Differential expression of human gonadotropin-releasing hormone receptor gene in pituitary and ovarian cells

Molecular and Cellular Endocrinology 162 (2000) 157 – 166 www.elsevier.com/locate/mce

Differential expression of human gonadotropin-releasing hormone receptor gene in pituitary and ovarian cells Sung Keun Kang a, Kwai Wa Cheng a, Elly S.W. Ngan b, Billy K.C. Chow b, Kyung-Chul Choi a, Peter C.K. Leung a,* a

Department of Obstetrics and Gynecology, Uni6ersity of British Columbia, 2H-30, 4490 Oak St., Vancou6er, BC, Canada V6H 3V5 b Department of Zoology, Uni6ersity of Hong Kong, Hong Kong, Hong Kong Received 8 December 1999; accepted 6 January 2000

Abstract In terms of regulation of gene expression, gonadotropin-releasing hormone receptor (GnRHR) found in extrapituitary tissues has been suggested to be different from that in the pituitary. In the present study, we examined the molecular basis of this difference using the pituitary aT3-1 and ovarian carcinoma OVCAR-3 cells. As a first step, the different expression levels of GnRHR mRNA in the pituitary and ovarian cells were investigated using semi-quantitative RT-PCR. Quantitative analysis showed that the expression level of hGnRHR is a nine-fold higher in primary pituitary tissues than the primary culture of ovarian carcinomas (PCO). In pituitary aT3-1 cells, the expression level of hGnRHR was ten-fold higher than ovarian carcinoma OVCAR-3 cells. The possibility of the differential use of various cell-specific promoters in different cells was addressed by transiently transfecting cells with 3%-deletion clones of human GnRHR promoter. Sequential deletion of the 5%-flanking region of the gene revealed the use of two putative promoters, designated PR1 (-771 to -557) and PR2 (-1351 to -1022), and a negative control region (-1022 to -771), in the pituitary and ovarian cells. The same promoters appeared to be utilized for driving the basal promoter activities in both aT3-1 and OVCAR-3 cells, suggesting that there is no cell-specific promoter usage for the human GnRHR gene. Alternatively, the involvement of different regulatory protein factors was investigated using electrophoretic gel mobility shift assays. When end-labeled PR1 was used as a probe, two unique shifted complexes were identified in OVCAR-3 cells when compared to aT3-1 cells. One unique protein–DNA complex was observed in aT3-1 cells compared to OVCAR-3 cells when incubated with end-labeled PR2 as a probe. These DNA – protein complexes appeared to be specific, as they competed with excess amount of unlabelled competitor PR1 and PR2, respectively. In summary, it is unlikely that the use of a cell-specific promoter contributes to the different characteristics of ovarian GnRHR. Our study demonstrates that one mechanism by which cell-specific expression of human GnRHR is achieved is through the binding of distinct and/or combinations of cell-specific regulatory factors to various promoter elements in the 5%-flanking region of the gene. © 2000 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Human GnRH receptor; Differential expression; Ovary; Transcription factors

1. Introduction The concerted hormonal regulation at the hypothalamic, pituitary and gonadal levels plays an important role in the control of sexual maturation and reproductive function. In terms of binding to its specific receptor in the pituitary, the decapeptide, gonadotropin-releasing hormone (GnRH), functions as a key neuroendocrine regulator of the reproductive hormonal cascade * Corresponding author. Tel.: +1-604-8752718; fax: + 1-6048752717. E-mail address: [email protected] (P.C.K. Leung)

(Conn, 1994). In addition to its well-documented role in gonadotropin biosynthesis and secretion, GnRH has been implicated in the endocrine functions of the gonads. The presence of GnRH and its binding sites in the ovary suggests that GnRH exerts its actions in an autocrine–paracrine manner to modulate both basal and gonadotropin-stimulated steroidogenesis (Leung and Steele, 1992; Va¨a¨nna¨nen et al., 1997; Bramely et al., 1986; Peng et al., 1994), and induce transcription of several genes (Ny et al., 1987; Wong and Richards, 1992). However, there is some evidence to suggest that the GnRH receptor (GnRHR) in the extrapituitary

0303-7207/00/$ - see front matter © 2000 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 3 0 3 - 7 2 0 7 ( 0 0 ) 0 0 1 9 6 - 9

158

S.K. Kang et al. / Molecular and Cellular Endocrinology 162 (2000) 157–166

tissues may be different from that of the pituitary in terms of basal expression levels. A lower level of receptor expression has been demonstrated in the rat ovary and testis compared to that in the pituitary (Kakar et al., 1994a). Demonstration of GnRHR mRNA by reverse transcription-polymerase chain reaction (RTPCR) provides further evidence for the low abundance of receptor mRNA in extrapituitary tissues such as ovarian and endometrial carcinomas (Imai et al., 1994a,b; Irmer et al., 1995; Imai et al., 1994c). The expression level of GnRHR gene is different among tissues in the hypothalamo – pituitary – gonadal axis, suggesting that different factors may be involved in the regulation of its gene expression. The mechanism by which the expression of one gene can be specifically directed in a range of functionally and developmentally diverse tissues may be based on the presence of tissueor cell-specific regulators (Orkin, 1990; Bodner et al., 1988a; Mangalam et al., 1989a). These regulators are able to control the expression of the gene by means of recognizing specific DNA sequences to enhance or repress transcription. To elucidate its transcriptional regulation, the 5%-flanking region of the human GnRHR (hGnRHR) gene has been cloned and characterized (Fan et al., 1994, 1995). Analysis of the 5%-flanking region of the hGnRHR gene suggests multiple transcription initiation sites and binding sites for several putative trans-acting factors, thereby reflecting the possible involvement of specific regulatory factors on the hGnRHR gene expression in diverse tissues. Recently, we have also shown that steroidogenic factor-1 (SF-1), by interacting with a gonadotroph specific element (GSE) motif within the first exon of the hGnRHR gene, is largely responsible for its gonadotroph-specific expression (Ngan et al., 1999). However, little is known about the molecular mechanisms governing the differential expression of the hGnRHR gene in the pituitary and extrapituitary tissues. The present study investigates the molecular basis that may account for the different expression levels of hGnRHR gene in various cells. We investigate the use of cell-specific promoters and differential trans-acting factors in the transcriptional regulation of hGnRHR gene expression in the pituitary and ovarian cell lines. The elucidation of the mechanisms controlling different regulation of the receptor in the extrapituitary tissues may provide insight into the understanding of its roles in the control of reproductive functions.

2. Materials and methods

2.1. Cell culture Human ovarian epithelial carcinoma cell line, OVCAR-3 (kindly provided by Dr T.C. Hamilton, Fox

Chase Cancer Center, Philadelphia, PA), was cultured at 37°C in medium 199 supplemented with 10% FBS in a humidified atmosphere of 5% CO2 –95% air. Mouse gonadotroph aT3-1 cells (kindly provided by Dr Pamela L. Mellon, University of California, San Diego, CA) and human embryonic kidney (HEK) — 293 cells (kindly provided by Dr A.J.W. Hsueh, Standford University, CA) were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% FBS and 4.5 g/l glucose. Primary ovarian tumors (n= 3) were obtained and cultured as described previously Crickard et al., 1983.

2.2. Total RNA preparation Total RNA from human pituitary tissues was kindly provided by Dr S.Y. Park, University of British Columbia, Canada. Total RNA from cultured cells was prepared using RNaid Kit (Bio/Can Scientific, Mississauga, Canada) according to the manufacturer’s suggested procedure. The RNA concentration was determined by the absorbance at 260 nm, and its integrity was confirmed by agarose–formaldehyde gel electrophoresis. Total RNA (1–3 mg) isolated from the cells was reverse transcribed to first strand cDNA using a first strand cDNA synthesis kit (Pharmacia Biotech, Morgan, Canada), following the manufacturer’s procedure.

2.3. Quantification of GnRHR mRNA To investigate the relative expression levels of GnRHR mRNA, semi-quantitative PCRs were performed. For comparison of different expression levels, the primers for both mouse and human GnRHR were designed to encompass the same region of the gene, and resulted in the same size of PCR products in both cell types. The oligonucleotides for the mouse GnRHR were sense: 5%-GTATGCTGGGGAGTTCCTCTGCA3% (mP44F); and antisense, 5%-GGATGATGAAGAGGCAGCCGAAG-3% (mP45R). The primers for the human GnRHR were sense: 5%-GTATGCTGGAGAGTTACTCTGCA-3% (hP44F); and antisense, 5%GGATGATGAAGAGGCAGCTGAAG-3% (hP45R). Primers for b-actin were derived from the human bactin cDNA sequence Ng et al., 1985, and resulted in amplification of the same size of PCR products in all cell types. Using 1–3 mg total RNA, first strand cDNA was transcribed and subjected to PCR amplification. Initially, to determine the conditions under which PCR amplification for GnRHR mRNA and b-actin mRNA were in the logarithmic phase, different amounts of total RNA were reverse transcribed, and aliquots were amplified using different numbers of cycles. A linear relationship was observed between the amount of RNA and PCR products when 3.0 mg of total RNA was used

S.K. Kang et al. / Molecular and Cellular Endocrinology 162 (2000) 157–166

in the reverse transcription reaction, and when 30 and 18 PCR amplification cycles for GnRHR and b-actin were performed, respectively. PCR for b-actin was used as a control to rule out the possibility of RNA degradation, and was used to control the variation in mRNA concentration in the RT reaction. The cDNA was amplified in a 50 ml PCR reaction containing 2.5 units Taq polymerase (Life Technologies Inc., Burlington, Canada), and its buffer, 1.5 mM MgCl2, 2 mM deoxyNTP, and 50 pmol specific primers. PCR amplification for GnRHR was carried out for 33 cycles with denaturing for 1 min at 94°C, annealing for 35 s at 60°C, extension for 90 s at 72°C, and a final extension for 15 min at 72°C. Amplified PCR products were subjected to Southern blot analysis and quantified using a computerized visual light densitometer (model 620, Bio-Rad Laboratories, Richmond, CA). GnRHR mRNA levels were expressed as the ratio of GnRHR to b-actin.

2.4. Southern blot and DNA sequence analysis Ten microliter of PCR products were fractionated in a 1.5% agarose gel and stained with ethidium bromide. The PCR products were transferred onto nylon membrane (Amersham Pharmacia Biotech, Oakville, Canada) and hybridized with a digoxigenin-labeled human GnRHR cDNA probe (16). After 3× high stringency washes (0.1% SDS, 0.1×SSC at 65°C), the membranes were exposed to Kodak Omat X-ray film (Eastman Kodak Co., Rochester, NY). The PCR products isolated from the gel were cloned into the pCR II vector using a TA Cloning Kit (Invitrogen, San Diego, CA) and sequenced by dideoxy nucleotide chain termination method using the T7 DNA Polymerase Sequencing Kit (Pharmacia Biotech).

2.5. Promoter–Luc 6ector construction and transient transfection assay A 2.3-kb DNA fragment corresponding to the 5%flanking region of the human GnRHR gene was prepared by PCR amplification using primer A, 5%CTGAAGCTTCCCAGGACAGAGCTTCAAGCCT3% and primer B, 5%-GGCCTGCTCTGTTTTAGCACTCTG-3%. A 2.7-kb fragment DNA containing the 5%-flanking region of the hGnRHR gene was used as a template for PCR amplification Fan et al., 1994. The Hind III restriction site (underlined) was included in primer A for subsequent cloning. The PCR-generated DNA was fused to the promoterless pGL2-basic luciferase vector (Promega, WI). A series of 3%-deletion clones containing different lengths of the promoter were constructed by restriction enzyme digestion and PCR amplification by specific primers. The positive clones were identified by restriction enzyme mapping, and confirmed by DNA sequence analysis. Plasmid DNAs

159

for transfection studies were prepared using Qiagen plasmid kits (Qiagen, Hilden, Germany), and DNA concentration was determined by measuring the absorbance at 260 and 280 nm. Transfection assays were carried out using the lipofectin reagent as recommended (Life Technologies Inc.). In order to normalize for different transfection efficiencies of various luciferase constructs, the b-galactosidase vector RSV-LacZ, was cotransfected into cells with each GnRHR promoter-luciferase construct. Approximately 3× 105 cells were plated onto 6-well plate 24 h before transfection. Five mg of the GnRHR-Luc vector and 2.5 mg of RSV–LacZ were combined with 16 ml lipofectin reagent (Life Technologies Inc.) in 200 ml serum-free medium. Lipofectin and DNA were incubated for 50 min at room temperature, diluted to 1 ml with serum-free medium and applied onto cells. Transfections were carried out for 24 h. Subsequently, the medium was removed and 2 ml of fresh medium containing 10% FBS was added. After 24 h incubation, cells were lysed with 150 ml reporter buffer (Promega). Cellular lysates were immediately assayed for luciferase activity, and the luminescence was measured using the TROPIX OPIOCOMP I luminometer (Bio/Can Scientific). b-galactosidase activity was also measured and used to normalize the luciferase activity. A promoterless pGL2-basic vector was transfected into the cells and served as a negative control.

2.6. Electrophoretic gel mobility shift assays (EMSAs) For the preparation of nuclear extracts, aT3-1, OVCAR-3 and HEK-293 cells were grown in 100 mm plates to 60% confluence. Cultured cells were washed three times with Tris buffered saline (pH 7.6), and then lysed by the lysis buffer (20 mM HEPES, pH 7.6, 20% glycerol, 10 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.1% Triton X-100, 1 mM DTT, 1 mM PMSF, 10 mg/ml leupeptin, 100 mg/ml aprotinin). The cells were dislodged by scraping and pelleted by centrifugation for 5 min at 2000 rpm at 4°C. Nuclei pellets were resuspended in 500 ml nuclear extract buffer (lysis buffer + 500 mM NaCl). Nuclei were gently rocked for 1 h at 4°C and centrifuged at 10 000 rpm for 10 min. The supernatant was aliquoted, frozen in liquid nitrogen and stored at − 70°C. Protein concentration of the nuclear extract was determined by the Bio-Rad assay kit (Bio-Rad, Hercules, CA). EMSAs were performed as described previously (Lasser et al., 1991). The DNA fragments were end-labeled with [g-32P]-ATP using 10 U of T4 polynucleotide kinase (New England Biolabs Inc., Beverly, MA). Ten micrograms of nuclear extracts were incubated for 30 min at room temperature or 0°C with 2× 105 cpm of the purified probe in a 30 ml reaction mixture containing 20 mM HEPES (pH 7.6), 5% glycerol, 50 mM NaCl, 1.5 mM MgCl2, 2 mg

160

S.K. Kang et al. / Molecular and Cellular Endocrinology 162 (2000) 157–166

Fig. 1. Different expression levels of GnRHR mRNA in pituitary tissues and primary culture of ovarian carcinomas. Various amounts of total RNA were reverse transcribed and PCR-amplified. The expected PCR products were observed by ethidium bromide staining (A, left panel), and confirmed as GnRHR by Southern blot analysis with a digoxigenin-labeled 364 bp hGnRHR cDNA probe (A, right panel). The level of mRNA was quantified using densitometer and plotted. A linear relationship was observed between RNA input and mRNA expression in both cells (B). When compared, a nine-fold higher expression of GnRHR mRNA was observed in the pituitary tissues than the PCO. Data are shown as the means of three individual experiments and are represented as the mean 9 S.D.

poly(dI-dC). For competitive EMSAs, excess amount of the unlabeled competitor DNA was added with the labeled probe. After incubation, reactions were loaded onto a 4% non-denaturing acrylamide gel containing 50 mM Tris base, 50 mM boric acid, 1 mM EDTA and electrophoresed at 150 V for 3 h at 4°C. The gels were dried and exposed to X-ray films with intensifiers.

2.7. Data analysis Data are represented as the means of three independent experiments each in duplicates. Statistical analysis was carried out using ANOVA, followed by Tukey’s t-test. Values are presented as the mean9 SD and are considered significant when P B 0.05.

3. Results

3.1. Expression le6els of GnRHR mRNA To investigate relative different expression levels of GnRHR mRNA in the pituitary tissues and the primary culture of ovarian cells (PCO), semi-quantitative RT-PCR was performed. Different amounts of total RNA were reverse-transcribed, and aliquots were amplified with primers specific for the human GnRHR. The expected PCR products were obtained as visualized by agarose gel electrophoresis and ethidium bromide staining (Fig. 1A, left panel). The authenticity of PCR products was confirmed by Southern blot analysis using a specific probe for hGnRHR (Fig. 1A, right panel).

Fig. 3. Functional analysis of the human GnRHR promoter by transient transfection assays. The 2.3 kb fragment of the 5%-flanking region of the human GnRHR gene were prepared by PCR amplification and fused to the promoterless pGL2-basic luciferase vector. A series of 3%-deletion clones containing different lengths of the promoter were constructed by restriction enzyme digestion and PCR amplifications from the 2.3 kb fragment and fused to the pGL2-basic vector. Restriction enzyme sites used in the 5%-flanking region of the human GnRHR gene were indicated (A). Five mg of the GnRHR-LUC vectors and 2.5 mg of RSV-LacZ were cotransfected into the aT3-1, OVCAR-3, HEK-293 cells as described in Section 2. Luciferase activity of GnRHR-LUC was expressed as a fold-induction over the luciferase activity of promoterless pGL2-basic vector. Values are the means 9S.D. of luciferase activity after adjusting for b-galactosidase activity. A similar pattern of luciferase activity was observed in the aT3-1 (B) and OVCAR-3 cells (C). Sequential deletion of 5%-flanking region of the gene revealed that the same two putative promoters designated PR1 (-771 to -557) and PR2 (-1351 to -1022) and a negative control region (-1022 to -771) in the pituitary and ovarian cells. No significant increase in luciferase activity was observed in HEK-293 cells (D).

S.K. Kang et al. / Molecular and Cellular Endocrinology 162 (2000) 157–166

Fig. 3.

161

162

S.K. Kang et al. / Molecular and Cellular Endocrinology 162 (2000) 157–166

Fig. 2. Different expression levels of GnRHR mRNA in aT3-1 and OVCAR-3 cells. Various amounts of total RNA were reverse-transcribed and PCR-amplified. The expected PCR products were observed by ethidium bromide staining (A, left panel), and confirmed as GnRHR by Southern blot analysis with a digoxigenin-labeled 364 bp hGnRHR cDNA probe (A, right panel). The level of mRNA was quantified using densitometer and plotted. A linear relationship was observed between RNA input and mRNA expression in both cells (B). When compared, a ten-fold higher expression of GnRHR mRNA was observed in the aT3-1 than the OVCAR-3 cells. Data are shown as the means of three individual experiments and are represented as the mean 9 S.D.

Furthermore, the PCR products were sequenced and were found to be identical to the receptors found in the human pituitary glands (data not shown). A linear relationship was observed between RNA input and PCR products (Fig. 1B). Quantitative analysis of the present study showed that the expression level of hGnRHR is nine-fold higher in the pituitary tissues than the PCO. Different expression levels of GnRHR mRNA in the pituitary and ovarian cells were also investigated using semi-quantitative RT-PCR. The expected PCR products were obtained from both cells (Fig. 2A). A linear relationship was observed between RNA input and PCR products in both cells (Fig. 2B). Quantitative analysis of the present study showed that the expression level of hGnRHR is ten-fold higher in aT3-1 than OVCAR-3 cells.

3.2. Analysis of cell-specific expression of the hGnRHR promoter by transient transfection assay To investigate the potential usage of a cell specific promoter in the two cells, a series of constructs containing 3%-deletions of the hGnRHR promoter (Fig. 3A) were constructed, and transfected into aT3-1 (Fig. 3B), OVCAR-3 (Fig. 3C) and HEK-293 cells (Fig. 3D). The promoterless vector, pGL2-basic, served as a control to determine the basal level of luciferase expression. A similar pattern of luciferase activity was observed in the aT3-1 and OVCAR-3 cells (Fig. 3). As a result, the

same promoter regions were found to be functional in both cell lines. When the region between -771 to -557 was deleted, a significant decrease in luciferase activity was observed in aT3-1 and OVCAR-3 cells. Furthermore, deletion of the promoter between -1351 to -1022 resulted in a decrease in luciferase activity in both cell types. Conversely, luciferase activity was significantly increased when the region between -1022 to -771 was deleted in aT3-1 and OVCAR-3 cells. No significant increase in luciferase activity was observed in HEK-293 cells (Fig. 3D).

3.3. In6ol6ement of regulatory proteins that confer different expression le6els of the hGnRHR gene To investigate the factors binding to the hGnRHR promoter, we performed electrophoretic mobility shift assays. Two putative promoter regions were identified from 3%-deletion transfection study, and were designated as PR1 (-771 to -557) and PR2 (-1351 to -1022). The DNA fragments were end-labeled and incubated with nuclear extracts from aT3-1, OVCAR-3 and HEK-293 cells. When the end-labeled PR1 was incubated with the nuclear extract from aT3-1 cells, four protein–DNA complexes, designated A1–A4, were observed. In contrast, using the same probe, two protein– DNA complexes (B1–B2) were observed in OVCAR-3 cells (Fig. 4A). The binding of each of these complexes were found to be specific, as formation of the retarded

S.K. Kang et al. / Molecular and Cellular Endocrinology 162 (2000) 157–166

163

complexes were abolished in the presence of a 250-fold molar excess of unlabelled competitor DNA (Fig. 4B). One of the shifted bands in OVCAR-3 cells appeared to represent nonspecific binding, as no competition was observed. When EMSAs were performed with the end-labeled PR2, one protein – DNA complex was observed in aT3-1 (C1) and OVCAR-3 cells (D1). However, patterns of complex formation were different in various cell types (Fig. 5A). The formation of both complexes was prevented by the addition of an excess amount of unlabeled PR2, indicating that these interactions are sequence specific (Fig. 5B). When EMSAs were performed using the negative regulatory region (-1022 to -771) as a probe, a similar pattern of DNA – protein complex formation was observed in both cell lines (data not shown). No

Fig. 5. EMSAs performed with the PR2 (-1351 to -1022). The nuclear extracts from aT3-1, OVCAR-3 and HEK-293 cells were incubated with end-labeled PR2 as a probe at different binding temperature as described in Section 2. A different protein – DNA complex was observed when incubated with end-labeled PR2 as probe in nuclear extracts from aT3-1 and OVCAR-3 cells, respectively (A, see arrows). Competitive EMSA with excess amount of unlabeled probe was added into reaction mixture and incubated at room temperature. The formation of DNA-protein complex was prevented by the addition of unlabeled probe (B, see arrows).

sequence specific binding activities were observed from the HEK-293 cell nuclear extract when incubated with end-labeled PR1 and PR2 (Figs. 4A and 5A). 4. Discussion

Fig. 4. EMSAs performed with PR1 (-771 to -557). The nuclear extracts from the aT3-1, OVCAR-3 and HEK-293 cells were incubated with end-labeled PR1 as a probe at different binding temperatures as described in Section 2. When end-labeled PR1 was used as a probe, four protein – DNA complexes were observed in nuclear extracts from aT3-1 cells, whereas two different shift complexes were identified in OVCAR-3 cells (A, see arrows). Competitive EMSA with excess amount of unlabeled probe was added into the reaction mixture and incubated at room temperature. As the concentrations of unlabeled competitor increased, the shifts were lost (B, see arrows). Notice a non-specific band (NS) in the OVCAR-3 cells.

As evident by the different expression levels, it has been suggested that GnRHR found in extrapituitary tissues may be different from that of the pituitary. In the present study, using pituitary aT3-1 and ovarian OVCAR-3 cell lines, we have demonstrated that different and/or combinations of regulatory factors may be the molecular basis of these differences. Since human gonadotroph-derived cell line is unavailable, we utilized the mouse gonadotroph-dervied aT3-1 cell line for our study. It has been demonstrated that aT3-1 cells express high levels of GnRH receptor that exhibits binding

164

S.K. Kang et al. / Molecular and Cellular Endocrinology 162 (2000) 157–166

characteristics similar to those found in the normal mouse and rat pituitary (Reinhart et al., 1992; Shah and Milligan, 1994; Perrin et al., 1993). Conservation of transcription factors among species further substantiates the feasibility of using this gonadotroph-derived cell line for our studies (Nilson et al., 1991; Farmerie et al., 1997). For comparison, the GnRHR expressing ovarian cancer cell line, OVCAR-3 was employed. In a preliminary study, we demonstrated that OVCAR-3 cells express functional GnRHR [Yin et al., 1998, manuscript submitted]. Different basal expression levels of GnRHR were addressed using quantitative RTPCR. We have demonstrated a higher level of receptor expression in the primary pituitary tissues and pituitary aT3-1 cells than in primary culture of ovarian carcinomas (PCO) and the OVCAR-3 cells. Initially, Northern blot analysis was employed but failed to detect the transcript in the ovarian cells. By Northern blot analysis, a previous study in the rat has shown that GnRHR gene expression is the highest in the pituitary and is followed by the ovary and testis (Kakar et al., 1994b). By RNase protection assay, the pituitary expressed 200 times greater hGnRHR mRNA level than the granulosa-luteal cells in the human Minaretzis et al., 1995. In an attempt to elucidate the underlying mechanisms for different basal transcription levels of the hGnRHR gene, we have investigated the use of various cell-specific promoters for the regulation of gene transcription in the pituitary and ovarian cells. This possibility has been documented in the transcriptional regulation of human GnRH and a-glycoprotein subunit genes (Dong et al., 1993, 1997; Schoderbek et al., 1992; Hamernik et al., 1992). To address the potential usage of a cell specific promoter, a series of constructs containing 3%-deletions of the hGnRHR promoter were fused to a luciferase reporter gene and tested for their abilities to drive expression in various cells. Two putative promoters and one repressor were identified in both cell types. The similar patterns of luciferase activity of the 3%-deletion constructs suggest that there is no cell specific promoter usage in pituitary aT3-1 versus ovarian OVCAR-3 cell lines. However, it is possible that a unique and currently undefined cisacting element is required for different expression levels of the hGnRHR gene in the two tissues. This possibility was demonstrated in the tissue specific expression of several genes (Means et al., 1989; Radovick et al., 1984; Hu et al., 1996; Zennaro et al., 1996). For instance, unlike in the ovary, a distal promoter which was located at least 40 kb upstream of the ovarian proximal promoter was employed to drive placenta-specific expression of the human P450 arom gene (Means et al., 1989). Therefore, we cannot rule out that the possibilities of other regulatory elements for cell/tissue-specific expression of the hGnRHR gene may reside outside of the 2.3-kb promoter region.

An alternative explanation is that different combinations of transcription factors may be used in gonadotroph and ovarian cells, thereby contributing to different levels of gene expression. It has been well documented that a cell type-specific expression of genes can be coordinately controlled by an individual or a combination of tissue-specific regulators (Nilson et al., 1991; Farmerie et al., 1997; Bodner et al., 1988b; Mangalam et al., 1989b; Steger et al., 1993). To examine this hypothesis, gel-shift assays were performed. We demonstrated the binding of different nuclear proteins in both promoter regions (PR1 and PR2). This observation provided strong evidence supporting the involvement of different transcription factors in the regulation of the hGnRHR promoter. Each of these complexes appeared to be specific, as they can be competed with excess amount of unlabelled competitor PR1 and PR2. Interestingly, when EMSA was performed with the negative regulatory region (− 1022 to − 771) as a probe, a similar shifted DNA–protein complex was observed in both cell lines (data not shown). This protein may be important for differential promoter activity, as it may have an effect on the promoter activity if it works in combinations with the proteins binding to the PR1 and PR2 region. No sequence specific binding activities were evident from the nuclear extract of HEK-293 cells when incubated with end-labeled PR1 and PR2, thus suggesting that binding activities observed in aT3-1 and OVCAR-3 cells are important in mediating cell specific expression of the hGnRHR gene. The demonstration of multiple nuclear protein bindings probably reflects the synergistic functional interactions of protein factors that are often observed in other transcription factors (Nilson et al., 1991; Schu¨le et al., 1988; Dre´an et al., 1996; Piao et al., 1997). Therefore, we conclude that different and/or combinations of regulatory factors may contribute to the different expression levels of the hGnRHR gene in gonadotroph and ovarian cells. The involvement of separable and/or differential combinations of trans-acting factors underscores the complexity of the hGnRHR promoter regarding requirements for cell specific expression. Alternatively, our results may reflect species differences rather than cell type difference. At this moment, we cannot address this point, as no human gonadotroph-derived cell line and/or mouse ovarian epithelial cancer cell line are available for the comparison study. Inspection of the sequence of the two promoter regions reveals putative binding sites for several transcription factors. A consensus sequence for GATA-1 is identified in both the PR1 and PR2 regions. Potential AP-1 binding site with one base insertion is found in the PR1 region (TGACTG6 CA, underlined) and with one base difference is present in the PR2 region (TGACTT6 A, underlined). A putative binding site for GF-1 is also found in the PR1 region with two bases difference (TTAA6 TCAG6 , underlined). A putative

S.K. Kang et al. / Molecular and Cellular Endocrinology 162 (2000) 157–166

binding site for AP4 is found in the PR2 region with two bases difference (TCAGCTTCT). Further characterization of the promoter regions will be warranted to determine the precise sequences of DNA elements mediating binding of these regulatory factors. In summary, we have demonstrated there is no differential use of promoter elements in ovarian and pituitary cells. Our study indicates that one mechanism by which cell-specific expression of the hGnRHR may occur, is through binding of different and/or combinations of cell-specific trans-acting factors. Further elucidation of differential transcriptional regulation of the hGnRHR gene expression will provide important insights into the complex regulation of GnRHR expression, and improve our understanding of its roles in reproductive functions.

Acknowledgements We express our gratitude to Drs T. Ehlen, J. Pike, M. Bertrand and D. Miller for providing primary ovarian tumors. This work was supported by Canadian Medical Research Council Grant MT7711 (to P.C.K.L) and Hong Kong Government Grants HKU 416/96M and HKU 7224/97M (to B.K.C.C.)

References Conn, P.M., 1994. The molecular mechanism of gonadotropin-releasing hormone action in the pituitary. In: Knobil, E., Neill, J.D. (Eds.), The Physiology of Reproduction. Raven Press, New York, pp. 1815 – 1826. Leung, P.C.K., Steele, G.L., 1992. Intracellular signaling in the gonads. Endocr. Rev. 13, 476–498. Va¨a¨nna¨nen, J., Tong, B.L.P., Va¨a¨nna¨nen, C.C.M., Chan, I.H.Y., Yuen, B.H., Leung, P.C.K., 1997. Interaction of prostaglandin F2a and gonadotropin-releasing hormone on progesterone and estradiol production in human granulosa–luteal cells. Biol. Reprod. 57, 1346 – 1353. Bramely, T.A., Menzies, G.S., Baird, D.T., 1986. Specificity of gonadotrophin-releasing hormone binding sites of the human corpus luteum: comparison with receptors of rat pituitary gland. J. Endorcrinol. 108, 323–328. Peng, C., Fan, N.C., Ligier, M., Va¨a¨nna¨nen, J., Leung, P.C.K., 1994. Expression and regulation of gonadotropin-releasing hormone (GnRH) and GnRH receptor messenger ribonucleic acids in human granulosa – luteal cells. Endocrinology 135, 1740–1746. Ny, T., Liu, Y.X., Ohlsson, M., Jones, P.B., Hsueh, A.J.W., 1987. Regulation of tissue-type plasminogen activator activity and messenger RNA levels by gonadotropin-releasing hormone gene in cultured rat granulosa cells and cumulus–oocyte complexes. J. Biol. Chem. 262, 11790–11793. Wong, W.Y., Richards, J.S., 1992. Induction of prostaglandin H synthase in rat preovulatory follicles by gonadotropin-releasing hormone. Endocrinology 130, 3512–3521. Kakar, S.S., Grantham, K., Musgrove, L.C., Devor, D., Sellers, J.C., Neill, J.D., 1994a. Rat gonadotropin-releasing hormone (GnRH) receptor: tissue expression and hormonal regulation of its mRNA. Mol. Cell. Endocrinol. 101, 151–157.

165

Imai, A., Ohno, T., Ohsuye, K., Tamaya, T., 1994a. Expression of gonadotropin-releasing hormone receptor in human epithelial ovarian carcinoma. Ann. Clin. Biochem. 31, 550 – 555. Imai, A., Ohno, T., Iida, K., Fuseya, T., Furui, T., Tamaya, T., 1994b. Gonadotropin-releasing hormone receptor in gynecologic tumors: frequent expression in adenocarcinoma histologic types. Cancer 74, 2555 – 2561. Irmer, G., Bu¨rger, C., Mu¨ler, R., Ortmann, O., Peter, U., Kakar, S.S., Neill, J.D., Chulz, K.D., Emons, G., 1995. Expression of the messenger RNAs for luteinizing hormone-releasing (LHRH) and its receptor in human ovarian epithelial carcinoma. Cancer Res. 55, 817 – 822. Imai, A., Ohno, T., Iida, K., Fuseya, T., Furui, T., Tamaya, T., 1994c. Presence of gonadotropin-releasing hormone receptor and its messenger ribonucleic acid in endometrial carcinoma and endometrium. Gynecol. Oncol. 55, 144 – 148. Orkin, S., 1990. Globin gene regulation and switching: circa (1990). Cell 63, 665 – 672. Bodner, M., Castrillo, J.L., Theill, L.E., Deerinick, T., Ellisman, M., Karin, M., 1988a. The pituitary-specific transcription factor GHF is a homeobox-containing protein. Cell 55, 505 – 518. Mangalam, H.J., Albert, V.R., Ingraham, H.A., Kapiloff, M., Wilson, L., Nelson, C., Elsholtz, H., Rosenfeld, M.G., 1989a. A pituitary POU domain protein, Pit-1, activates both growth hormone and prolactin promoters trasnscriptionally. Genes Dev. 3, 946 – 958. Fan, N.C., Jeung, E.B., Peng, C., Olofsson, J.I., Krisinger, J., Leung, P.C.K., 1994. The human gonadotropin-releasing hormone (GnRH) receptor gene: Cloning, genomic organization and chromosomal assignment. Mol. Cell. Endocrinol. 103, R1 – 6. Fan, N.C., Peng, C., Krisinger, J., Leung, P.C.K., 1995. The human gonadotropin-releasing hormone receptor gene: complete structure including multiple promoters, transcription initiation sites and polyadenylation signal. Mol. Cell. Endocrinol. 107, R1–8. Ngan, E.S.W., Cheng, P.K.W., Leung, P.C.K., Chow, B.K.C., 1999. Steroidogenic factor-1 interacts with a gonadotrope-specific element within the first exon of the human gonadotropin-releasing hormone receptor gene to mediate gonadotrope-specific expression. Endocrinology 140, 2452 – 2462. Crickard, K., Crickard, U., Yoonessi, M., 1983. Human ovarian carcinoma cells maintained on extracellular matrix versus plastic. Cancer Res. 43, 2762 – 2767. Ng, S.Y., Gunning, P., Eddy, R., Ponte, P., Leavitt, J., Shows, T., Kedes, L., 1985. Evolution of the functional human b-actin gene and its multi-pseudogene family: conservation of noncoding regions and chromosomal dispersion of pseudogenes. Mol. Cell. Biol. 5, 2720 – 2732. Lasser, A.B., Davis, R.L., Wright, W.E., Kadesch, T., Murre, C., Voronova, A., Baltimore, D., Weintraub, H., 1991. Functional activity of myogenic HLH proteins requires hetero-oligomerization with E12/E47-like protiein in vivo. Cell 66, 305 – 315. Reinhart, J., Mertz, L.M., Catt, K.J., 1992. Molecular cloning and expression of cDNA encoding the murine gonadotropin-releasing hormone receptor. J. Biol. Chem. 267, 21281 – 21284. Shah, B.H., Milligan, G., 1994. The gonadotrophin-releasing hormone receptor of aT3-1 pituitary cells regulates cellular levels of both of the phosphoinositidase C-linked G proteins, Gqa and G11a, equally. Mol. Pharmacol. 46, 1 – 7. Perrin, M.H., Bilezikjian, L.M., Hoeger, C., Donaldson, C.J., Rivier, J., Haas, Y., Vale, W.W., 1993. Molecular and functional characterization of GnRH receptors cloned from rat pituitary and a mouse pituitary tumor cell line. Biochem. Biophys. Res. Com. 191, 1139 – 1144. Nilson, J.H., Bokar, J.A., Clay, C.M., Farmerie, T.A., Fenstermaker, R.A., Hamernik, D.L., Keri, R.A., 1991. Different combinations of regulatory elements may explain why placenta-specific expression of the glycoprotein hormone a-subunit gene occurs only in primates and horses. Biol. Reprod. 44, 231 – 237.

166

S.K. Kang et al. / Molecular and Cellular Endocrinology 162 (2000) 157–166

Farmerie, T.A., Abbud, R.A., Budworth, P.R., Clay, C.M., Keri, R.A., McDowell, K.J., Wolfe, M.W., Nilson, J.H., 1997. Characterization of the equine glycoprotein hormone alpha-subunit gene reveals divergence in the mechanism of pituitary and placental expression. Biol. Reprod. 57, 1104–1114. Yin, H., Cheng, K.W., Peng, C., Auersperg, N., Leung, P.C.K., 1998. Expression of the messenger RNA for gonadotropin-releasing hormone and its receptor in human cancer cell lines. Life Sciences 62, 2015 – 2023. Kakar, S.S., Grantham, K., Musgrovw, L.C., Devor, D., Sellers, J.C., Neill, J.D., 1994b. Rat gonadotropin-releasing hormone(GnRH) receptor: tissue expression and hormonal regulation of its mRNA. Mol. Cell. Endocrinol. 101, 151–157. Minaretzis, D., Jakubowski, M., Mortola, J.F., Pavlou, S.N., 1995. Gonadotropin-releasing hormone receptor gene expression in human ovary and granulosa–lutein cells. J. Clin. Endocrinol. Metab. 80, 430 – 434. Dong, K.W., Yu, K.L., Roberts, J.L., 1993. Identification of a major up-stream transcription start site for the human progonadotropinreleasing hormone gene used in reproductive tissues and cell lines. Mol. Endocrinol. 7, 1654–1666. Dong, K.W., Yu, K.L., Chen, Z.G., Chen, Y.D., Roberts, J.L., 1997. Characterization of multiple promoters directing tissue-specific expression of the human gonadotropin-releasing hormone gene. Endocrinology 138, 2754–2762. Schoderbek, W.E., Kim, K.E., Ridgway, E.C., Mellon, P.L., Maurer, R.A., 1992. Analysis of DNA sequence required for pituitary-specific expression of the glycoprotein hormone a-subunit gene. Mol. Endocrinol. 6, 893 – 903. Hamernik, D.L., Keri, R.A., Clay, C.M., Clay, J.N., Sherman, G.B., Sawyer Jr, H.R., Nett, T.M., Nilson, J.H., 1992. Gonadotropeand thyrotrope-specific expression of the human and bovine glycoprotein hormone a-subunit genes is regulated by distinct cis-acting elements. Mol. Endocrinol. 6, 1745–1755. Means, G.D., Mahendroo, M., Corbin, C.J., Mathis, J.M., Powell, F.E., Mendelson, C.R., Simpson, E.R., 1989. Structural analysis of the gene encoding human aromatase cytochrome P-450, the enzyme responsible for estrogen biosynthesis. J. Biol. Chem. 264, 19385 – 19391.

.

Radovick, S., Wray, S., Muglia, L., Westphal, H., Olsen, B., Smith, E., Patriquin, E., Wondisford, F.E., 1984. Steroid hormone regulation and tissue-specific expression of the human GnRH gene in cell culture and transgenic animals. Hormones Behav. 28, 520– 529. Hu, Z., Zhuang, L., Dufau, M., 1996. Multiple and tissue-specific promoter control of gonadal and non-gonadal prolactin receptor gene expression. J. Biol. Chem. 271, 10242 – 10246. Zennaro, M.C., Menuet, D.L., Lombe´s, M., 1996. Characterization of the human mineralocorticoid receptor gene 5%-regulatory region: evidence for differential hormonal regulation of two alternative promoters via nonclassical mechanisms. Mol. Endocrinol. 10, 1549 – 1560. Bodner, M., Castrillo, J.L., Theill, L.E., Deerinick, T., Ellisman, M., Karin, M., 1988b. The pituitary-specific transcription factor GHF is a homeobox-containing protein. Cell 55, 505 – 518. Mangalam, H.J., Albert, V.R., Ingraham, H.A., Kapiloff, M., Wilson, L., Nelson, C., Elsholtz, H., Rosenfeld, M.G., 1989b. A pituitary POU domain protein, Pit-1, activates both growth hormone and prolactin promoters trasnscriptionally. Genes Dev. 3, 946 – 958. Steger, D.J., Bu¨scher, M., Hecht, J.H., Mellon, P.L., 1993. Coordinate control of the a- and b-subunit genes of human chorionic gonadotropin by trophoblast specific element-binding protein. Mol. Endocrinol. 7, 1579 – 1588. Schu¨le, R., Muller, M., Kaltschmidt, C., Renkawitz, R., 1988. Many transcription factors interact synergistically with steroid receptors. Science 242, 1418 – 1420. Dre´an, L.Y., Lie, D., Wong, A.O.L., Xiong, F., Hew, C.L., 1996. Steroidogenic factor-1 and estradiol receptor act in synergism to regulate the expression of the salmon gonadotropin II b subnunit gene. Mol. Endocrinol. 10, 217 – 229. Piao, Y.S., Peltoketo, H., Vihko, P., Vihko, R., 1997. The proximal promoter region of the gene encoding human 17b-hydorxysteroid dehydrogenase type I contains GATA, AP-2, and Sp1 response elements: Analysis of promoter function in choriocarcinoma cells. Endocrinology 138, 3417 – 3425.