Differential expression of fibrillin-3 adds to microfibril variety in human and avian, but not rodent, connective tissues

Genomics 83 (2004) 461 – 472 www.elsevier.com/locate/ygeno

Differential expression of fibrillin-3 adds to microfibril variety in human $ and avian, but not rodent, connective tissues Glen M. Corson, Noe L. Charbonneau, Douglas R. Keene, and Lynn Y. Sakai * Shriners Hospital for Children, Department of Biochemistry and Molecular Biology, Oregon Health and Science University, Portland, OR 97201, USA Received 27 January 2003; accepted 25 August 2003

Abstract The human genome contains three fibrillins: FBN1 and FBN2, both well characterized, and FBN3, reported only as a cDNA sequence. Like FBN2, the highest expression levels of FBN3 were found in fetal tissues, with only low levels in postnatal tissues. Immunolocalization demonstrated fibrillin-3 in extracellular microfibrils abundant in developing skeletal elements, skin, lung, kidney, and skeletal muscle. Unlike the other two fibrillins, FBN3 expression is high in brain, and FBN3 is alternatively spliced, removing the exon encoding cbEGF2. Like FBN1, FBN3 contains three alternate exons in the 5V UTR. While FBN3 orthologs were identified in cow and chicken, Fbn3 appears to have been inactivated in the mouse genome, perhaps during chromosome fission events. Located on chromosome 19p13.3 – 13.2, FBN3 is a candidate gene for Weill – Marchesani syndrome. D 2003 Elsevier Inc. All rights reserved. Keywords: Fibrillin; Weill – Marchesani syndrome; Marfan syndrome; Microfibril; Elastic fiber; Heritable disorders of connective tissue; Extracellular matrix

Fibrillins are extracellular matrix macromolecules that perform architectural functions in most connective tissues. Fibrillins assemble into microfibrils that can be identified ultrastructurally as uniform, small-diameter fibrils. Microfibrils have been described in all organs as well as in very early developing embryos [1– 3]. Fibrillin-1 was first described as a ubiquitous component of these ultrastructurally identifiable connective tissue elements [4]. Fibrillins, which are extended, linear molecules [5], are thought to contribute to the backbone structure of microfibrils, visualized as ‘‘beads on a string’’ after rotary shadowing and electron microscopy [6]. Expression and immunolocalization studies have demonstrated that, in contrast to fibrillin-1, fibrillin-2 is largely restricted to developing fetal tissues [7– 9]. Both fibrillins can form distinct fibrillar polymers, as well as heteropolymeric fibrils [9]. In addition, similar domains in the fibrillins mediate fibril assembly, suggesting that fibrillin-1 and fibrillin-2 can perform equivalent architectural functions

$ Sequence data from this article have been deposited with the Genbank Data Library under Accession Nos. AY165863 – AY165867. * Corresponding author. Shriners Hospital for Children, 3101 SW Sam Jackson Park Road, Portland, OR 97201, USA. Fax: +1-503-221-3451. E-mail address: [email protected] (L.Y. Sakai).

0888-7543/$ - see front matter D 2003 Elsevier Inc. All rights reserved. doi:10.1016/j.ygeno.2003.08.023

[9]. Gene targeting experiments in mice [10,11] demonstrated that neither fibrillin is required for embryogenesis or development, even though both are present from gastrulation, and that even in the absence of one or the other fibrillin, microfibrils and elastic fibers are assembled. Since fibrillins can perform equivalent architectural functions, it seems that in the absence of one fibrillin, the other can compensate. Cloning and sequencing of fibrillin-1 [12,13] and fibrillin-2 [7] revealed highly homologous primary structures composed of multiple domains (calcium-binding epidermal growth factor-like modules (cbEGF),1 8-cysteine-containing modules (8cys), and hybrid modules). The overall organization of these domain modules is identical within each of the fibrillin isoforms, in contrast to the related family of latent transforming growth factor h-binding proteins (LTBPs), whose members contain similar domains that are, however, variable in size and structure. We used BLAST homology searches of fibrillin-2 queries against the GenBank database of human genomic sequences

1

Abbreviations used: cbEGF, calcium-binding epidermal growth factor-like; 8cys, 8-cysteine module; LTBP, latent TGFh-binding protein; mAb, monoclonal antibody; pAb, polyclonal antibody.

462

G.M. Corson et al. / Genomics 83 (2004) 461–472

and found the presence of segments of chromosome 19 with significant similarity to previously identified members of the fibrillin protein family. A combination of PCR, sequencing, and matching database entries allowed us to assemble the FBN3 cDNA sequence properly. At the same time, a large 8966-bp clone (GenBank Acccession No. AB053450) from a human fetal brain cDNA library was sequenced and identified as FBN3 [14]. Investigations presented here further describe the FBN3 gene structure and demonstrate temporal and spatial expression patterns of the gene and protein. In addition, comparisons with other species yielded novel findings about the family of fibrillin genes.

Results Gene and protein structure FBN3 is located on chromosome 19p13.3 – p13.2 in a region of f85 kb and is composed of 66 exons. The FBN3 gene structure matches nearly exactly that of the other fibrillins, except that the exon encoding cbEGF6 and the exon encoding the first half of 8cys2, which are separate in FBN1 and FBN2, are fused into a single exon in FBN3. The deduced primary structure of fibrillin-3 substantially resembles that of the other two fibrillins. It is composed mainly of multiple cysteine-rich domains (cbEGF modules, 8cys modules, and hybrid modules, as originally described for fibrillin-1 [13]), interrupted by one internal region of unique sequence devoid of cysteines. Among the three fibrillins, amino acid identities are high, including the absolute conservation of all cysteine residues, and their overall domain organization is consistent throughout each of the molecules (Fig. 1A). In the internal unique region, which is proline-rich in fibrillin-1 and glycine-rich in fibrillin-2, both glycine and proline residues predominate in fibrillin-3. As in the other fibrillins, polybasic sites predicted to be cleavage sites used by furin-type proprotein convertases are present in both the amino and the carboxyl termini of fibrillin-3. In addition to the conserved RGD site found in the fourth 8cys module of all fibrillins, fibrillin-3 has a second RGD motif located in cbEGF19. The 10 consensus sequences for Nlinked glycosylation identified in fibrillin-3 are also found in the other fibrillins; other sites present in fibrillin-1 and fibrillm-2 are not found in fibrillin-3. The unmodified propeptide is predicted to be composed of 2851 amino acids, with a corresponding molecular mass of f305 kDA.

The cDNA sequence was extended by 5V- and 3V-RACE experiments. A complete 3V UTR of 519 bp was obtained, including a canonical polyadenylation signal. Similar to the variants found in the 5V region of FBN1 [13], three transcript variants were identified within the 5V region of FBN3, arising from alternate first exons consisting variously of f140– 415 bp of untranslated sequence (Fig. 1C). One transcript form begins with exon 1, located f2.4 kb upstream of the coding region, and is spliced to an internal acceptor site within exon 3, 17 bp 5V of the translation start site. A small CpG island of f360 bp overlaps the vicinity of exon 1. Another variant initiates with exon 2, situated f1.4 kb upstream of the coding region, and is also spliced to the internal acceptor site in exon 3. A third alternate delineates an extended exon 3, initiating at least 286 bp upstream of the translation start site and continuing directly into the coding region. Thus, the transcripts vary in their 5V UTRs, but have in common the immediate context for translation initiation and the subsequent entire coding region. These three variant transcripts have been deposited with GenBank under Accession Nos. AY165863, AY165864, and AY165865. Expression of FBN3 in human tissues and cell lines RT-PCR was used to confirm the presence of FBN3 transcripts in cultured skin fibroblasts as well as numerous other cell and tissue sources (Fig. 2A and other data not shown) and to obtain overlapping cDNAs comprising the full-length coding sequence. Compared to other targets (data not shown), the levels of FBN3 mRNA were estimated to be relatively low. Northern blot analysis of fetal RNAs revealed a transcript of f9.5 kb (Fig. 2B), consistent with the cloned cDNAs, of which the longest form observed was 9361 bp, exclusive of poly(A) tail. A normalized dot blot was used to survey additional tissues. The highest signals were obtained from fetal lung, brain, and kidney, whereas low levels were observed for a wide variety of adult tissues (Fig. 2C). Expression of FBN3 orthologs in other species The human fibrillin-3 sequence was used to query the GenBank EST database for possible orthologs in other species. Several bovine and porcine EST clones with high similarity to segments of FBN3 were identified. RT-PCR was used to search for expression in chicken. Using chick embryo cDNA as template and degenerate primers based on human

Fig. 1. (A) Schematic representations of the fibrillin isoforms and recombinant polypeptides used in these studies. Overall amino acid identities between the isoforms are shown at the left margin, calculated after alignment by the program Gap (Wisconsin Package, Genetics Computer Group). (B) Specificity of fibrillin-3 mAb in ELISA. mAb 129 with various test substrates (recombinant fibrillin-1 , fibrillin-2, and fibrillin-3 polypeptides) demonstrated a high titer and specificity for fibrillin-3. (C) The 5Vgenomic organization of human FBN3. Three alternative FBN3 transcript variants are depicted, which arise from alternative first exons, as deduced from cDNAs obtained by 5V-RACE. Untranslated exon regions are shown as open boxes, coding regions as shaded boxes, introns as solid lines; transcript splicing patterns are shown as thin solid lines. Exons 1 and 2 are each spliced into an internal splice acceptor within exon 3, 17 bp upstream of the common translation start site. The third variant delineates an extended exon 3, contiguous with the coding region. Transcription start sites have not been exactly defined and are represented as broken lines. Sizes in base pairs of exons and introns are indicated in italics within parentheses.

G.M. Corson et al. / Genomics 83 (2004) 461–472

463

464

G.M. Corson et al. / Genomics 83 (2004) 461–472

Fig. 2. Expression of human FBN3 mRNA. (A) RT-PCR of a partial FBN3 product using RNA extracted from human fetal tissues and cultured cells showed detectable message in all sources examined, using primers FBN3-15S and FBN3-3AS. M, 100 bp marker. (B) Northern blot of poly(A)+ RNA from human 26-week fetal brain, probed with a 3V region of FBN3 showing a 9.5-kb mRNA. (C) Analysis of a normalized dot blot containing RNA from various human tissues. The bound radiolabeled FBN3 probe was detected and quantitated by phosphoimager. Striped bars designate fetal samples, while filled bars correspond to adult samples.

FBN3 sequence, a PCR product was obtained corresponding to a C-terminal region in which sequence from chick orthologs of FBN1 and FBN2 have been reported previously (GenBank Accession Nos. AF194817, AF194818). This product yielded a novel sequence with high similarity to human FBN3. The chick cDNA was extended by a series of overlapping PCRs using primers based on the novel sequence and additional degenerate primers. Using a variety of degenerate primers based on conserved regions of FBN3 in human, cow, and chick, RT-PCR failed repeatedly to yield successful products from the mouse. Analyses of currently available mouse and rat genome data revealed only partial, nonfunctional fibrillin-3-like sequences. In both the mouse and the rat, sequences matching

fibrillin-3 amino and carboxyl termini were found, but these were interrupted by stop codons. PCR of these regions from mouse genomic DNA confirmed the presence of abnormal translation stop codons in these sequences (data not shown). Most of the central portion of the gene appeared to have been deleted. In the mouse, EGFl (exon 3) and EGF3 (exon 5) appeared to be intact, while other regions of similarity (EGF2 and several cbEGF domains) were often interrupted by stop codons. Sequences encoding 8cys modules were not identifiable in the mouse or rat. In each case, the rodent sequences were found within chromosomal regions synthenic to human chromosome 19p13 (mouse chromosome 8 and rat chromosome 12). In the mouse, 40% of the region between the sequences homologous to the amino and carboxyl termini of

G.M. Corson et al. / Genomics 83 (2004) 461–472

465

FBN3 contains repeat elements (LINE-l elements appear twice, and there is a ribosomal L32-like pseudogene present) or undefined sequences homologous to multiple regions of multiple mouse chromosomes. Consistent with the absence of a functional mouse Fbn3, immunohistochemical analyses of embryonic mouse tissues using an anti-fibrillin3 polyclonal antiserum (described below) appeared to be negative (data not shown). Alternative splicing of FBN3 exon 10 Unlike FBN1 and FBN2, all human FBN3 cDNAs examined to date (from RT-PCR experiments with cultured cells and commercially available fetal cDNAs) splice out the predicted exon 10 (GenBank Accession No. AY165866), which encodes cbEGF2 (Fig. 3 and other data not shown). Specific primers for each chick and human fibrillin isoform were used to examine the expression patterns of exons in the region of cbEGF2 (Fig. 3A). RT-PCR from chick and human embryonic RNAs showed that for fibrillin-1, both human and chick expressed exclusively transcripts that included the exon for cbEGF2. For fibrillin-2, human cDNA again showed only a cbEGF2(+)-included form, whereas chick cDNAs contained both cbEGF2(+) and cbEGF2(
) forms in apparently similar amounts. This result is consistent with partial cDNA sequences found in GenBank (Accession Nos. AF300614, AF300615), indicating alternative splicing of this exon in fibrillin-2 of embryonic chick. For fibrillin-3, the PCR products we obtained showed exclusively a cbEGF2(
) form in human, in contrast to chick, which showed only a cbEGF2(+) form, the sequence of which has been deposited with GenBank under Accession No. AY165867. An alignment of the deduced amino acid sequences from this region of fibrillin-3 of human and chick is shown in Fig. 3B. The sequenced fibrillin-3 products include the internal unique regions, which are rich in glycine and proline residues in both species and are similar in overall length. Since alternative splicing of cbEGF2 was found in chick fibrillin-2, but not in chick fibrillin-3, sequences of chick fibrillin-2 and chick fibrillin-3 were compared with that of human fibrillin-3. In the region of alternative splicing, the chick fibrillin-3 was most homologous to human fibrillin-3, particularly in the unique glycine/proline-rich region (Fig. 3B). Designation of the chick fibrillin-3 gene as such was also confirmed by the presence of a single exon encoding cbEGF6 and the first half of 8cys2, a distinctive feature of human FBN3. PCR of genomic DNA from this region using chick fibrillin-3 primers resulted in a product consistent with a single exon, whereas chick fibrillin-2 primers yielded a large product consistent with the presence of two exons and the intervening sequence between them (data not shown). Therefore, since the human FBN2 gene contains two exons, one coding for cbEGF6 and one for the first half of 8cys2, with a large intron in between, the chick gene that alternatively splices cbEGF2 was designated chick FBN2.

Fig. 3. Alternative splicing in fibrillin isoforms of human and chicken. (A) RT-PCR of regions of fibrillin isoforms from embryonic chick and human RNAs. The following primers were used: chick Fbn1, primers CF1-3S and CF1-1AS; chick Fbn2, primers CF2-3S and CF2-1AS; chick Fbn3, primers CF3-5S and CF3-1OAS; human FBN1, primers 32-8.6S and PF3.1AS; human FBN2, primers 5-1.2S and FBN2-1568AS; human FBN3, primers FBN3-13s and FBN3-17AS. Filled arrowheads indicate positions predicted for products amplified from transcripts that include cbEGF2; open arrowheads indicate products from alternatively spliced transcripts lacking this domain. M, 100 bp marker. (B) The peptide sequence deduced from the PCR product shown for human FBN3 and comparison to the equivalent regions of the chick Fbn3 and chick Fbn2 isoforms. Residues identical to human fibrillin-3 are shown with black background. cbEGF2 is absent in the human cDNA from this source, but present in the chick. The glycine/ proline-rich internal unique region and flanking domains of the fibrillin-3 isoforms are highly similar between the species.

Characterization of fibrillin-3-specific antibodies A four-domain recombinant fibrillin-3 peptide, rF301 (represented schematically in Fig. 1A), was used as immunogen for the production of polyclonal antiserum in rabbit and monoclonal antibodies in mouse. The antibodies were tested in ELISA with rF301 and various fibrillin-1 and

466

G.M. Corson et al. / Genomics 83 (2004) 461–472

G.M. Corson et al. / Genomics 83 (2004) 461–472

467

Fig. 5. Immunoelectron microscopy of fetal human digit perichondrium using fibrillin-3 mAbs. (A) 10 weeks, mAb 129. (B) 16 weeks mAb 317. (C) 16 weeks, mAb 405. Scale bar, 100 nm.

fibrillin-2 recombinant polypeptides (spanning most of these other fibrillins, depicted in Fig. 1A) as substrate. Five monoclonal antibodies, which showed high affinity for the immunogen but very low reactivity to fibrillin-1 or fibrillin-2 peptides, were selected. An ELISA using mAb 129 is shown in Fig. 1B. Similar results were obtained for mAbs 317, 405, 471, and 511 (data not shown) and for polyclonal antiserum pAb 1869 (data not shown). mAb 471 also reacted in ELISA with a synthetic peptide of 27 residues from within the internal unique region. In immunohistochemistry, pAb 1869 and mAbs 129, 317, 405, and 511 could be used to stain fetal human tissues (Fig. 4 and data not shown). In addition, reactivity with bovine tissues was observed with each of the antibodies (Fig. 4 and data not shown). mAb 129 also reacted with chick tissues (Fig. 4). No immunohistochemical crossreac-

tivity of the fibrillin-3 antibodies with fibrillin-1 or with fibrillin-2 was observed, since many fetal or postnatal tissues that stained positively with fibrillin-1 or fibrillin-2 antibodies were negative with fibrillin-3 antibodies (see below). However, a single monoclonal antibody, mAb 689, did crossreact with homologous regions of fibrillin-1 and fibrillin-2 in ELISA and appeared to stain fibrillin in all tissues examined (data not shown). Immunolocalization of fibrillin-3 Polyclonal and monoclonal fibrillin-3-specific antibodies were used to survey the spatial distribution of fibrillin-3 in fetal human, bovine, and chick tissues. Prominent staining was noted in connective tissues such as perichondrium, periosteum, skeletal muscle, tendon, and skin, in patterns

Fig. 4. Immunofluorescence using fibrillin-3 mAbs. (A) 16-week fetal human skin, mAb 511. (B) 16-week fetal human muscle, mAb 405. (C) 10-week fetal arm, mAb 511. (D) 7-day embryonic chick limb, mAb 129. (E) f150-day fetal bovine kidney cortex, mAb 129. (F) f150-day fetal bovine kidney medulla, mAb 129. (G) 20-week fetal human lung, anti-FBN3 mAb 405. (H) 20-week fetal human lung, anti-FBN3 mAb 317. (I) 20-week fetal human lung, anti-FBN2 mAb 48. (J) 20-week fetal human lung, anti-LTBP-1 mAb 75G. C designates cartilage. Arrows indicate blood vessels. Scale bar, 50 Am.

468

G.M. Corson et al. / Genomics 83 (2004) 461–472

that generally resembled those of fibrillin-l and fibrillin-2. Fibrillar structures were labeled in perichondrial regions surrounding limbs (Figs. 4C and 4D), digits, vertebrae, ribs, and skull (data not shown). Staining was also observed in a variety of other tissues, including lung (Figs. 4G and 4H), kidney (Figs. 4E and 4F), brain, eye, ear, penis, testis, and ovary (data not shown). In the developing kidney, fibrillin-3 appeared to be limited to the connective tissues separating regions of the cortex (Fig. 4E) and medulla (Fig. 4F), whereas glomerular and tubular regions that contain fibrillin-1 and fibrillin-2 were negative for fibrillin-3 (data not shown). In the lung, staining appeared to be restricted to regions beneath the epithelial cell layer lining developing airways (Figs. 4G and 4H). In contrast to fibrillin-1 (data not shown), fibrillin-2 (Fig. 4I), and LTBP-1 (Fig. 4J), blood vessels of the lung were essentially negative for fibrillin-3. No fibrillin-3 staining was observed within liver, and the major as well as peripheral blood vessels of a variety of organs, locations where fibrillin-1 is normally abundant, were always negative (data not shown). Ultrastructural immunolocalization demonstrated that fibrillin-3 is associated with microfibrils in perichondrium (Fig. 5) and human and bovine fetal skin (data not shown). Bundles of microfibrils, without apparent amorphous elastin, were labeled with antibodies to fibrillin-3 (Fig. 5A), indicating that fibrillin-3, like the other fibrillins, is a component of microfibrils. However, when microfibrils with amorphous elastin cores were examined, labeling with fibrillin-3 antibodies appeared to bind preferentially microfibrils close to the amorphous elastin (Figs. 5B and 5C).

Discussion Fibrillin-3 was reported recently as one of 100 cDNAs isolated during a human cDNA sequencing project that focused on large cDNAs [14].2 The information presented in this article, obtained independent of the first report, contributes analyses of the gene and protein structure of fibrillin-3 in human and chicken, demonstrates preferential expression of fibrillin-3 mRNA in certain fetal tissues, and documents the presence of fibrillin-3 protein in microfibrils in specific fetal tissues. From the point of view of structure, there appear to be few differences between the fibrillins. Fibrillin-3 is clearly more homologous to the other fibrillins than to the LTBPs.

2

Our sequence is substantially similar to that of previous report with a few exceptions. First, we have identified the presence in the genome of exon 10, encoding the second cbEGF domain. We demonstrate that the cDNAs observed to date, however, have spliced out this exon, a result that is consistent with the sequence of Nagase et al. Second, we have extended the sequence in the 5Vdirection and demonstrated the presence of three alternative first exons that create diversity within the 5VUTR. Third, our sequences diverge at a number of individual nucleotide positions, and these are likely to reflect polymorphic variation.

The overall organization of domains in all three fibrillins is the same. A major difference is the splicing out of exon 10 (cbEGF2) in fibrillin-3 in human. We found that the same regions of human and mouse (data not shown) fibrillin-1 and fibrillin-2 are not alternatively spliced. In contrast, in the chick embryo between 5 and 14 days of incubation, the exon coding for cbEGF2 in fibrillin-3 is not spliced out, but the corresponding exon of fibrillin-2 is alternatively spliced (Fig. 3 and data not shown). The significance of these alternative splicing events is not clear, since no specific function has been assigned to cbEGF2 in any of the fibrillins. However, because deletions of FBN1 exons result in the Marfan syndrome, the absolute length of fibrillin monomers may be important to their architectural functions. The highly similar genomic organizations, domain structures, and homologous primary structures of the three fibrillins indicate whole gene duplication from a common ancestral gene. The presence of FBN3 orthologs in cow, pig, and chicken implies that this duplication event occurred prior to the divergence of mammals and birds. Therefore, a third fibrillin is predicted in all mammals, including rodents. However, our analyses of mouse genome data have revealed only a partial and likely nonfunctional fibrillin-3 gene. Human FBN3 is mapped between 8020 and and 8110 kb from the telomere, flanked by CCL25 (at 8010– 8020 kb) and FLJ12089 (at 8170– 8220 kb). This region of human chromosome 19 corresponds to an evolutionary breakpoint: orthologs of genes flanking FBN3 are found on mouse chromosome 8 (Ccl25, formerly Scya25) and mouse chromosome 17 (Rab11b) [15]. All FBN3 homologous sequences that we have found in the mouse are on chromosome 8, which also includes sequences homologous to the flanking gene FLJ12089. It is likely that fibrillin-3 in the mouse may have been interrupted and inactivated during chromosomal rearrangements or other recombination events during mouse evolution. Concentrations of repeated sequences and duplicated genes are found at all human chromosome 19 breakpoints, suggesting that recombinations between these repeated sequences may drive duplications of genes and chromosomal rearrangements [15]. However, the inactivation of fibrillin-3 in the mouse is an unusual result of chromosomal rearrangements, since there is otherwise a virtual one-for-one conservation of single-copy human chromosome 19 genes in the mouse [15]. Since the genomes of mouse and human differ by an estimated few hundred genes, the lack of fibrillin-3 in mouse may be significant, especially to skeletal growth and ocular physiology. Genetic analyses in human and mice suggest that fibrillin- 1 and fibrillin-2 perform both overlapping and unique functions. In humans, mutations in the gene for fibrillin-1 result in the skeletal, cardiovascular, and ocular features of the Marfan syndrome [16,17], whereas mutations in the fibrillin-2 gene result in the skeletal features of congenital contractural arachnodactyly [18,19]. A common phenotypic feature of both human disorders is overgrowth of long

G.M. Corson et al. / Genomics 83 (2004) 461–472

bones. Gene targeting experiments in mice have demonstrated that fibrillin-1 is required for postnatal cardiovascular function [10,20], while fibrillin-2 is required for proper limb patterning [11]. Since neither fibrillin-1 nor fibrillin-2 is required for completion of embryogenesis, overlapping architectural functions—assembly of microfibrils—are assumed. This notion is consistent with other recent evidence [9]. Like the other two fibrillins, fibrillin-3 can be expected to perform an architectural function, since specific antibodies localized fibrillin-3 to microfibrils. However, immunolocalization data revealed differences between the fibrillins. Fibrillin-3 antibodies demonstrated preferential labeling of microfibrils around amorphous elastin cores (Figs. 5B and 5C). In contrast, fibrillin-l- and fibrillin-2specific antibodies label microfibrils throughout elastic fiber bundles [4,9]. These results suggest that fibrillin-3 may perform a unique architectural function. Alternatively, these results might simply reflect the temporal order of events in elastic fiber assembly: initial microfibril formation (containing fibrillin-3) followed by elastogenesis and then further elaboration of microfibrils (no longer containing fibrillin-3). Additional data are required to resolve this question. Temporal regulation of fibrillin gene expression clearly impacts microfibril composition. Fibrillin-1 is present in the embryo from the time of gastrulation [21] through postnatal life. Fibrillin-2 gene expression is limited largely to fetal development [8] and only small amounts of fibrillin-2 can be detected in selected postnatal tissues [9]. Here we showed that fibrillin-3 gene expression is most abundant in fetal tissues compared with adult tissues or cells in culture, suggesting that fibrillin-3 is also largely limited to fetal development. Thus, it appears that the developing embryo utilizes three fibrillins, while the adult organism requires only one fibrillin. More investigations are necessary to reveal the existence of the specific functions of fibrillins that require temporal regulation. Fibrillin-3 is distributed in perichondria, skeletal muscle, and skin (Fig. 4) and in meninges, tendon, and connective tissues of the eye (data not shown) in fibrillar patterns very similar to those of the other fibrillins. In certain tissues (kidney and lung) (Fig. 4), the spatial distribution of fibrillin-3 is clearly more limited than that of the other fibrillins. Thus, the distribution of fibrillin-3 appears to overlap with the other fibrillins in some cases, but not in all. Most notably, fibrillin-3 appears to be absent in fibrillin-rich blood vessels. Moreover, in contrast to fibrillin-1 and fibrillin-2, which are abundant in the meninges and brain vasculature, fibrillin-3 is present in the brain parenchyma (data not shown), consistent with the high levels of gene expression that were found in the brain. These data suggest that fibrillin-3 may perform unique functions in certain tissues. Identification of human genetic disorders caused by mutations in FBN3 may provide important clues regarding unique and/or overlapping functions performed by fibril-

469

lin-3. Recently, a locus for recessive Weill –Marchesani syndrome was mapped to chromosome 19p13.3 – p13.2 [22], a region that contains FBN3. Features of Weill – Marchesani syndrome include ectopia lentis, short stature, and brachydactyly. The lens is usually round and abnormally small, and progressive joint stiffness may also be a feature of the disease. Since fibrillin-3 is abundant around skeletal elements and in the eye, we propose fibrillin-3 as a likely candidate gene for homozygous Weill – Marchesani syndrome mapped to chromosome 19p13.3 – p13.2 [22]. If disease-causing mutations are found in FBN3 in individuals with Weill –Marchesani syndrome, it will be interesting to discover why these result in short stature and brachydactyly, while FBN1 mutations produce tall stature and arachnodactyly. This information would reinforce the notion that fibrillins perform regulatory roles important to skeletal growth and also extend the concept by indicating a specific function for fibrillin3 distinct from fibrillin-1.

Materials and methods Cloning of human FBN3 cDNA First-strand cDNA was synthesized from normal neonate skin fibroblast total RNA using TRIzol and Superscript II reverse transcriptase (Invitrogen) according to the manufacturer’s directions. PCR was performed using various pairs of primers comprising exonic sequences as predicted from human genomic DNA (GenBank Accession No. AC002146). An initial product was generated using TAQurate polymerase mix (Epicentre, Madison, WI, USA) in the presence of 2 PCR enhancer solution, with primers FBN3-1S and FBN3-3AS (see Table 1 for sequences of primers discussed in this study). The 3-kb product was gelpurified and used as template for a second round of PCR. The final product was gel-purified and sequenced directly using an automated fluorescence DNA sequencer (Applied Biosytems). Additional, overlapping RT-PCR products ranging in size from 0.3 to 1.6 kb were obtained using similar methods with some variations. 5V- and 3V-RACE was performed to extend the coding sequence into untranslated regions. Pooled human (20 –25 week) fetal lung MarathonReady cDNA (Clontech) was used as template for PCR using an FBN3-specific primer and an adaptor primer. Products were gel-purified and used as templates for a second round of PCR using nested primers. Specific primers were FBN324AS followed by FBN3-23AS and FBN3-22S followed by FBN3-9s. The final products were gel-purified and sequenced directly. Cloning of chicken Fbn3 cDNA First-strand cDNA was synthesized as described above with chick whole 5-day embryo total RNA as template. PCR

470

G.M. Corson et al. / Genomics 83 (2004) 461–472

Table 1 Oligonucleotide primers used in this study Primer FBN3-1S FBN3-3AS FBN3-8AS FBN3-9S FBN3-10AS FBN3-13S FBN3-15S FBN3-17AS FBN3-22S FBN3-23AS FBN3-24AS ZF3-4S ZF3-7AS 32-8.6S PF3.1AS 5-1.2S FBN2-1568AS CF1-3S CF1-1AS CF2-3S CF2-1AS CF3-5S CF3-10AS rF301S rF301AS rF52S rF52AS

Gene FBN3 FBN3 FBN3 FBN3 FBN3 FBN3 FBN3 FBN3 FBN3 FBN3 FBN3 FBN3 FBN3 FBN1 FBN1 FBN2 FBN2 Fbn1 Fbn1 Fbn2 Fbn2 Fbn3 Fbn3 FBN3 FBN3 FBN2 FBN2

Sequence (5V ! 3V)

Source a

Human Humana Humana Humana Humana Humana Humana Humana Humana Humana Humana Humana Humana Humanb Humanb Humanc Humanc Chickend Chickend Chickene Chickene Chickenf Chickenf Humana Humana Humanc Humanc

GACCACGGTTTTGGGGAG TGCCACCATTGACTTGGAG CCATCCGTGGTAATGCCAA GCCTGAACCTCTCACACCTG ACTCCGAGGAATAAGCCCTG TTCCATGTGAACTTTGCCCT TTTCCTGGAGACGCATGAC TTCAGGGTAGCAGTGCCAA CGTCTGAAGCCTGCTACGAA TGGGAGCAGAAGCCTTCAC CCCATGAAGCCATACACACAG TGTACCTTCCTCTGYAARAAYAC TGRTGCATNCKRAARAANCC GGCTCCAGATCCATACAACACTGCAA GAGCACAGCTTGTTGAAATCCTCGG AACCGCTGTGCTTGTGTTTATGGG CCCATGTTGCATTCACATC GCTTCATTCCAAACATTCGAAC AGCAGAGCAGCTACTGAGCAC CGGTTTCATCCCTAATATTCGT ACACCATCCACACAAAGCCT ACGAGGTTTCATTCCCAACA AGTCCTTCGATGCAAAGCC CTAGGCTAGCAGATGTGGATGAGTGCCAGGCTG CTAGCTCGAGTCAGTGATGGTGATGGTGATGAATGCACTCGCCGCGCAC CAGAATTCGCTAGCAGATATTGATGAGTGTGCAGATCC CTAGCGGCCGCTCAATGATGATGATGATGATGTACACAGCCTTCTCCATCGGG

a

This study and Genbank Accession Nos. AY165863, AY165864, and AY165865 and AC002146. Genbank Accession No. X63556. c Genbank Accession No. U03272. d Genbank Accession No. AF300613. e Genbank Accession No. AF300614. f This study and Genbank Accession No. AY165867. b

was performed using Platinum Taq polymerase (Invitrogen) in the presence of 1 M betaine, with primers ZF3-4S and ZF3-7AS comprising degenerate sequences based on human FBN3. A 1-kb product was gel-purified and sequenced directly. Subsequent overlapping PCRs, using chick-specific and additional degenerate primers, were used to extend the cDNA in both 5V and 3V directions. Expression studies RT-PCR Total RNA was extracted using TRIzol from cultured human whole embryo cells (FHs 173We, American Type Culture Collection) and human cell lines MG63, SW1353, WISH, JAR, IMR90, A204 (all from ATCC), and U251MG and primary cultured fibroblasts from normal neonatal foreskin. Total RNA was also obtained from whole 5-day chick embryos, human 6-week embryo (Chemicon), and 26week fetal brain (Stratagene). RT-PCR was performed using Platinum Taq polymerase (Invitrogen) in the presence of 1 M betaine with FBN3 primers FBN3-15S and FBN3-3AS. To interrogate alternative splicing, additional PCRs used FBN1 primers 32-8.6S and PF3.1AS, FBN2 primers 5-1.2S

and FBN2-1568AS, FBN3 primers FBN3-13S and FBN317AS, chicken Fbn1 primers CF1-3S and CF1-1AS, chicken Fbn2 primers CF2-3S and CF2-1AS, and chicken Fbn3 primers CF3-5S and CF3-10AS. Northern blot RT-PCR using primers FBN3-22S and FBN3- 10AS was used to generate a cDNA corresponding to the carboxylterminal and 3V UTR regions of human FBN3 (nucleotides 8132 – 8961). After being labeled with 32P by random primer extension, the probe was hybridized overnight to a Northern blot with lanes containing 2 Ag of poly(A)+ RNAs from various human fetal tissues (Stratagene). After the blot was washed to a final stringency of 0.1X SSC, 0.1% SDS at 68jC, hybridized probe was detected using a phosphorimager (Molecular Dynamics, Sunnyvale, CA, USA). RNA dot blot The radiolabeled probe described above was hybridized overnight to a dot blot containing normalized amounts of poly(A)+ RNAs from various human tissues (Clontech). After the blot was washed to a final stringency of 0.1X SSC, 0.1% SDS at 68jC, hybridized probe was detected and quantified using a phosphorimager.

G.M. Corson et al. / Genomics 83 (2004) 461–472

Production of recombinant polypeptides and antibodies Fibrillin-1 peptides rF6, rF20 [23], and rF23 [24] and fibrillin-2 peptide rF37 [25] have been previously described. A recombinant fibrillin-3 polypeptide, rF301, was generated and expressed using similar methods. rF301 contains four domains (cbEGF1, 8cys1, Gly/Pro unique region, and EGF4) beginning at Asp247 and ending at Ile490. Consistent with splicing patterns in observed FBN3 cDNAs, this construct lacks the second calcium-binding EGF-like domain (cbEGF2). Human fibrillin-3 cDNA was generated by RT-PCR from normal skin fibroblast total RNA, using primers FBN3-13S and FBN3-8AS in the initial PCR. The product was used as template for a second PCR using nested primers rF301S and rF301AS to limit the product to the desired region and to introduce a carboxyl-terminal tag of six histidine residues, a stop codon, and terminal restriction enzyme sites. The product was digested with NheI and XhoI for cloning into expression vector pCEP4/g2III4 [26], and the insert sequence and cloning junctions were confirmed by DNA sequencing. After transfection into HEK-293 cells, rF301 peptide was purified from the culture medium using chelating chromatography followed by molecular sieve chromatography. Purity of the sample was assessed by SDS –PAGE and amino acid sequencing, and samples were quantitated using amino acid analysis. Fibrillin-2 recombinant polypeptide rF52 was generated by similar methods, using PCR primers rF52S and rF52AS to generate an insert spanning fibrillin-2 domains cbEGF22 to cbEGF35, residues Asp1531 to Val2336 [7]. The insert was sequenced, and some differences were observed relative to the published sequence.3 A synthetic fibrillin-3 peptide with the sequence Leu417 – Gly443 (within the internal unique region) was produced using FMOC chemistry and a MilliGen 9050 peptide synthesizer (Millipore). The peptide was purified using C18 reverse-phase HPLC (Waters Corp.) and was analyzed by amino acid sequencing and mass spectrometry. Monoclonal antibodies and polyclonal antiserum were generated using rF301 peptide as immunogen. mAbs were produced as described previously [27]. Hybridomas were screened in ELISA using rF301 and the synthetic Gly/Prorich peptide as coated substrates. Immunoassays ELISA Recombinant fibrillin peptides were coated at 20 nM each onto polystyrene 96-well plates overnight at 4jC. To block nonspecific sites, 5% nonfat milk in TBS wasincubated overnight at 4jC. Purified mAbs 129, 317, 3 Two changes may reflect either polymorphisms or errors in the original cDNA clone from which the insert was derived: T6443C, resulting in amino acid change V2148A, and A6752G, for an amino acid change E2251G.

471

405, 471, and 511 were 10-fold serially diluted over a range of 0.01 –100 Ag/ml in 2% nonfat milk in TBS and incubated overnight at 4jC. After three washes with TBS/ Tween 20, alkaline phosphatase-conjugated sheep antimouse IgG (Sigma), diluted 1:1000 in 2% milk/TBS, was incubated for 2 h at 25jC. After washing, color reaction was achieved using 1 mg/ml p-nitrophenyl phosphate in 0.2 M Tris buffer and the absorbance read at 405 nm using Titertek Multiskan. Immunohistochemistry Light microscopy of tissue samples was performed as previously described [28], using pAb 1869 diluted 1:200 or mAbs at 10 Ag/ml in phosphate-buffered saline (PBS) and FITC-conjugated goat anti-rabbit IgG or sheep anti-mouse IgG (Sigma; diluted 1:50 in PBS) or AlexaFluor 488conjugated goat anti-mouse IgG (Molecular Probes, Eugene, OR, USA; diluted 1:500 in PBS) as secondary antibody. Fibrillin-2-specific mAb 48 [9] and LTBP-1specific mAb 75G [29] were used for comparison with fibrillin-3 mAbs. Immunoelectron microscopy Perichondrium from 10- and 16-week human fetal digits was rinsed briefly in PBS and then immunolabeled en bloc by immersing in primary antibody diluted 1:5 in PBS overnight at 4jC. They were then rinsed extensively in PBS and immersed in goat anti-mouse 5-nm gold conjugate (Amersham) diluted 1:3 in PBS, rinsed again in PBS and then in 0.1 M cacodylate buffer, pH 7.4. The immunolabeled tissues were fixed in 1.5% glutaraldehyde/1.5% paraformaldehyde containing 0.05% tannic acid in cacodylate buffer followed by 1% buffered OsO4 and then rinsed, dehydrated, and embedded in Spurrs epoxy [28].

Acknowledgments We thank Robert Ono for help with transfections and purification of recombinant fibrillin-3; Dr. Steve C. Chalberg for producing recombinant fibrillin-2 polypeptide rF52: Sara Tufa for excellent technical assistance; the Analytical Core of the Portland Shriners Hospital for oligo synthesis, DNA sequencing, and peptide synthesis; and Dr. Hans Peter Ba¨chinger for advice and encouragement. Support for this work was obtained from grants from the Shriners Hospitals for Children (to L.Y.S. and D.R.K.) and from the NIH (AR46811 to L.Y.S.).

References [1] F.N. Low, The extracellular portion of the human blood – air barrier and its relation to tissue space, Anat. Rec. 142 (1962) 131 – 137. [2] E.G. Cleary, M.A. Gibson, Elastin-associated microfibrils and microfibrillar proteins, Int. Rev. Connect. Tissue Res. 10 (1983) 97 – 209.

472

G.M. Corson et al. / Genomics 83 (2004) 461–472

[3] B. Mayer, E.D. Hay, R.O. Hynes, Immunocytochemical localization of fibronectin in embryonic chick trunk and area vasculosa, Dev. Biol. 82 (1981) 267 – 286. [4] L.Y. Sakai, D.R. Keene, E. Engvall, Fibrillin, a new 350-kD glycoprotein, is a component of extracellular microfibrils, J. Cell Biol. 103 (1986) 2499 – 2509. [5] L.Y. Sakai, D.R. Keene, R.W. Glanville, H.P. Ba¨chinger, Purification and partial characterization of fibrillin, a cysteine-rich structural component of connective tissue microfibrils, J. Biol. Chem. 266 (1991) 14763 – 14770. [6] D.R. Keene, B.K. Maddox, H.J. Kuo, L.Y. Sakai, R.W. Glanville, Extraction of extendable beaded structures and their identification as fibrillin-containing extracellular matrix microfibrils, J. Histochem. Cytochem. 39 (1991) 441 – 449. [7] H. Zhang, et al., Structure and expression of fibrillin-2, a novel microfibrillar component preferentially located in elastic matrices, J. Cell Biol. 124 (1994) 855 – 863. [8] H. Zhang, W. Hu, F. Ramirez, Developmental expression of fibrillin genes suggests heterogeneity of extracellular microfibrils, J. Cell Biol. 129 (1995) 1165 – 1176. [9] N.L. Charbonneau, B.J. Dzamba, R.N. Ono, D.R. Keene, D.P. Reinhardt, L.Y. Sakai, Fibrillins can co-assemble in fibrils, but fibrillin fibril composition displays cell-specific differences, J. Biol. Chem. 278 (2002) 2740 – 2749. [10] L. Pereira, et al., Targeting of the gene encoding fibrillin-1 recapitulates the vascular aspect of Mar-fan syndrome, Nat. Genet. 17 (1997) 218 – 222. [11] E. Arteaga-Solis, B. Gayraud, S.Y. Lee, L. Shum, L.Y. Sakai, F. Ramirez, Regulation of limb patterning by extracellular microfibrils, J. Cell Biol. 154 (2001) 275 – 281. [12] C.L. Maslen, G.M. Corson, B.K. Maddox, R.W. Glanville, L.Y. Sakai, Partial sequence of a candidate gene for the Marfan syndrome, Nature 352 (1991) 334 – 337. [13] G.M. Corson, S.C. Chalberg, H.C. Dietz, N.L. Charbonneau, L.Y. Sakai, Fibrillin binds calcium and is coded by cDNAs that reveal a multidomain structure and alternatively spliced exons at the 5V end, Genomics 17 (1993) 476 – 484. [14] T. Nagase, M. Nakayama, D. Nakajima, R. Kikuno, O. Ohara, Prediction of the coding sequences of unidentified human genes. XX. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro, DNA Res. 8 (2001) 85 – 95. [15] P. Dehal, et al., Human chromosome 19 and related regions in mouse:

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23] [24] [25]

[26]

[27]

[28] [29]

conservative and lineage-specific evolution, Science 293 (2001) 104 – 111. H.C. Dietz, et al., Marfan syndrome caused by a recurrent de novo missense mutation in the fibrillin gene, Nature 352 (1991) 337 – 339. P.N. Robinson, et al., Mutations of FBN1 and genotype – phenotype correlation in Marfan syndrome and related fibrillinopathies, Hum. Mutat. 20 (2002) 153 – 161. E.A. Putnam, H. Zhang, F. Ramirez, D.M. Milewicz, Fibrillin-2 (FBN2) mutations result in the Marfan-like disorder, congenital contractural arachnodactyly, Nat. Genet. 11 (1995) 456 – 458. P.A. Gupta, et al., Ten novel FBN2 mutations in congenital contractural arachnodactyly: delineation of the molecular pathogenesis and clinical phenotype, Hum. Mutat. 19 (2002) 39 – 48. L. Pereira, et al., Pathogenetic sequence for aneurysm revealed in mice underexpressing fibrillin-1, Proc. Natl. Acad. Sci. USA 96 (1999) 3819 – 3823. B.C. Gallagher, L.Y. Sakai, C.D. Little, Fibrillin delineates the primary axis of the early avian embryo, Dev. Dyn. 196 (1993) 70 – 78. L. Faivre, et al., Homozygosity mapping of a Weill – Marchesani syndrome locus to chromosome 19p13.3 – p13.2, Hum. Genet. 110 (2002) 366 – 370. D.P. Reinhardt, et al., Fibrillin 1: organization in microfibrils and structural properties, J. Mol. Biol. 258 (1996) 104 – 116. D.P. Reinhardt, et al., Fibrillin-1 and fibulin-2 interact and are colocalized in some tissues, J. Biol. Chem. 271 (1996) 19489 – 19496. D.R. Keene, et al., Fibrillin-1 in human cartilage: developmental expression and formation of special banded fibers, J. Histochem. Cytochem. 45 (1997) 1069 – 1082. U. Mayer, E. Po¨schl, D.R. Gerecke, D.W. Wagman, R.E. Burgeson, R. Timpl, Low nidogen affinity of laminin-5 can be attributed to two serine residues in EGF-like motif g2III4, FEBS Lett. 365 (1995) 129 – 132. L.Y. Sakai, D.R. Keene, N.P. Morris, R.E. Burgeson, Type VII collagen is a major structural component of anchoring fibrils, J. Cell Biol. 103 (1986) 1577 – 1586. L.Y. Sakai, D.R. Keene, Fibrillin: monomers and microfibrils, Methods Enzymol. 245 (1994) 29 – 52. Z. Isogai, et al., Latent transforming growth factor h binding protein 1 interacts with fibrillin and is a microfibril-associated protein, J. Biol. Chem. 278 (2002) 2750 – 2757.