Differential expression of FREP genes in two strains of Biomphalaria glabrata following exposure to the digenetic trematodes Schistosoma mansoni and Echinostoma paraensei

Developmental and Comparative Immunology 29 (2005) 295–303 www.elsevier.com/locate/devcompimm

Differential expression of FREP genes in two strains of Biomphalaria glabrata following exposure to the digenetic trematodes Schistosoma mansoni and Echinostoma paraensei Lynn A. Hertel*, Coen M. Adema, Eric S. Loker Department of Biology, University of New Mexico, Albuquerque, NM 87131, USA Received 11 May 2004; revised 5 July 2004; accepted 17 August 2004 Available online 25 September 2004

Abstract Fibrinogen-related proteins (FREPs) are hypothesized to function in non-self-recognition in the snail Biomphalaria glabrata. To investigate this assumption, the expression of four members of the FREP gene family was studied using quantitative PCR at 0.5–16 days following exposure of M line and BS-90 strain B. glabrata to Echinostoma paraensei and Schistosoma mansoni. Both strains react to, but fail to eliminate E. paraensei. Only the BS-90 strain is immunologically resistant to S. mansoni. Both snail strains responded to E. paraensei with significantly elevated expression of FREP 2 and 4. Following exposure to S. mansoni, resistant BS-90 snails showed an increase in expression of FREP 2 and 4 (57-fold and 4.5-fold increase, respectively), susceptible M line snails did not display a FREP response. Expression of FREP 3 and 7 was not significantly elevated in any snail/trematode combination. These expression profiles support the hypothesis that some FREPs play a role in the antitrematode responses in B. glabrata. q 2004 Elsevier Ltd. All rights reserved. Keywords: FREP; Fibrinogen-related polypeptide; Quantitative PCR; Biomphalaria glabrata; Echinostoma paraensei; Schistosoma mansoni; Differential gene expression; Trematode

1. Introduction Proteins with similarities to fibrinogen that are thought to function in innate immune response in invertebrates have been described from the fruit fly,

Abbreviations: FREP, fibrinogen-related protein; qPCR, quantitative polymerase chain reaction; DPE, days post-exposure; CT, threshold value; CI, confidence interval. * Corresponding author. Tel.: C1 505 277 3124; fax: C1 505 277-0304. E-mail address: [email protected] (L.A. Hertel). 0145-305X/$ - see front matter q 2004 Elsevier Ltd. All rights reserved. doi:10.1016/j.dci.2004.08.003

Drosophila [1]; the mosquito, Anopheles [2–4]; the horseshoe crab, Tachypleus [5,6]; the slug, Limax [7]; snails (see below); the sea cucumber, Parastichopus [8]; and ascidians, Halocynthia [9,10] and Ciona [11]. Because of the connection between fibrinogen and invertebrate defense, we were interested in learning more about the expression of fibrinogen-related polypeptides (FREPs) present in the hemolymph of the snail, Biomphalaria glabrata. FREPs are encoded by a large gene family documented in the snail, B. glabrata [12–15].

296

L.A. Hertel et al. / Developmental and Comparative Immunology 29 (2005) 295–303

FREPs have also been found in at least five other genera of snails [12]. They are thought to function in the immune response of B. glabrata because at least some family members are up-regulated following exposure to the trematode Echinostoma paraensei [16], have lectin-like capabilities to bind carbohydrates [17,18], precipitate parasite antigens [12,19,20] and are capable of binding to the surface of E. paraensei sporocysts and rediae [21] and to cilia of the miracidial stage [19]. Here we present work that originally began with the identification of polypeptides from B. glabrata that were observed to be up-regulated following exposure to a pathogen [16]. We used this information to obtain amino acid data, obtained full-length sequences for the genes of the up-regulated polypeptides and identified the presence of gene families [12–15]. This paper provides evidence of differential expression of representatives of specific FREP subfamilies following exposure of the snail to trematode infection. To our knowledge, this is the first documentation from a mollusc of differential expression of specific genes that are thought to play a role in non-self recognition based on their known correspondence to polypeptides identified and upregulated following exposure of the snail to trematode infection. We employed two different strains of B. glabrata (M line and BS-90) and two species of digeneans (Schistosoma mansoni and E. paraensei) to orchestrate different types of immunobiological interactions between snail hosts and digenean parasites. The M line strain of B. glabrata is susceptible to S. mansoni and the BS-90 strain is resistant to this infection. Both of these strains are susceptible to infection by E. paraensei. Within this model, we used quantitative PCR (qPCR) to monitor expression levels of FREPs to address four questions. Is there an increase in FREP expression in snails over time following exposure to either parasite compared to non-exposed snails? Is expression of the four FREPs uniform within a snail strain following trematode exposure? Are there constitutive differences in FREP response in snails of a single strain after exposure to the two trematode species? Are there constitutive differences in FREP response between snail strains after exposure to the same parasite?

2. Materials and methods 2.1. Snails and parasites Two strains of B. glabrata (M line and BS-90) were maintained as described by Loker and Hertel [16]. Parasites included the PR1 strain of S. mansoni maintained as described by Stibbs et al. [22] and E. paraensei maintained as described by Loker and Hertel [16]. Snails were exposed to E. paraensei or S. mansoni miracidia. Routinely a dose of 10 S. mansoni miracidia yields infection rates of O95% for the M line strain but 0% for the BS-90 strain (personal observation). Infection rates for E. paraensei are more variable, so snail hearts were examined to confirm infection using an Olympus dissecting microscope starting at 2 days post-exposure (DPE), the earliest time sporocysts are visible. Only snails with visible E. paraensei sporocysts, the first intra-molluscan larval stage, were used for samples collected on or after 2 DPE. 2.2. RNA isolation At 0.5, 1, 2, 4, 8 and 16 DPE to one of the parasites, total RNA was obtained from snails using RNAse free equipment. For each time point, nine snails were selected and divided into three samples, each comprised of three different snails, the whole bodies of which were ground in liquid N2 and placed in sterile RNAse-free tubes. RNA was isolated using the RNA isolation kit (Stratagene, La Jolla, CA) and stored in isopropanol at K70 8C until use. Following removal of isopropanol and drying, RNA pellets were dissolved in RNAse free MilliQ water. RNA was spectrophotometrically quantified. RNA was also obtained from non-exposed snails. 2.3. cDNA generation All RNAs were first treated to remove residual genomic DNA using DNA-free (Ambion, Austin, TX). Total RNA was re-quantified as described above. cDNA generation was performed by random priming using the Omniscript kit (Qiagen, Valencia, CA). The 19 ml reaction mix for cDNA generation contained 400 ng template, dNTPs at 5 mM each, 1! buffer, RNase inhibitor 10U (ABI, Foster City, CA), 5 mM

L.A. Hertel et al. / Developmental and Comparative Immunology 29 (2005) 295–303

297

random hexamer primers (ABI, Foster City, CA), Omniscript reverse transcriptase 4U and RNase-free water. The RT reactions were 25 8C for 5 min, 42 8C for 30 min, 85 8C for 5 min followed by 4 8C using a Biometra thermocycler. To check for genomic DNA contamination a PCR was performed. The reaction consisted of 190 ng template, dNTPs at 190 mM each, MgCl2 at 2.5 mM, 1! buffer, primers at 0.5 mM and AmpliTaq Gold 0.5 U (ABI, Foster City, CA). The primers used (BGACTX_S, GTTTAGAGGTGCCTCTGTGAG and BGACTFAS, CCCATCTATTGTTGGCAGACC) target an intron spanning region of b actin of M line B. glabrata [23, GenBank accession no. AF329436]. Therefore, the resulting band amplified from cDNA should be 219 bp. If genomic contamination occurred the amplicon would include intronic sequence of 1040 bp. Only cDNAs that exclusively yielded the 219 bp product were used for qPCR.

Table 1 Primer name, direction, dissociation temperature and sequence for primers used in PCR reactions

2.4. Quantitative PCR At each time point for each snail/parasite combination, two separate samples derived from 3 individual snails were tested in triplicate The 25 ml qPCR reaction consisted of cDNA (either 400 ng for the FREP primers or 190 ng for the 18S primers), dNTPs at 250 mM for dATP, dCTP and dGTP and 500 mM for dUTP, 1X SYBR buffer, 3.75 mM MgCl2, primers at 0.1 mM each and 0.675U AmpliTaq Gold. The qPCR temperature profiles were as follows, 95 C for 10 min followed by 40 cycles of 95 8C for 15 s and 58 8C for 1 min. Melting analysis was performed following qPCR to assure specificity of the reaction. Primers (Table 1) were designed using the Primer Express 2.0 software (ABI). FREP primers were designed from sequences for FREP 2, 3, 4 and 7 (GenBank accession nos. AY012700, AY028461, AY012701, AY028462, respectively) from M line B. glabrata. Primers were designed from the 18S sequence for the BS-90 strain of B. glabrata (U65223) for use as a housekeeping control. Primers were obtained from Ransom Hill (Ramona, CA) or Integrated DNA Technologies (Coralville, IA). The reactions were carried out using the ABI 7000 sequence detection system. The amplification efficiency for each primer pair was checked by performing a linear regression on threshold values obtained from serial dilutions of

Name

Direction

Temp. (C)

Sequence

F2Q5S

Forward

60.0

F2Q5AS

Reverse

68.0

F3Q5S

Forward

60.2

F3Q5AS

Reverse

58.9

F4Q3S

Forward

60.0

F4Q3AS

Reverse

70.0

F7Q4S

Forward

68.0

F7Q4AS

Reverse

70.0

BG18SQSP1

Forward

60.0

BG18SQASP1

Reverse

58.0

GTTTCCATGGCGACGTTGAT TGATTGTTTCTGAATTCCCTGTAAAA ACGAGCGTGTGGTGGTAACA CCACCGCCGTCTGTCTTG TGATTCGCCGAATGATAATTGT CGTTAAGGTTGACATCAGCACAGT ACATCATTTCAGCGGAGATAACTG GTTGAACTTGGTTGTTGGTTACAGA CGCCCGTCGCTACTATCG ACGCCAGACCGAGACCAA

a template. The efficiency for all primer pairs was R0.96 (r2 value), well above the acceptable threshold of 90% [24]. Melting point analyses were performed to confirm that the signal resulted from a single specific amplicon. 2.5. Statistical analysis For each cDNA sample (obtained from a pool of three snails), three separate threshold values (CT) were obtained for each FREP primer pair and two were obtained for each 18S housekeeping primer pair. The CT values for 18S were averaged and then subtracted from each of the three FREP CT measurements (ZDCT). An average was taken for the DCTs. This was repeated using two separate cDNA samples for each snail strain at each timepoint, resulting in a sample size of two representing 6 individual snails. In the same fashion, a DCT value was calculated for three threshold values obtained from a cDNA sample obtained from a pool of three non-exposed individuals of a corresponding snail strain. The DCT for non-exposed was subtracted from experimental to obtain DDCT values. The equation 2KDDCT [25] was used to calculate

298

L.A. Hertel et al. / Developmental and Comparative Immunology 29 (2005) 295–303

the fold-increase of FREP expression. Standard error and 95% confidence intervals (CI) were calculated for each sample. The data was also analyzed using the relative expression ratio mathematical model presented by Pfaffl [26]. Using this method, the expression levels of FREPs were also determined to be significantly elevated. Here we present the more conservative results obtained using the method presented by Livak et al. [25]. To determine whether FREP expression in nonexposed snails differed between the snail strains, a DCT was obtained for three separate samples each comprised of three snails from each snail strain for each FREP. The results were analyzed using a t-test. To determine whether there were significant differences (P!0.05) in FREP expression over time in snails exposed to one or the other of two trematodes compared to non-exposed snails, the CI was subtracted from the average fold-increase value for infected snails. If this value was greater than 1 (1Zvalue for non-exposed snails), the fold-increase was considered to be significant. Two-way analysis of covariance was performed for the rest of the analyses using S-PLUS (MathSoft Inc. Seattle, WA). To determine whether there was a difference in expression between the different FREPs within a snail strain exposed to the same parasite over time, FREP value was evaluated as a function of FREP typeCtime. To determine whether there was a difference in the way a single snail strain responded to the two different parasites over time, FREP value was examined as a function of parasiteCtimeCtime2. Time2 was included to allow for the parabolic relationship between gene response and time. To determine whether there was a significant difference between the way two snail strains responded to the same parasite over time, FREP value was evaluated as a function of snail strainCtimeCtime2.

significant differences in expression levels between non-exposed snails from the two snail strains (data not shown). 3.2. Differences in response of a snail strain over time Following exposure to E. paraensei, significant increases occurred in FREP 2 expression in M line B. glabrata at 4 DPE and of FREP 4 at 2 and 16 DPE (Fig. 1A). FREP expression in M line snails was not significantly different from expression in corresponding non-exposed snails at any time following infection with S. mansoni (Fig. 1A). Exposure to E. paraensei also resulted in significant increases of FREP 2 expression in BS-90 snails at 1 and 16 DPE and of FREP 4 expression at 2 DPE (Fig. 1B). The most dramatic FREP responses were seen in BS-90 snails exposed to S. mansoni (Fig. 1B). For FREP 2, expression levels were significantly elevated in all but 1 and 16 DPE. FREP 4 expression was significantly elevated at 1 DPE. 3.3. Differences in expression among FREP genes within a snail strain There were significant differences between the levels of FREP expression as a function of both FREP type and time when M lines were exposed to E. paraensei (Fig. 1A). There were no significant differences in FREP expression as a function of type or time when M line snails were exposed to S. mansoni. For BS-90 snails, significant differences occurred in expression levels as a function of type and time when the snails were exposed to S. mansoni (Fig. 1B). When BS-90 snails were exposed to E. paraensei, time did not have a significant effect but FREP type was significant. 3.4. Differences in response of snails of the same strain to two parasite species

3. Results 3.1. Initial determinations The 18S ribosomal gene was determined to be an appropriate housekeeping gene based on the amplification efficiency (r2) of 0.998 Based on the DCT values for any of the 4 FREPs, there were no

Following exposure to E. paraensei, M line snails displayed significantly higher fold increase values for FREP 2 and 4 than they did following exposure to S. mansoni. There were no significant differences in FREP response in BS-90 snails infected with E. paraensei compared to those exposed to S. mansoni: both had comparably

L.A. Hertel et al. / Developmental and Comparative Immunology 29 (2005) 295–303

299

Fig. 1. Fold increase values and SE for four FREP genes from two strains of Biomphalaria glabrata at 0.5, 1, 2, 4, 8, or 16 days post-exposure to Echinostoma paraensei or Schistosoma mansoni. (A) Snail strain is M line. (B) Snail strain is BS-90. Note: graph in box has a different scale for the Y axis compared to the rest. *Significance at P!0.05.

300

L.A. Hertel et al. / Developmental and Comparative Immunology 29 (2005) 295–303

elevated FREP 2 and 4 levels and equally low FREP 3 and 7 levels (Fig. 1B). 3.5. Differences in FREP response between the two snail strains We found that there were significant differences in FREP 2 response between snail strains (Fig. 1A and B). When snails were exposed to E. paraensei for 1 day, BS-90 snails had a 51 fold increase in expression compared to the !1 fold increase obtained from M line snails. The difference fell to 35 fold at 4 DPE, when FREP 2 expression was highest in M line snails. FREP 2 and 4 values were significantly higher in BS90 snails following exposure to S. mansoni compared to values for M lines. Differential expression of FREP 2 occurred as early as 1 DPE when BS-90 snails were exposed to S. mansoni. The greatest difference in fold increase values between the snail strains was 57 for FREP 2 obtained from BS-90 snails at 1 DPE. FREP 4 levels were comparable between the two snail strains but varied as to which day the highest levels were attained. For BS-90, FREP 4 expression peaked at 4 DPE while for M lines the peak occurred at 8 DPE. There were no significant differences in response of the other two FREP genes.

4. Discussion Quantitative PCR has become an accepted alternative method to Northern blot analysis when examining differential gene expression. This sensitive technique requires smaller amounts of RNA and provides quantitative data that can be analyzed statistically [27]. Quantitative PCR has been used to study expression of genes that are thought to play a role in defense in other invertebrates [28–30] and to examine B. glabrata embryonic cell responses to secretory– excretory products of E. caproni and S. mansoni [31]. In our case, qPCR provided the first indication of a significant elevation of FREP expression of the BS-90 strain of B. glabrata following exposure to S. mansoni and allowed us to detect differences in expression levels of the four FREP genes in the two snail strains examined here. While variation between the two samples for a given parasite/snail combination at a given time

occasionally led to reduction in the significance of some of the differences, certain patterns were still evident. For both snail strains, the most significant differences in expression levels were recorded for FREP 2. When examining differences in FREP expression within a snail/parasite combination over time, M line snails exposed to E. paraensei demonstrated a significant increase in expression of FREPs 2 and 4, peaking at 4 and 8 DPE, respectively, compared to non-exposed M line snails. Previous studies using SDS-PAGE to examine differences in polypeptide profiles following trematode-exposure [19] support the expression results obtained with qPCR. SDSPAGE analysis of polypeptides that increased in abundance indicated that FREPs (detected as the 65 kDa band) were maximally elevated at 4 DPE in M line snails exposed to E. paraensei, but were also present in plasma at 8 DPE. Following exposure to E. paraensei, significant differences in expression of FREP 2 and FREP 4 occurred earlier for BS-90 snails (1 DPE for both FREPs) than for M lines (4 and 2 DPE, respectively). Similar rapid responses to pathogen exposure have been obtained with other systems. Expression of anti-microbial genes in insects can occur as rapidly as 3 h post-exposure [32]. Significant differences were seen between the levels of expression of the four FREPs when M line snails were exposed to E. paraensei. Previous SDSPAGE analysis has shown that polypeptides in the molecular weight range of 80–119 kDa are upregulated following exposure [12,16,19]. In addition to FREP 3 and 7, which we have calculated to fall within this molecular weight range, we have identified additional FREPs with two IgSF domains [15]. Whether these additional FREPs are up-regulated following parasite exposure has not been determined. The differences in FREP response between the two snail strains support our previous observations that the M line strain responds differently to infection with the two parasites than do the S. mansoni-resistant strains, 10-R2 and 13-16-R1 [17–19]. Exposure of the M line B. glabrata to E. paraensei clearly provokes a response including the up-regulation of FREP 2 and 4 genes. Exposure to S. mansoni did not yield increased expression of FREPs, suggesting that the M line strain does not respond, possibly because it does not recognize S. mansoni. In contrast BS-90

L.A. Hertel et al. / Developmental and Comparative Immunology 29 (2005) 295–303

snails, which are resistant to S. mansoni, demonstrated a rapid and dramatic response of up to 57-fold increase of FREP 2 expression following exposure to S. mansoni indicating that the resistant strain not only recognizes S. mansoni but responds vigorously to the parasite. Interestingly, the time course for heightened FREP 2 and 4 expression overlaps the interval within which sporocysts are encapsulated and killed [33]. Once parasites are eliminated after 2DPE the need to maintain increased FREP expression may be reduced. Indeed expression of FREP 2 was expressed at lower levels from 2 DPE onward. Clearly the role of FREP 2 in destruction of S. mansoni sporocysts in resistant snails merits further study. The elevation of FREP 2 and 4 values in either strain after exposure to E. paraensei indicates that snails of both strains are capable of recognizing and responding to a digenean parasite. Both strains become equally infected following exposure to this trematode and the production of sporocysts appears to be equivalent. Since neither snail strain is resistant to infection with this trematode, the results of the qPCRs seem to be contradictory. This apparent discrepancy may be explained by immunomodulatory capabilities (interference) of E. paraensei. Previous work [34–39] has shown that E. paraensei and E. caproni sporocysts release secretory-excretory products that mediate interference toward hemocytes of B. glabrata causing these defense cells to round up rendering ineffective at attaching to sporocysts [40]. Thus even though snails recognize E. paraensei and mount an immune response, we hypothesize that the cells responsible for sporocyst destruction are rendered ineffective. In contrast, it is our belief that S. mansoni does not mediate an equivalent interference effect [20,40–42]. Thus, cellular defense capabilities remain intact and can contribute effectively to resistance of the BS-90 snails to S. mansoni infection. One possibility is that S. mansoni relies largely on molecular mimicry, i.e. masking of non-self determinants by the display of host-like surface molecules [43]. A schistosome can successfully infect and survive in susceptible snails that fail to detect the parasite and consequently do not mount a defense response. Resistant snails may detect the parasite despite its efforts at mimicry and then mount defenses to eliminate the parasite. In contrast, susceptible B. glabrata respond to echinostome infection by producing a complex array of

301

parasite-reactive plasma polypeptides. Rather than avoiding a host defense response, we hypothesize that E. paraensei survives inside B. glabrata by interfering with the effector functions of the circulating hemocytes (phagocytic defense cells). Here we have demonstrated differential expression in snails of four members of the FREP gene subfamily following exposure to two trematodes, lending support for the possible role of certain FREPs in defense. This is the first report of a significant immune response from a S. mansoni-resistant strain of B. glabrata strain following exposure to this trematode.

Acknowledgements This study was supported by NIH AI24340. We thank Dr Timothy Meehan for assistance with statistics. We thank Dr Si-Ming Zhang and Ms Jennifer Hall for their assistance with this manuscript. References [1] Lee E-C, Yu S-Y, Hu XX, Mlodzik M, Baker NE. Functional analysis of the fibrinogen-related scabrous gene from Drosophila melanogaster identifies potential effector and stimulatory protein domains. Genetics 1998;150(2):663–73. [2] Dimopoulos G, Casavant TL, Chang S, Scheetz T, Roberts C, Donohue M, et al. Anopheles gambiae pilot gene discovery project: Identification of mosquito innate immunity genes from expressed sequence tags generated from immunecompetent cell lines. Proc Natl Acad Sci USA 2000;97(12): 6619–24. [3] Kumar S, Christophides GK, Cantera R, Charles B, Han YS, Meister S, et al. The role of reactive oxygen species on Plasmodium melanotic encapsulation in Anopheles gambiae. Proc Natl Acad Sci USA 2003;100(24):14139–44. [4] Srinivasan P, Abraham EG, Ghosh AK, Valenzuela J, Ribeiro JMC, Dimopoulos G, et al. Analysis of the Plasmodium and Anopheles transcriptomes during oocyst differentiation. J Biol Chem 2004;279(7):5581–7. [5] Gokudan S, Muta T, Tsuda R, Koori K, Kawahara T, Seki N, et al. Horseshoe crab acetyl group-recognizing lectins involved in innate immunity are structurally related to fibrinogen. Proc Natl Acad Sci USA 1999;96(18): 10086–91. [6] Kairies N, Beisel H-G, Fuentes-Prior P, Tsuda R, Muta T, ˚ crystal structure of tachylectin 5A Iwanaga S, et al. The 2.0-A provides evidence for the common origin of the innate immunity and the blood coagulation systems. Proc Natl Acad Sci USA 2001;98(24):13519–24.

302

L.A. Hertel et al. / Developmental and Comparative Immunology 29 (2005) 295–303

[7] Kurachi S, Song Z, Takagaki M, Yang Q, Winter HC, Kurachi K, Goldstein IJ. Sialic-acid-binding lectin from the slug Limax flavus Cloning, expression of the polypeptide, and tissue localization. Eur J Biochem 1998;254(2): 217–22. [8] Xun X, Doolittle RF. Presence of a vertebrate fibrinogen-like sequence in an echinoderm. Proc Natl Acad Sci USA 1990; 87(6):2097–101. [9] Abe Y, Tokuda M, Ishimoto R, Azumi K, Yokosawa H. A unique primary structure, cDNA cloning and function of a galactose-specific lectin from ascidian plasma. Eur J Biochem 1999;261(1):33–9. [10] Kenjo A, Takahashi M, Matsushita M, Endo Y, Nakata M, Mizuochi T, et al. Cloning and characterization of novel ficolins from the solitary ascidian, Halocynthia roretzi. J Biol Chem 2001;276(23):19959–65. [11] Hotta K, Takahashi H, Asakura T, Saitoh B, Takatori N, Satou Y, et al. Characterization of Brachyury-downstream notochord genes in the Ciona intestinalis embryo. Dev Biol 2000;224(1):69–80. [12] Adema CM, Hertel LA, Miller RD, Loker ES. A family of fibrinogen-related proteins that precipitates parasitederived molecules is produced by an invertebrate after infection. Proc Natl Acad Sci USA 1997;94(16): 8691–6. [13] Le´onard PM, Adema CM, Zhang S-M, Loker ES. Structure of two FREP genes that combine IgSF and fibrinogen domains, with comments on diversity of the FREP gene family in the snail Biomphalaria glabrata. Gene 2001; 269(1–2):155–65. [14] Zhang S-M, Le´onard PM, Adema CM, Loker ES. Parasiteresponsive IgSF members in the snail Biomphalaria glabrata: characterization of novel genes with tandemly arranged IgSF domains and a fibrinogen domain. Immunogenetics 2001; 53(8):684–94. [15] Zhang S-M, Loker ES. The FREP gene family in the snail Biomphalaria glabrata: additional members, and evidence consistent with alternative splicing and FREP retrosequences. Dev Comp Immunol 2003;27(3):175–87. [16] Loker ES, Hertel LA. Alterations in Biomphalaria glabrata plasma induced by infection with the digenetic trematode Echinostoma paraensei. J Parasitol 1987;73(3):503–13. [17] Monroy F, Hertel LA, Loker ES. Carbohydrate-binding plasma proteins from the gastropod Biomphalaria glabrata: strain specificity and the effects of trematode infection. Dev Comp Immunol 1992;16(5):355–66. [18] Monroy FP, Loker ES. Production of heterogeneous carbohydrate-binding proteins by the host snail Biomphalaria glabrata following exposure to Echinostoma paraensei and Schistosoma mansoni. J Parasitol 1993;79(3): 416–23. [19] Adema CM, Hertel LA, Loker ES. Infection with Echinostoma paraensei (Digenea) induces parasite-reactive polypeptides in the hemolymph of the gastropod host Biomphalaria glabrata. In: Beckage NE, editor. Parasites and pathogens effects on host hormones and behavior. New York, NY: Chapman and Hall; 1997. p. 76–98.

[20] Adema CM, Sapp KK, Hertel LA, Loker ES. Immunobiology of the relationship of echinostomes with snail intermediate hosts. In: Graczyk TK, Fried B, editors. Echinostomes as experimental models for biological research. Dordrecht: Kluwer; 2000. p. 149–73. [21] Hertel LA, Stricker SA, Monroy FP, Wilson WD, Loker ES. Biomphalaria glabrata hemolymph lectins: binding to bacteria, mammalian erythrocytes, and to sporocysts and rediae of Echinostoma paraensei. J Invertebr Pathol 1994; 64(1):52–61. [22] Stibbs HH, Owczarzak A, Bayne CJ, DeWan P. Schistosome sporocyst-killing amoebae isolated from Biomphalaria glabrata. J Invertebr Pathol 1979;33:159–70. [23] Adema CM. Comparative study of cytoplasmic actin DNA sequences from six species of Planorbidae (Gastropoda: Basommatophora). J Mollus Stud 2002;68(1): 17–23. [24] Ginzinger DG. Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream. Exp Hematol 2002;30(6):503–12. [25] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the DDC T method. Methods 2001;25(4):402–8. [26] Pfaffl MW. A new model for relative quantification in realtime RT-PCR. Nucleic Acids Res 2001;29(29):2003–7. [27] Freeman WM, Walker SJ, Vrana KE. Quantitative RTPCR pitfalls and potential. BioTechniques 1999;26(1): 112–25. [28] Gottar M, Gobert V, Michel T, Belvin M, Duyk G, Hoffmann JA, et al. The Drosophila immune response against Gram-negative bacteria is mediated by a peptidoglycan recognition protein. Nature 2002;416(6881):640–4. [29] Seitz V, Clermont A, Wedde M, Hummel M, Vilcinskas A, Schlatterer K, Podsiadlowski L. Identification of immunorelevant genes from greater wax moth (Galleria mellonella) by a subtractive hybridization approach. Dev Comp Immunol 2003;27(3):207–15. [30] Lopez L, Morales G, Ursic R, Wolff M, Lowenberger C. Isolation and characterization of a novel insect defensin from Rhodnius prolixus, a vector of Chagas disease. Insect Biochem Mol Biol 2003;33(4):439–47. [31] Coustau C, Mitta G, Dissous C, Guillou F, Galinier R, Allienne J-F, et al. Schistosoma mansoni and Echinostoma caproni excretory–secretory products differentially affect gene expression in Biomphalaria glabrata embryonic cells. Parasitology 2003;127:533–42. [32] Lemaitre B, Reichhart J-M, Hoffmann JA. Drosophila host defense: differential induction of antimicrobial peptide genes after infection by various classes of microorganisms. Proc Natl Acad Sci USA 1997;94(26):14614–9. [33] Newton WL. The comparative tissue reaction of two strains of Australorbis glabratus to infection with Schistosoma mansoni. J Parasitol 1952;38(4):362–6. [34] Lie KJ. Survival of Schistosoma mansoni and other trematode larvae in the snail Biomphalaria glabrata. A discussion of the interference theory. Trop Geogr Med 1982; 34(2):111–22.

L.A. Hertel et al. / Developmental and Comparative Immunology 29 (2005) 295–303 [35] Loker ES, Bayne CJ, Yui MA. Echinostoma paraensei: hemocytes of Biomphalaria glabrata as targets of echinostome mediated interference with host snail resistance to Schistosoma mansoni. Exp Parasitol 1986;62(1):149–54. [36] Loker ES, Cimino DF, Hertel LA. Excretory–secretory products of Echinosotoma paraensei sporocysts mediate interference with Biomphalaria glabrata hemocyte functions. J Parasitol 1992;78(1):104–15. [37] DeGaffe´ G, Loker ES. Susceptibility of Biomphalaria glabrata to infection with Echinostoma paraensei: correlation with the effect of parasite secretory–excretory products on host hemocyte spreading. J Invertebr Pathol 1998;71(1):64–72. [38] Adema CM, Arguello II DF, Stricker SA, Loker ES. A timelapse study of interactions between Echinostoma paraensei intramolluscan larval stages and adherent hemocytes from Biomphalaria glabrata and Helix aspersa. J Parasitol 1994; 80(5):719–27.

303

[39] Humbert E, Coustau C. Refractoriness of host haemocytes to parasite immunosuppressive factors as a putative resistance mechanism in the Biomphalaria glabrata–Echinostoma caproni system. Parasitology 2001;122:651–60. [40] Loker ES, Adema CM. Schistosomes, echinostomes and snails: comparative immunobiology. Parasitol Today 1995; 11(3):120–4. [41] Lodes MJ, Yoshino TP. Polypeptides synthesized in vitro by Biomphalaria glabrata hemocytes bind to Schistosoma mansoni primary sporocysts. J Invertebr Pathol 1993;61(2): 117–22. [42] Sapp KK, Loker ES. A comparative study of mechanisms underlying digenean-snail specificity: in vitro interactions between hemocytes and digenean larvae. J Parasitol 2000; 86(5):1020–9. [43] Damian RT. Parasite immune evasion and exploitation: reflections and projections. Parasitology 1997;115: S169–S175.