebral lesions. Lancet 358, 1699 – 1700. Fischer, F.R., Luo, Y., Luo, M., Santambrogio, L., Dorf, M.E., 2001. RANTES-induced chemokine cascade in dendritic cells. J. Immunol. 167, 1637 – 1643. Floyd, R.A., Hensley, K., Jaffery, F., Maidt, L., Robinson, K., Pye, Q., Stewart, C., 1999. Increased oxidative stress brought on by pro-inflammatory cytokines in neurodegenerative processes and the protective role of nitrone-based free radical traps. Life Sci. 65, 1893 – 1899. Giulian, D., Robertson, C., 1990. Inhibition of mononuclear phagocytes reduces ischemic injury in the spinal cord. Ann. Neurol. 27, 33 – 42.

Giulian, D., Vaca, K., 1993. Inflammatory glia mediate delayed neuronal damage after ischemia in the central nervous system. Stroke 24, I-84 – I-90. Giulian, D., Vaca, K., Corpuz, M., 1993. Brain glia release factors with opposing actions upon neuronal survival. J. Neurosci. 13, 29 – 37. Iadecola, C., Ross, M.E., 1997. Molecular pathology of cerebral ischemia: delayed gene expression and strategies for neuroprotection. Ann. N.Y. Acad. Sci. 835, 203 – 217. Leviton, A., Gilles, F., Neff, R., Yaney, P., 1976a. Multivariate analysis of risk of perinatal telencephalic leucoencephalopathy. Am. J. Epidemiol. 104, 621 – 626. Leviton, A., Gilles, F.H., Strassfeld, R., 1976b. Cesarian section and the risk of neonatal intracranial hemorrhage. Trans. Am. Neurol. Ass. 101, 121 – 124. Ling, Z., Gayle, D.A., Ma, S.Y., Lipton, J.W., Tong, C.W., Hong, J.S., Carvey, P.M., 2002. In utero bacterial endotoxin exposure causes loss of tyrosine hydroxylase neurons in the postnatal rat midbrain. Mov. Disord. 17, 116 – 124. Liu, S., Ju, G., 1994. Origin of CCK-like immunoreactive nerve fibers in the neurohypophysis of the rat. Brain Res. 651, 7 – 15. Liu, W., Brosnan, C.F., Dickson, D.W., Lee, S.C., 1994. Macrophage colony-stimulating factor mediates astrocyte-induced microglial ramification in human fetal central nervous system culture. Am. J. Pathol. 145, 48 – 53. Luster, A.D., 1998. Chemokines—chemotactic cytokines that mediate inflammation. N. Engl. J. Med. 338, 436 – 445. Malek-Ahmadi, P., 1998. Cytokines in dementia of the Alzheimer’s type (DAT): relevance to research and treatment. Neurosci. Biobehav. Rev. 22, 389 – 394. Mattson, M.P., Barger, S.W., Begley, J.G., Mark, R.J., 1995. Calcium, free radicals, and excitotoxic neuronal death in primary cell culture. Methods Cell Biol. 46, 187 – 216. Murphy, D.J., Sellers, S., MacKenzie, I.Z., Yudkin, P.L., Johnson, A.M., 1995. Case-control study of antenatal and intrapartum risk factors for cerebral palsy in very preterm singleton babies. Lancet 346, 1449 – 1451. Nadeau, S., Rivest, S., 1999a. Effects of circulating tumor necrosis factor on the neuronal activity and expression of the genes encoding the tumor necrosis factor receptors (p55 and p75) in the rat brain: a view from the blood – brain barrier. Neuroscience 93, 1449 – 1464. Nadeau, S., Rivest, S., 1999b. Regulation of the gene encoding tumor necrosis factor alpha (TNF-alpha) in the rat brain and pituitary in response in different models of systemic immune challenge. J. Neuropathol. Exp. Neurol. 58, 61 – 77. Ohtsuki, T., Ruetzler, C.A., Tasaki, K., Hallenbeck, J.M., 1996. Interleukin1 mediates induction of tolerance to global ischemia in gerbil hippocampal CA1 neurons. J. Cereb. Blood Flow Metab. 16, 1137 – 1142. Quan, N., Whiteside, M., Kim, L., Herkenham, M., 1997. Induction of inhibitory factor kappaBalpha mRNA in the central nervous system after peripheral lipopolysaccharide administration: an in situ hybridization histochemistry study in the rat. Proc. Natl. Acad. Sci. U. S. A. 94, 10985 – 10990. Quan, N., Whiteside, M., Herkenham, M., 1998. Time course and localization patterns of interleukin-1beta messenger RNA expression in brain and pituitary after peripheral administration of lipopolysaccharide. Neuroscience 83, 281 – 293. Sica, A., Saccani, A., Borsatti, A., Power, C.A., Wells, T.N., Luini, W., Polentarutti, N., Sozzani, S., Mantovani, A., 1997. Bacterial lipopolysaccharide rapidly inhibits expression of C-C chemokine receptors in human monocytes. J. Exp. Med. 185, 969 – 974. Sozzani, S., Allavena, P., D’Amico, G., Luini, W., Bianchi, G., Kataura, M., Imai, T., Yoshie, O., Bonecchi, R., Mantovani, A., 1998a. Differential regulation of chemokine receptors during dendritic cell maturation: a model for their trafficking properties. J. Immunol. 161, 1083 – 1086. Sozzani, S., Ghezzi, S., Iannolo, G., Luini, W., Borsatti, A., Polentarutti, N., Sica, A., Locati, M., Mackay, C., Wells, T.N., Biswas, P., Vicenzi,

S.G. Kremlev et al. / Journal of Neuroimmunology 149 (2004) 1–9 E., Poli, G., Mantovani, A., 1998b. Interleukin 10 increases CCR5 expression and HIV infection in human monocytes. J. Exp. Med. 187, 439 – 444. Tamatani, M., Che, Y.H., Matsuzaki, H., Ogawa, S., Okado, H., Miyake, S., Mizuno, T., Tohyama, M., 1999. Tumor necrosis factor induces Bcl-2 and Bcl-x expression through NFkappaB activation in primary hippocampal neurons. J. Biol. Chem. 274, 8531 – 8538. Tikka, T.M., Koistinaho, J.E., 2001. Minocycline provides neuroprotection against N-methyl-D-aspartate neurotoxicity by inhibiting microglia. J. Immunol. 166, 7527 – 7533. Tikka, T., Fiebich, B.L., Goldsteins, G., Keinanen, R., Koistinaho, J., 2001. Minocycline, a tetracycline derivative, is neuroprotective against excitotoxicity by inhibiting activation and proliferation of microglia. J. Neurosci. 21, 2580 – 2588. Uno, H., Matsuyama, T., Akita, H., Nishimura, H., Sugita, M., 1997. Induction of tumor necrosis factor-alpha in the mouse hippocampus following transient forebrain ischemia. J. Cereb. Blood Flow Metab. 17, 491 – 499. Vallieres, L., Rivest, S., 1997. Regulation of the genes encoding interleukin-6, its receptor, and gp130 in the rat brain in response to the immune activator lipopolysaccharide and the proinflammatory cytokine interleukin-1beta. J. Neurochem. 69, 1668 – 1683. Verma, U., Tejani, N., Klein, S., Reale, M.R., Beneck, D., Figueroa, R., Visintainer, P., 1997. Obstetric antecedents of intraventricular hemor-

9

rhage and periventricular leukomalacia in the low-birth-weight neonate. Am. J. Obstet. Gynecol. 176, 275 – 281. Volpe, J.J., 1997. Brain injury in the premature infant—from pathogenesis to prevention. Brain Develop. 19, 519 – 534. Yamasaki, Y., Matsuo, Y., Matsuura, N., Onodera, H., Itoyama, Y., Kogure, K., 1995. Transient increase of cytokine-induced neutrophil chemoattractant, a member of the interleukin-8 family, in ischemic brain areas after focal ischemia in rats. Stroke 26, 318 – 322 (Discussion 322-313). Yoon, B.H., Kim, C.J., Romero, R., Jun, J.K., Park, K.H., Choi, S.T., Chi, J.G., 1997a. Experimentally induced intrauterine infection causes fetal brain white matter lesions in rabbits. Am. J. Obstet. Gynecol. 177, 797 – 802. Yoon, B.H., Romero, R., Kim, C.J., Koo, J.N., Choe, G., Syn, H.C., Chi, J.G., 1997b. High expression of tumor necrosis factor-alpha and interleukin-6 in periventricular leukomalacia. Am. J. Obstet. Gynecol. 177, 406 – 411. Yrjanheikki, J., Keinanen, R., Pellikka, M., Hokfelt, T., Koistinaho, J., 1998. Tetracyclines inhibit microglial activation and are neuroprotective in global brain ischemia. Proc. Natl. Acad. Sci. U. S. A. 95, 15769 – 15774. Yrjanheikki, J., Tikka, T., Keinanen, R., Goldsteins, G., Chan, P.H., Koistinaho, J., 1999. A tetracycline derivative, minocycline, reduces inflammation and protects against focal cerebral ischemia with a wide therapeutic window. Proc. Natl. Acad. Sci. U. S. A. 96, 13496 – 13500.