- Email: [email protected]
Differential expression of microRNA species in a freeze tolerant insect, Eurosta solidaginis
Cryobiology 65 (2012) 210–214
Contents lists available at SciVerse ScienceDirect
Cryobiology journal homepage: www.elsevier.com/locate/ycryo
Differential expression of microRNA species in a freeze tolerant insect, Eurosta solidaginis q Lynn A. Courteau, Kenneth B. Storey 1, Pier Jr. Morin ⇑ Department of Chemistry and Biochemistry, Université de Moncton, 18 Antonine-Maillet Avenue, Moncton, New Brunswick, Canada E1A 3E9
a r t i c l e
i n f o
Article history: Received 19 April 2012 Accepted 21 June 2012 Available online 2 July 2012 Keywords: microRNA Freeze tolerance Eurosta solidaginis Reversible control of translation Gene silencing
a b s t r a c t Freeze tolerance in insects is associated with a variety of adaptations including production of cryoprotectants, specialized proteins that regulate ice formation, and energy-saving mechanisms that strongly suppress the rates of metabolic processes in the oxygen-limited frozen state. We hypothesized that microRNAs (miRNAs), small non-coding transcripts that bind to mRNA, could play a role in the global regulation of energy-expensive mRNA translation in frozen insects and would be modulated at subzero temperatures. Expression levels of miRNA species were evaluated in control (5 °C) and frozen (15 °C) goldenrod gall fly larvae, Eurosta solidaginis, using a miRNA microarray. Levels of miR-11, miR-276, miR-71, miR-3742, miR-277-3p, miR-2543b and miR-34 were significantly reduced in frozen larvae whereas miR-284, miR-3791-5p and miR-92c-3p rose significantly in frozen larvae. Target prediction for two miRNAs, miR-277-3p and miR-284, revealed potential regulation of transcripts involved in translation and the Krebs cycle. These data constitute the first report that differential expression of miRNAs occurs in a freeze tolerant insect and suggest a mechanism for reversible gene regulation during prolonged periods of freezing over the winter months, a mechanism that can be rapidly reversed to allow renewed translation of mRNA when temperatures rise and insects thaw. Ó 2012 Elsevier Inc. All rights reserved.
Introduction To survive the cold temperatures of winter, many ectothermic terrestrial animals, especially insects, have evolved freeze tolerance to endure prolonged exposures to temperatures below 0 °C. Freezing can cause extensive damage to tissues of nontolerant organisms but freeze tolerant insects have developed a range of protection mechanisms including the production of cryoprotectants, antifreeze proteins, ice-nucleating proteins, heat-shock proteins and other defensive mechanisms [9,11,33,34]. The goldenrod gall fly, Eurosta solidaginis, has been extensively studied as a model of insect freeze tolerance [20,33,34]. E. solidaginis larvae grow and develop inside the stems of goldenrod, feeding on plant tissue and causing a round gall of plant material to grow around each larva. Mature third instar larvae overwinter within their galls and because goldenrod stems often project above the snowpack, the larvae are frequently exposed to deep subzero temperatures for prolonged times. E. solidaginis q Statement of funding: This research was supported by the New Brunswick Innovation Foundation through its Innovation Capacity Development Initiative awarded to P.J.M. P.J.M. is also funded by an Operating Grant from the Natural Sciences and Engineering Research Council of Canada. ⇑ Corresponding author. Fax: +1 (506) 858 4541. E-mail address: [email protected] (P.Jr. Morin). 1 Address: Institute of Biochemistry, Carleton University, Ottawa, Ontario, Canada K1S 5B6.
0011-2240/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.cryobiol.2012.06.005
larvae typically freeze at 8 to 10 °C and may survive frozen at temperatures as low as 55 °C in some parts of their range [19]. When warm temperatures return in the spring, the larvae pupate and the adult fly emerges to restart the cycle by laying eggs on new goldenrod shoots. To achieve the cryoprotection needed for survival, many metabolic and molecular changes must occur in the organism regulated by both thermal and seasonal triggers. To spare energy reserves accumulated during warmer months, metabolic rate is significantly depressed over the winter (insects enter a diapause state) and a substantial supply of fermentable fuels is maintained [15]. At the molecular level, E. solidaginis protects its cells against the lethal effects of body fluid freezing by producing high concentrations of polyhydric alcohols (glycerol and sorbitol) as cryoprotectants [31]. Multiple changes also occur in enzymatic activities [32] and increased expression of heat-shock proteins (HSPs), including HSP40, HSP70 and HSP110, has also been reported and ensures proper folding of other cellular proteins [37].These are just a few examples of the molecular changes involved in the process of freeze tolerance. Coordination of these molecular adjustments requires tight regulation of cellular processes; for example, attenuation of selected metabolic pathways, enzymes and co-factors is carefully regulated by different molecular strategies including reversible protein phosphorylation [22,23]. Suppression of many other energy-consuming cellular processes such as transcription and translation is also needed.
L.A. Courteau et al. / Cryobiology 65 (2012) 210–214
A reversible mechanism capable of regulating mRNA translation is the action of microRNAs (miRNAs). miRNAs are small non-coding double-stranded ribonucleic acids of approximately 20–25 nucleotides that are capable of inhibiting the translation of messenger RNAs by binding to specific mRNA targets. The miRNA interacts with several proteins to form a RNA-Induced Silencing Complex (RISC). This complex consists of a ribonuclease-type protein from the Argonaute family, as well as other components that together participate in the translational repression of the target transcript. After recognition of the mRNA by a miRNA, the RISC complex can either proceed with the degradation of the mRNA or simply prevent its translation (often facilitating transcript storage for later translation); both mechanisms lead to the inhibition of mRNA translation into a specific protein [3]. Regulation of translation by miRNA action can provide a highly effective and often reversible way of controlling both global and differential protein synthesis with respect to environmental stresses. Indeed, the involvement of miRNA in the suppression and differential regulation of mRNA translation with respect to cold or freezing survival has recently been reported in vertebrates for a mammalian hibernator (Spermophilus tridecemlineatus) [25] and a freeze tolerant frog (Rana sylvatica) [4]. We hypothesized that a cold-induced miRNA signature would also be effective in the adaptive regulation of cold hardiness in the freeze tolerant insect E. solidaginis. The present study reports differential expression of ten miRNAs in this insect model as assessed by microarray analysis. Materials and methods Insect collection Goldenrod galls containing freeze tolerant E. solidaginis larvae were collected from fields in the Ottawa, Canada region in October. Sampling procedures were performed as previously described [24]. Briefly, the galls containing insect larvae were brought into the laboratory, acclimated for 14 days at 15 °C, and then submitted to the different temperature exposures. Insects were first acclimated for two weeks in an incubator set at 5 °C. A group of insects were subsequently sampled by being rapidly removed from the galls and flash-frozen in liquid nitrogen. The remaining insects were then acutely moved to 5 °C for two weeks before ultimately being subjected to 15 °C treatment for two weeks and sampled as the 5 °C insects. Samples were shipped on dry ice to the Moncton laboratory and placed in long term storage at 80 °C. Total RNA isolation Total small RNA was isolated from 5 °C and 15 °C E. solidaginis samples using the mirVana™ microRNA Isolation Kit (AmbionÒ, Life Technologies™). Two RNA isolates, or duplicates, were prepared for each temperature group (5 °C and 15 °C), following the manufacturer’s procedure, a standard acid phenol:chloroform RNA extraction. Each isolate combined three larvae (70 mg each) and were homogenized 1:10 (w/v) in the cell lysis:binding solution using a Polytron homogenizer followed by acid phenol:chloroform extraction using reagents provided with the RNA isolation kit. After a 5 min centrifugation at 10,000 g, nucleic acids were recovered from the aqueous phase and passed through glass-fiber filters as the final purification step. The purified RNA samples were then eluted from filter cartridges in sterile RNAse-free water (DEPCtreated). The final products were analyzed using a NanoVue Plus Spectrophotometer (±2 nm) to determine RNA concentrations as well as RNA purity via the absorbance ratio at 260/280 nm. All samples were stored at 80 °C until use.
211
Insect miRNA microarray miRNA levels in the two insect groups (5 °C and 15 °C) were detected via microarray profiling on microfluidic chips from LC Sciences (Houston, USA). The Arthropoda miRNA array (Product #MRA-1035B, version 17) was chosen for use since it contains probes that were complementary to multiple insect miRNA targets. Version 17 of this array included 2022 unique mature miRNA probes. Blanks and non-homologous nucleic acids were present on the chip and served as negative controls. Insect RNA samples were sent to and subsequently handled by LC Sciences. Briefly, samples were extended using poly(A) polymerase. An oligonucleotide tag was then attached to the poly(A) tail for later fluorescent dye staining. The purified small RNAs were next labeled with the Cy3 (5 °C) and Cy5 (15 °C) dyes. Hybridization was performed overnight on a lParaFlo microfluidic chip using a microcirculation pump (Atactic Technologies). Signals were detected the following day using tag-specific Cy3 and Cy5 dyes. Hybridization images were collected using a laser scanner (GenePix 4000B, Molecular Device) and digitized using Array-Pro image analysis software (Media Cybernetics). Data analysis To control for system related variations, data were normalized using a cyclic LOWESS (locally-weighted regression) filter following background subtraction. Ratios of the two sets of detected signals (log2 transformed and balanced) and P values of t-tests were subsequently calculated and reported. Differentially detected signals were those with P values <0.05.
Results Overexpressed miRNAs in frozen E. solidaginis Changes in miRNA levels in E. solidaginis were assessed using a miRNA microarray in larvae exposed to two temperatures: 5 °C control larvae and 15 °C frozen larvae. Fig. 1 shows a heat map of the miRNAs that were significantly up-regulated in frozen larvae when compared to the control larvae (P < 0.05). miRNAs with increased expression in the frozen insects were tca-miR-3791-5p (5.5-fold), dan-miR-284 (7.2-fold) and tca-miR-92c-3p (2.0-fold). Table 1 shows the nucleotide sequences targeted by these up-regulated miRNAs. The ratio values are reported using a log2 scale for rapid assessment of the type and magnitude of target differential expression. Positive and negative values indicate up- or down-regulation, respectively. Fold changes were converted to an arithmetic ratio using the 2^(log2 value) formula.
Fig. 1. Overexpressed miRNA species in E. solidaginis larvae under frozen (15 °C, 2 weeks) versus control (5 °C, 2 weeks) conditions. Representative heat map showing up-regulated miRNAs identified from samples of frozen (duplicates) versus control (duplicates) insects using a miRNA microarray.
212
L.A. Courteau et al. / Cryobiology 65 (2012) 210–214
Table 1 Targeted mRNA sequences and differential expression values of overexpressed miRNAs. Table shows overexpressed miRNAs and their nucleotide target sequences. The fold change calculated for each miRNA species is also reported. Values for frozen samples are significantly different from the corresponding normalized control values, P < 0.05. Detailed information on reporter names and sequences can be found on the provider website (http://www.lcsciences.com/applications/transcriptomics/mirnaprofiling/mirna/mirna-available arrays/insects-array-content/). Reporter name
Target sequence (50 to 30 )
Log2 (frozen/ control)
tca-miR-37915p dan-miR-284 tca-miR-92c-3p
CGGUGGUUUUAUUACGGUGGUUGCG
2.46
AGAAGUCAGCAACUUGAUUCCAGCAAUUG 2.84 UAUUGCACCAGUCCCGGCCUCAG 1.03
Underexpressed miRNAs in frozen E. solidaginis The microarray data also identified miRNAs that were significantly down-regulated in frozen insects. A greater number of miRNAs were identified as down-regulated following cold exposure when compared to the up-regulated miRNAs. Seven miRNAs fell in this category; aae-miR-11, aae-miR-276, ame-miR-71, amemiR-3742, dme-miR-277-3p, dps-miR-2543b and ngi-miR-34 (P < 0.05). Fig. 2 shows the heat map of the under-expressed miRNAs. The likely target mRNA sequence for each of these miRNAs is listed in Table 2. Predicted targets of differentially regulated miRNAs The Target Scan Fly 6.0 software [http://www.targetscan.org/ fly/] was used to identify mRNA targets from the fruit fly Drosophila
Table 3 Predicted mRNA targets of dme-miR-277 using the Target Scan Fly software. Table also indicates the number of predicted miRNA binding sites for each target. Name
Gene ID
Conserved sites
Task6 Stan Vimar
41671 36125 35609
5 4 3
Table 4 Predicted mRNA targets of dme-miR-284 using the Target Scan Fly software. Table also indicates the number of predicted mi 341 RNA binding sites for each target. Name
Gene ID
Conserved sites
Smaug Arrestin Bruno-2
39034 35078 250811
2 1 1
melanogaster transcriptome that are likely to be regulated by two differentially expressed miRNAs that were identified by microarray: dme-miR-277-3p that was down-regulated and dan-miR284 that was up-regulated . This site is used for the prediction of miRNA target genes using a seed-based algorithm previously reported [21] and can identify the occurrence and frequency of miRNA-binding sites located in the 3’UTR of target mRNAs. The predicted mRNA targets for the selected miRNAs are presented in Tables 3 and 4. Task6, Vimar and Stan were found to be leading mRNA targets for miR-277 while Smaug, Arr1 and Bru-2 were primary targets for miR-284 in the list generated by Target Scan Fly 6.0.
Discussion
Fig. 2. Down-regulated miRNA species in frozen E. solidaginis larvae. Representative heat map showing underexpressed miRNAs from samples of frozen (duplicates) versus control (duplicates) insects using a miRNA microarray.
Table 2 Targeted mRNA sequences and differential expression values of down-regulated miRNAs. Table shows underexpressed miRNAs, their nucleotide target sequences and the fold change calculated for each miRNA species. Values for frozen samples are significantly different from the corresponding normalized control values, P < 0.05. Reporter name
Target sequence (50 to 30 )
Log2 (frozen/control)
aae-miR-11 aae-miR-276 ame-miR-71 ame-miR-3742 dme-miR-277-3p dps-miR-2543b ngi-miR-34
CAUCACAGUCUGAGUUCUUGCU UAGGAACUUCAUACCGUGCUC UGAAAGACAUGGGUAGUGA AAAUAUAUUUUAAACGACGGAC UAAAUGCACUAUCUGGUACGACA UAUGCCACGGCGGCGGAUAGGAGCA GGCAGUGUGGUUAGCUGGUUG
0.90 0.67 0.89 0.77 0.27 1.52 0.78
The identification of miRNAs that regulate key biochemical pathways has gained tremendous momentum in recent years. This family of small ribonucleotides, by targeting mRNAs and preventing their translation, are involved in the regulation of cellular processes as diverse as embryonic development [1], metabolism [3], aging [29] as well as the adaptive mechanisms associated with responses to a variety of stresses [20] and reversible entry into hypometabolic states [5]. Interestingly, miRNAs were recently shown to be modulated in response to cold/freezing in a mammalian hibernator and in a freeze tolerant frog [4,25]. We hypothesized that the inhibitory regulation of transcript translation by miRNAs could be an important mechanism to impact gene and protein expression at subzero temperatures in a freeze tolerant insect and that a distinct signature of freeze-responsive miRNAs could be identified. Based on the differential expression of a group of miRNAs in E. solidaginis reported in this study, we believe that this is the case. A signature of miRNAs was identified as differentially expressed in frozen E. solidaginis, compared with 5 °C acclimated controls, using a microarray-based approach. Seven miRNAs were identified as significantly down-regulated in 15 °C exposed larvae whereas three were up-regulated. Putative functionality for a number of these miRNA species is available and suggests areas of E. solidaginis metabolism that may be particularly susceptible to positive or negative translational control by miRNA when the insect transitions into the frozen state. Tight control of apoptosis is essential for normal development and appropriate responses to stress. Two down-regulated miRNAs, miR-11 and miR-34, possess target transcripts involved in the apoptotic response. The differentially regulated miR-11 has been shown to regulate the apoptotic response in D. melanogaster
L.A. Courteau et al. / Cryobiology 65 (2012) 210–214
embryonic development through interactions with a series of proapoptotic targets including reaper, grim and sickle [12]. In addition, expression of miR-11 could also limit the pro-apoptotic functions of the dE2f1 transcription factor upon DNA damage in a similar model [35]. In mammals, study of the miR-34 family members, regulated by the tumor suppressor p53, has revealed the proapoptotic roles played by these miRNAs [14,18]. Interestingly, prolonged exposure to cold temperatures leads to apoptosis in some models [28] but such an event would be undesirable during prolonged cold exposure over the winter months in a cold-hardy insect. Current data available on expression levels of pro-apoptotic and anti-apoptotic proteins in natural models of hypometabolism are conflicting [36]. Modulation of the apoptotic response in cold insects remains to be further defined, but the down-regulation of the anti-apoptotic miR-11 and miR-34 reinforces the importance of investigating the apoptotic signaling cascade at low temperatures. Another down-regulated miR in E. solidaginis was miR-277. A previous study identified seven potential targets of miR-277 that are involved in branched chain amino acid degradation [30]. Regulation of these enzymes by miR-277 suggests a key role for this miRNA in valine, leucine and isoleucine degradation. It was hypothesized that this catabolic process is important under conditions of starvation and that this miR-277 would be involved in controlling the metabolic switch that regulates the machinery for branched chain amino acid degradation. Interestingly, a recent study reported differential expression of proteins involved in branched chain amino acid degradation during the winter in a mammalian hibernator [13]. These proteins have yet to be characterized in a freeze tolerant insect, but it is plausible to propose that miR-277 would be involved in modulating their translation at subzero temperatures. A search for additional mRNA targets for miR277 was undertaken using the Target Scan Fly software. Vimar was identified as one of the leading target transcripts of miR277. The human homolog of Vimar is a guanine exchange factor that activates the RAP1 protein and is known to be involved in regulating the actin cytoskeleton [6]. It was demonstrated in D. melanogaster that vimar heterozygous mutants showed a 30% increase in citrate synthase activity [8]. The activity of this enzyme catalyzes the first step of the Krebs cycle (TCA cycle) and is often used as a marker of mitochondrial oxidative capacity [7]. Data available on citrate synthase activity in E. solidaginis shows that citrate synthase activity, along with activites for two other mitochondrial enzymes glutamate dehydrogenase and NAD-isocitrate dehydrogenase, decreases by more than 50% in overwintering insects when compared with autumn values [16]. The reduction in miR-277 levels reported in this study could translate into reduced activity for this key enzyme of the TCA cycle and would be in line with the reduced activities of selected mitochondrial enzymes often measured in mid-winter insects. Down-regulation of miR-277 along with the potential concurrent increase in Vimar synthesis and reduction in citrate synthase activity might highlight a key regulatory node for mitochondrial activity in freeze tolerant insects. Expression of miR-71 was also down-regulated in frozen insects. Interestingly, this miRNA has previously been linked with the process of aging and the DNA damage response pathway [10]. More recently, miR-71 was shown to correlate with longevity in C. elegans [27]. In addition, a study associated miR-71 with response to environmental stresses and nutrient availability through interactions with different targets of the insulin and PI-3 K signaling pathways in the same species [38]. Results obtained for frozen E. solidaginis could highlight the role played by this miRNA following a temperature stress and a better characterization of specific targets of miR-71 in freeze tolerant insects is warranted. A short list of miRNAs was identified as significantly up-regulated in frozen larvae; tca-miR-3791-5p, dan-miR-284 and tca-
213
miR-92c-3p. This group of miRNAs further reinforces the possibility that miRNA biogenesis could be modulated at sub-zero temperatures in a freeze tolerant insect species which most likely has its cytoplasm in a liquid state at the temperatures assessed in this study. While these miRNAs are not well characterized in the literature, miR-284 has been shown to regulate the translation of two glutamate receptors; GluRIIA and GluRIIB, in D. melanogaster [17]. Using the Target Scan Fly software, we identified potential transcripts targeted by miR-284. The protein Smaug was identified among the leading candidates. Interestingly, Smaug has been shown to be involved in the translational regulation of transcripts harboring a Smaug response element (SRE) through its interaction with Cup, a protein that prevents the interaction between two translation initiation factors, eIF4E and eIF4G [26]. Mammalian Smaug is also involved in the formation of cytoplasmic foci that are similar to stress granules [2]. While the exact translational dynamics of SRE-containing transcripts at low temperatures remain to be defined, modulation of miR-284 could be a necessary mechanism to regulate translation of these transcripts under the low metabolic rate conditions of the frozen state. In conclusion, results presented here identify a subset of miRNAs that are differentially expressed in response to freezing in E. solidaginis. The data provide the first results of their kind for a freeze tolerant insect. While the exact metabolic cascades impacted by differential miRNA expression remain to be defined, these data nevertheless show that freeze tolerant species activate and differentially regulate miRNAs at low temperatures and that this is another mechanism by which such species can achieve with cold-responsive metabolic reorganization. Acknowledgments We thank J.M. Storey for editorial review of the manuscript. This research was supported by the New Brunswick Innovation Foundation through its Innovation Capacity Development Initiative awarded to P.J.M. References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21] [22] [23] [24] [25] [26] [27]
A.L. Abbott, Curr. Biol. 21 (2011) 668–671. M.V. Baez, G.L. Boccaccio, J. Biol. Chem. 280 (2005) 43131–43140. D.P. Bartel, Cell 116 (2004) 281–297. K.K. Biggar, A. Dubuc, K.B. Storey, Cryobiology 59 (2009) 317–321. K.K. Biggar, K.B. Storey, J. Mol. Cell Biol. 3 (2011) 167–175. J.L. Bos, Curr. Opin. Cell Biol. 17 (2005) 123–128. C.R. Bruce, A.D. Kriketos, G.J. Cooney, J.A. Hawley, Diabetologia 47 (2004) 23– 30. J. Chen, X. Shi, R. Padmanabhan, Q. Wang, Z. Wu, S.C. Stevenson, M. Hild, D. Garza, H. Li, Genome Res. 18 (2008) 123–136. D.L. Denlinger, R.E. Lee, Low Temperature Biology of Insects, Cambridge University Press, Cambridge, 2010. A. de Lencastre, Z. Pincus, K. Zhou, M. Kato, S.S. Lee, F.J. Slack, Curr. Biol. 24 (2010) 2159–2168. J.G. Duman, Ann. Rev. Physiol. 63 (2001) 327–357. W. Ge, Y.W. Chen, R. Weng, S.F. Lim, M. Buescher, R. Zhang, S.M. Cohen, Cell Death Diff. 19 (2011) 839–846. K.R. Grabek, A. Karimpour-Fard, L.E. Epperson, A. Hindle, L.E. Hunter, S.L. Martin, Physiol. Genom. 43 (2011) 1263–1275. H. Hermeking, Cell Death Diff. 17 (2010) 193–199. J.T. Irwin, R.E. Lee, J. Exp. Zool. 292 (2002) 345–350. D.R. Joanisse, K.B. Storey, Insect Biochem. Mol. Biol. 24 (1994) 145–150. J. Karr, V. Vagin, K. Chen, S. Ganesan, O. Olenkina, V. Gvozdev, D.E. Featherstone, J. Cell Biol. 185 (2009) 685–697. M. Kato, T. Paranjape, R.U. Müller, S. Nallur, E. Gillespie, K. Keane, A. EsquelaKerscher, J.B. Weidhaas, F.J. Slack, Oncogene 28 (2009) 2419–2424. R.E. Lee, R.A. Dommell, K.H. Joplin, D.L. Denlinger, Climate Res. 5 (1995) 61–67. C. Lema, M.J. Cunningham, Toxicol. Lett. 198 (2010) 100–105. B.P. Lewis, C.B. Burge, D.P. Bartel, Cell 120 (2005) 15–20. D.C. McMullen, K.B. Storey, J. Insect Physiol. 54 (2008) 1023–1027. D.C. McMullen, K.B. Storey, Physiol. Biochem. Zool. 8 (2010) 677–686. P. Morin Jr, D.C. McMullen, K.B. Storey, Mol. Cell. Biochem. 280 (2005) 99–106. P. Morin Jr, A. Dubuc, K.B. Storey, Biochim. Biophys. Acta 1779 (2008) 628–633. M.R. Nelson, A.M. Leidal, C.A. Smibert, EMBO J. 23 (2004) 150–159. Z. Pincus, T. Smith-Vikos, F.J. Slack, PLoS Genet. 7 (2011).
214
L.A. Courteau et al. / Cryobiology 65 (2012) 210–214
[28] U. Rauen, B. Polzar, H. Stephan, H.G. Mannherz, H. de Groot, FASEB J. 13 (1999) 155–168. [29] T. Smith-Vikos, F.J. Slack, J. Cell Sci. 125 (2012) 7–17. [30] A. Stark, J. Brennecke, R.B. Russell, S.M. Cohen, PLoS Biol. 1 (2003) 60. [31] J.M. Storey, K.B. Storey, J. Insect Physiol. 32 (1985) 549–556. [32] K.B. Storey, J.M. Storey, J. Comp. Physiol. B 144 (1981) 191–199. [33] K.B. Storey, J.M. Storey, in: R.E. Lee, D. Denlinger (Eds.), Insects at Low Temperature, Chapman and Hall, New York, 1991, pp. 64–93.
[34] K.B. Storey, J.M. Storey, Canadian, J. Zool. 90 (2012) 456–475. [35] M. Truscott, A.B. Islam, N. López-Bigas, M.V. Frolov, Genes Dev. 25 (2011) 1820–1834. [36] F. van Breukelen, G. Krumschnabel, J.E. Podrabsky, Apoptosis 15 (2010) 386– 399. [37] G. Zhang, J.M. Storey, K.B. Storey, J. Insect Physiol. 57 (2011) 1115–1122. [38] X. Zhang, R. Zabinsky, Y. Teng, M. Cui, M. Han, Proc. Nat. Acad. Sci. USA 108 (2011) 17997–18002.
Contents lists available at SciVerse ScienceDirect
Cryobiology journal homepage: www.elsevier.com/locate/ycryo
Differential expression of microRNA species in a freeze tolerant insect, Eurosta solidaginis q Lynn A. Courteau, Kenneth B. Storey 1, Pier Jr. Morin ⇑ Department of Chemistry and Biochemistry, Université de Moncton, 18 Antonine-Maillet Avenue, Moncton, New Brunswick, Canada E1A 3E9
a r t i c l e
i n f o
Article history: Received 19 April 2012 Accepted 21 June 2012 Available online 2 July 2012 Keywords: microRNA Freeze tolerance Eurosta solidaginis Reversible control of translation Gene silencing
a b s t r a c t Freeze tolerance in insects is associated with a variety of adaptations including production of cryoprotectants, specialized proteins that regulate ice formation, and energy-saving mechanisms that strongly suppress the rates of metabolic processes in the oxygen-limited frozen state. We hypothesized that microRNAs (miRNAs), small non-coding transcripts that bind to mRNA, could play a role in the global regulation of energy-expensive mRNA translation in frozen insects and would be modulated at subzero temperatures. Expression levels of miRNA species were evaluated in control (5 °C) and frozen (15 °C) goldenrod gall fly larvae, Eurosta solidaginis, using a miRNA microarray. Levels of miR-11, miR-276, miR-71, miR-3742, miR-277-3p, miR-2543b and miR-34 were significantly reduced in frozen larvae whereas miR-284, miR-3791-5p and miR-92c-3p rose significantly in frozen larvae. Target prediction for two miRNAs, miR-277-3p and miR-284, revealed potential regulation of transcripts involved in translation and the Krebs cycle. These data constitute the first report that differential expression of miRNAs occurs in a freeze tolerant insect and suggest a mechanism for reversible gene regulation during prolonged periods of freezing over the winter months, a mechanism that can be rapidly reversed to allow renewed translation of mRNA when temperatures rise and insects thaw. Ó 2012 Elsevier Inc. All rights reserved.
Introduction To survive the cold temperatures of winter, many ectothermic terrestrial animals, especially insects, have evolved freeze tolerance to endure prolonged exposures to temperatures below 0 °C. Freezing can cause extensive damage to tissues of nontolerant organisms but freeze tolerant insects have developed a range of protection mechanisms including the production of cryoprotectants, antifreeze proteins, ice-nucleating proteins, heat-shock proteins and other defensive mechanisms [9,11,33,34]. The goldenrod gall fly, Eurosta solidaginis, has been extensively studied as a model of insect freeze tolerance [20,33,34]. E. solidaginis larvae grow and develop inside the stems of goldenrod, feeding on plant tissue and causing a round gall of plant material to grow around each larva. Mature third instar larvae overwinter within their galls and because goldenrod stems often project above the snowpack, the larvae are frequently exposed to deep subzero temperatures for prolonged times. E. solidaginis q Statement of funding: This research was supported by the New Brunswick Innovation Foundation through its Innovation Capacity Development Initiative awarded to P.J.M. P.J.M. is also funded by an Operating Grant from the Natural Sciences and Engineering Research Council of Canada. ⇑ Corresponding author. Fax: +1 (506) 858 4541. E-mail address: [email protected] (P.Jr. Morin). 1 Address: Institute of Biochemistry, Carleton University, Ottawa, Ontario, Canada K1S 5B6.
0011-2240/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.cryobiol.2012.06.005
larvae typically freeze at 8 to 10 °C and may survive frozen at temperatures as low as 55 °C in some parts of their range [19]. When warm temperatures return in the spring, the larvae pupate and the adult fly emerges to restart the cycle by laying eggs on new goldenrod shoots. To achieve the cryoprotection needed for survival, many metabolic and molecular changes must occur in the organism regulated by both thermal and seasonal triggers. To spare energy reserves accumulated during warmer months, metabolic rate is significantly depressed over the winter (insects enter a diapause state) and a substantial supply of fermentable fuels is maintained [15]. At the molecular level, E. solidaginis protects its cells against the lethal effects of body fluid freezing by producing high concentrations of polyhydric alcohols (glycerol and sorbitol) as cryoprotectants [31]. Multiple changes also occur in enzymatic activities [32] and increased expression of heat-shock proteins (HSPs), including HSP40, HSP70 and HSP110, has also been reported and ensures proper folding of other cellular proteins [37].These are just a few examples of the molecular changes involved in the process of freeze tolerance. Coordination of these molecular adjustments requires tight regulation of cellular processes; for example, attenuation of selected metabolic pathways, enzymes and co-factors is carefully regulated by different molecular strategies including reversible protein phosphorylation [22,23]. Suppression of many other energy-consuming cellular processes such as transcription and translation is also needed.
L.A. Courteau et al. / Cryobiology 65 (2012) 210–214
A reversible mechanism capable of regulating mRNA translation is the action of microRNAs (miRNAs). miRNAs are small non-coding double-stranded ribonucleic acids of approximately 20–25 nucleotides that are capable of inhibiting the translation of messenger RNAs by binding to specific mRNA targets. The miRNA interacts with several proteins to form a RNA-Induced Silencing Complex (RISC). This complex consists of a ribonuclease-type protein from the Argonaute family, as well as other components that together participate in the translational repression of the target transcript. After recognition of the mRNA by a miRNA, the RISC complex can either proceed with the degradation of the mRNA or simply prevent its translation (often facilitating transcript storage for later translation); both mechanisms lead to the inhibition of mRNA translation into a specific protein [3]. Regulation of translation by miRNA action can provide a highly effective and often reversible way of controlling both global and differential protein synthesis with respect to environmental stresses. Indeed, the involvement of miRNA in the suppression and differential regulation of mRNA translation with respect to cold or freezing survival has recently been reported in vertebrates for a mammalian hibernator (Spermophilus tridecemlineatus) [25] and a freeze tolerant frog (Rana sylvatica) [4]. We hypothesized that a cold-induced miRNA signature would also be effective in the adaptive regulation of cold hardiness in the freeze tolerant insect E. solidaginis. The present study reports differential expression of ten miRNAs in this insect model as assessed by microarray analysis. Materials and methods Insect collection Goldenrod galls containing freeze tolerant E. solidaginis larvae were collected from fields in the Ottawa, Canada region in October. Sampling procedures were performed as previously described [24]. Briefly, the galls containing insect larvae were brought into the laboratory, acclimated for 14 days at 15 °C, and then submitted to the different temperature exposures. Insects were first acclimated for two weeks in an incubator set at 5 °C. A group of insects were subsequently sampled by being rapidly removed from the galls and flash-frozen in liquid nitrogen. The remaining insects were then acutely moved to 5 °C for two weeks before ultimately being subjected to 15 °C treatment for two weeks and sampled as the 5 °C insects. Samples were shipped on dry ice to the Moncton laboratory and placed in long term storage at 80 °C. Total RNA isolation Total small RNA was isolated from 5 °C and 15 °C E. solidaginis samples using the mirVana™ microRNA Isolation Kit (AmbionÒ, Life Technologies™). Two RNA isolates, or duplicates, were prepared for each temperature group (5 °C and 15 °C), following the manufacturer’s procedure, a standard acid phenol:chloroform RNA extraction. Each isolate combined three larvae (70 mg each) and were homogenized 1:10 (w/v) in the cell lysis:binding solution using a Polytron homogenizer followed by acid phenol:chloroform extraction using reagents provided with the RNA isolation kit. After a 5 min centrifugation at 10,000 g, nucleic acids were recovered from the aqueous phase and passed through glass-fiber filters as the final purification step. The purified RNA samples were then eluted from filter cartridges in sterile RNAse-free water (DEPCtreated). The final products were analyzed using a NanoVue Plus Spectrophotometer (±2 nm) to determine RNA concentrations as well as RNA purity via the absorbance ratio at 260/280 nm. All samples were stored at 80 °C until use.
211
Insect miRNA microarray miRNA levels in the two insect groups (5 °C and 15 °C) were detected via microarray profiling on microfluidic chips from LC Sciences (Houston, USA). The Arthropoda miRNA array (Product #MRA-1035B, version 17) was chosen for use since it contains probes that were complementary to multiple insect miRNA targets. Version 17 of this array included 2022 unique mature miRNA probes. Blanks and non-homologous nucleic acids were present on the chip and served as negative controls. Insect RNA samples were sent to and subsequently handled by LC Sciences. Briefly, samples were extended using poly(A) polymerase. An oligonucleotide tag was then attached to the poly(A) tail for later fluorescent dye staining. The purified small RNAs were next labeled with the Cy3 (5 °C) and Cy5 (15 °C) dyes. Hybridization was performed overnight on a lParaFlo microfluidic chip using a microcirculation pump (Atactic Technologies). Signals were detected the following day using tag-specific Cy3 and Cy5 dyes. Hybridization images were collected using a laser scanner (GenePix 4000B, Molecular Device) and digitized using Array-Pro image analysis software (Media Cybernetics). Data analysis To control for system related variations, data were normalized using a cyclic LOWESS (locally-weighted regression) filter following background subtraction. Ratios of the two sets of detected signals (log2 transformed and balanced) and P values of t-tests were subsequently calculated and reported. Differentially detected signals were those with P values <0.05.
Results Overexpressed miRNAs in frozen E. solidaginis Changes in miRNA levels in E. solidaginis were assessed using a miRNA microarray in larvae exposed to two temperatures: 5 °C control larvae and 15 °C frozen larvae. Fig. 1 shows a heat map of the miRNAs that were significantly up-regulated in frozen larvae when compared to the control larvae (P < 0.05). miRNAs with increased expression in the frozen insects were tca-miR-3791-5p (5.5-fold), dan-miR-284 (7.2-fold) and tca-miR-92c-3p (2.0-fold). Table 1 shows the nucleotide sequences targeted by these up-regulated miRNAs. The ratio values are reported using a log2 scale for rapid assessment of the type and magnitude of target differential expression. Positive and negative values indicate up- or down-regulation, respectively. Fold changes were converted to an arithmetic ratio using the 2^(log2 value) formula.
Fig. 1. Overexpressed miRNA species in E. solidaginis larvae under frozen (15 °C, 2 weeks) versus control (5 °C, 2 weeks) conditions. Representative heat map showing up-regulated miRNAs identified from samples of frozen (duplicates) versus control (duplicates) insects using a miRNA microarray.
212
L.A. Courteau et al. / Cryobiology 65 (2012) 210–214
Table 1 Targeted mRNA sequences and differential expression values of overexpressed miRNAs. Table shows overexpressed miRNAs and their nucleotide target sequences. The fold change calculated for each miRNA species is also reported. Values for frozen samples are significantly different from the corresponding normalized control values, P < 0.05. Detailed information on reporter names and sequences can be found on the provider website (http://www.lcsciences.com/applications/transcriptomics/mirnaprofiling/mirna/mirna-available arrays/insects-array-content/). Reporter name
Target sequence (50 to 30 )
Log2 (frozen/ control)
tca-miR-37915p dan-miR-284 tca-miR-92c-3p
CGGUGGUUUUAUUACGGUGGUUGCG
2.46
AGAAGUCAGCAACUUGAUUCCAGCAAUUG 2.84 UAUUGCACCAGUCCCGGCCUCAG 1.03
Underexpressed miRNAs in frozen E. solidaginis The microarray data also identified miRNAs that were significantly down-regulated in frozen insects. A greater number of miRNAs were identified as down-regulated following cold exposure when compared to the up-regulated miRNAs. Seven miRNAs fell in this category; aae-miR-11, aae-miR-276, ame-miR-71, amemiR-3742, dme-miR-277-3p, dps-miR-2543b and ngi-miR-34 (P < 0.05). Fig. 2 shows the heat map of the under-expressed miRNAs. The likely target mRNA sequence for each of these miRNAs is listed in Table 2. Predicted targets of differentially regulated miRNAs The Target Scan Fly 6.0 software [http://www.targetscan.org/ fly/] was used to identify mRNA targets from the fruit fly Drosophila
Table 3 Predicted mRNA targets of dme-miR-277 using the Target Scan Fly software. Table also indicates the number of predicted miRNA binding sites for each target. Name
Gene ID
Conserved sites
Task6 Stan Vimar
41671 36125 35609
5 4 3
Table 4 Predicted mRNA targets of dme-miR-284 using the Target Scan Fly software. Table also indicates the number of predicted mi 341 RNA binding sites for each target. Name
Gene ID
Conserved sites
Smaug Arrestin Bruno-2
39034 35078 250811
2 1 1
melanogaster transcriptome that are likely to be regulated by two differentially expressed miRNAs that were identified by microarray: dme-miR-277-3p that was down-regulated and dan-miR284 that was up-regulated . This site is used for the prediction of miRNA target genes using a seed-based algorithm previously reported [21] and can identify the occurrence and frequency of miRNA-binding sites located in the 3’UTR of target mRNAs. The predicted mRNA targets for the selected miRNAs are presented in Tables 3 and 4. Task6, Vimar and Stan were found to be leading mRNA targets for miR-277 while Smaug, Arr1 and Bru-2 were primary targets for miR-284 in the list generated by Target Scan Fly 6.0.
Discussion
Fig. 2. Down-regulated miRNA species in frozen E. solidaginis larvae. Representative heat map showing underexpressed miRNAs from samples of frozen (duplicates) versus control (duplicates) insects using a miRNA microarray.
Table 2 Targeted mRNA sequences and differential expression values of down-regulated miRNAs. Table shows underexpressed miRNAs, their nucleotide target sequences and the fold change calculated for each miRNA species. Values for frozen samples are significantly different from the corresponding normalized control values, P < 0.05. Reporter name
Target sequence (50 to 30 )
Log2 (frozen/control)
aae-miR-11 aae-miR-276 ame-miR-71 ame-miR-3742 dme-miR-277-3p dps-miR-2543b ngi-miR-34
CAUCACAGUCUGAGUUCUUGCU UAGGAACUUCAUACCGUGCUC UGAAAGACAUGGGUAGUGA AAAUAUAUUUUAAACGACGGAC UAAAUGCACUAUCUGGUACGACA UAUGCCACGGCGGCGGAUAGGAGCA GGCAGUGUGGUUAGCUGGUUG
0.90 0.67 0.89 0.77 0.27 1.52 0.78
The identification of miRNAs that regulate key biochemical pathways has gained tremendous momentum in recent years. This family of small ribonucleotides, by targeting mRNAs and preventing their translation, are involved in the regulation of cellular processes as diverse as embryonic development [1], metabolism [3], aging [29] as well as the adaptive mechanisms associated with responses to a variety of stresses [20] and reversible entry into hypometabolic states [5]. Interestingly, miRNAs were recently shown to be modulated in response to cold/freezing in a mammalian hibernator and in a freeze tolerant frog [4,25]. We hypothesized that the inhibitory regulation of transcript translation by miRNAs could be an important mechanism to impact gene and protein expression at subzero temperatures in a freeze tolerant insect and that a distinct signature of freeze-responsive miRNAs could be identified. Based on the differential expression of a group of miRNAs in E. solidaginis reported in this study, we believe that this is the case. A signature of miRNAs was identified as differentially expressed in frozen E. solidaginis, compared with 5 °C acclimated controls, using a microarray-based approach. Seven miRNAs were identified as significantly down-regulated in 15 °C exposed larvae whereas three were up-regulated. Putative functionality for a number of these miRNA species is available and suggests areas of E. solidaginis metabolism that may be particularly susceptible to positive or negative translational control by miRNA when the insect transitions into the frozen state. Tight control of apoptosis is essential for normal development and appropriate responses to stress. Two down-regulated miRNAs, miR-11 and miR-34, possess target transcripts involved in the apoptotic response. The differentially regulated miR-11 has been shown to regulate the apoptotic response in D. melanogaster
L.A. Courteau et al. / Cryobiology 65 (2012) 210–214
embryonic development through interactions with a series of proapoptotic targets including reaper, grim and sickle [12]. In addition, expression of miR-11 could also limit the pro-apoptotic functions of the dE2f1 transcription factor upon DNA damage in a similar model [35]. In mammals, study of the miR-34 family members, regulated by the tumor suppressor p53, has revealed the proapoptotic roles played by these miRNAs [14,18]. Interestingly, prolonged exposure to cold temperatures leads to apoptosis in some models [28] but such an event would be undesirable during prolonged cold exposure over the winter months in a cold-hardy insect. Current data available on expression levels of pro-apoptotic and anti-apoptotic proteins in natural models of hypometabolism are conflicting [36]. Modulation of the apoptotic response in cold insects remains to be further defined, but the down-regulation of the anti-apoptotic miR-11 and miR-34 reinforces the importance of investigating the apoptotic signaling cascade at low temperatures. Another down-regulated miR in E. solidaginis was miR-277. A previous study identified seven potential targets of miR-277 that are involved in branched chain amino acid degradation [30]. Regulation of these enzymes by miR-277 suggests a key role for this miRNA in valine, leucine and isoleucine degradation. It was hypothesized that this catabolic process is important under conditions of starvation and that this miR-277 would be involved in controlling the metabolic switch that regulates the machinery for branched chain amino acid degradation. Interestingly, a recent study reported differential expression of proteins involved in branched chain amino acid degradation during the winter in a mammalian hibernator [13]. These proteins have yet to be characterized in a freeze tolerant insect, but it is plausible to propose that miR-277 would be involved in modulating their translation at subzero temperatures. A search for additional mRNA targets for miR277 was undertaken using the Target Scan Fly software. Vimar was identified as one of the leading target transcripts of miR277. The human homolog of Vimar is a guanine exchange factor that activates the RAP1 protein and is known to be involved in regulating the actin cytoskeleton [6]. It was demonstrated in D. melanogaster that vimar heterozygous mutants showed a 30% increase in citrate synthase activity [8]. The activity of this enzyme catalyzes the first step of the Krebs cycle (TCA cycle) and is often used as a marker of mitochondrial oxidative capacity [7]. Data available on citrate synthase activity in E. solidaginis shows that citrate synthase activity, along with activites for two other mitochondrial enzymes glutamate dehydrogenase and NAD-isocitrate dehydrogenase, decreases by more than 50% in overwintering insects when compared with autumn values [16]. The reduction in miR-277 levels reported in this study could translate into reduced activity for this key enzyme of the TCA cycle and would be in line with the reduced activities of selected mitochondrial enzymes often measured in mid-winter insects. Down-regulation of miR-277 along with the potential concurrent increase in Vimar synthesis and reduction in citrate synthase activity might highlight a key regulatory node for mitochondrial activity in freeze tolerant insects. Expression of miR-71 was also down-regulated in frozen insects. Interestingly, this miRNA has previously been linked with the process of aging and the DNA damage response pathway [10]. More recently, miR-71 was shown to correlate with longevity in C. elegans [27]. In addition, a study associated miR-71 with response to environmental stresses and nutrient availability through interactions with different targets of the insulin and PI-3 K signaling pathways in the same species [38]. Results obtained for frozen E. solidaginis could highlight the role played by this miRNA following a temperature stress and a better characterization of specific targets of miR-71 in freeze tolerant insects is warranted. A short list of miRNAs was identified as significantly up-regulated in frozen larvae; tca-miR-3791-5p, dan-miR-284 and tca-
213
miR-92c-3p. This group of miRNAs further reinforces the possibility that miRNA biogenesis could be modulated at sub-zero temperatures in a freeze tolerant insect species which most likely has its cytoplasm in a liquid state at the temperatures assessed in this study. While these miRNAs are not well characterized in the literature, miR-284 has been shown to regulate the translation of two glutamate receptors; GluRIIA and GluRIIB, in D. melanogaster [17]. Using the Target Scan Fly software, we identified potential transcripts targeted by miR-284. The protein Smaug was identified among the leading candidates. Interestingly, Smaug has been shown to be involved in the translational regulation of transcripts harboring a Smaug response element (SRE) through its interaction with Cup, a protein that prevents the interaction between two translation initiation factors, eIF4E and eIF4G [26]. Mammalian Smaug is also involved in the formation of cytoplasmic foci that are similar to stress granules [2]. While the exact translational dynamics of SRE-containing transcripts at low temperatures remain to be defined, modulation of miR-284 could be a necessary mechanism to regulate translation of these transcripts under the low metabolic rate conditions of the frozen state. In conclusion, results presented here identify a subset of miRNAs that are differentially expressed in response to freezing in E. solidaginis. The data provide the first results of their kind for a freeze tolerant insect. While the exact metabolic cascades impacted by differential miRNA expression remain to be defined, these data nevertheless show that freeze tolerant species activate and differentially regulate miRNAs at low temperatures and that this is another mechanism by which such species can achieve with cold-responsive metabolic reorganization. Acknowledgments We thank J.M. Storey for editorial review of the manuscript. This research was supported by the New Brunswick Innovation Foundation through its Innovation Capacity Development Initiative awarded to P.J.M. References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21] [22] [23] [24] [25] [26] [27]
A.L. Abbott, Curr. Biol. 21 (2011) 668–671. M.V. Baez, G.L. Boccaccio, J. Biol. Chem. 280 (2005) 43131–43140. D.P. Bartel, Cell 116 (2004) 281–297. K.K. Biggar, A. Dubuc, K.B. Storey, Cryobiology 59 (2009) 317–321. K.K. Biggar, K.B. Storey, J. Mol. Cell Biol. 3 (2011) 167–175. J.L. Bos, Curr. Opin. Cell Biol. 17 (2005) 123–128. C.R. Bruce, A.D. Kriketos, G.J. Cooney, J.A. Hawley, Diabetologia 47 (2004) 23– 30. J. Chen, X. Shi, R. Padmanabhan, Q. Wang, Z. Wu, S.C. Stevenson, M. Hild, D. Garza, H. Li, Genome Res. 18 (2008) 123–136. D.L. Denlinger, R.E. Lee, Low Temperature Biology of Insects, Cambridge University Press, Cambridge, 2010. A. de Lencastre, Z. Pincus, K. Zhou, M. Kato, S.S. Lee, F.J. Slack, Curr. Biol. 24 (2010) 2159–2168. J.G. Duman, Ann. Rev. Physiol. 63 (2001) 327–357. W. Ge, Y.W. Chen, R. Weng, S.F. Lim, M. Buescher, R. Zhang, S.M. Cohen, Cell Death Diff. 19 (2011) 839–846. K.R. Grabek, A. Karimpour-Fard, L.E. Epperson, A. Hindle, L.E. Hunter, S.L. Martin, Physiol. Genom. 43 (2011) 1263–1275. H. Hermeking, Cell Death Diff. 17 (2010) 193–199. J.T. Irwin, R.E. Lee, J. Exp. Zool. 292 (2002) 345–350. D.R. Joanisse, K.B. Storey, Insect Biochem. Mol. Biol. 24 (1994) 145–150. J. Karr, V. Vagin, K. Chen, S. Ganesan, O. Olenkina, V. Gvozdev, D.E. Featherstone, J. Cell Biol. 185 (2009) 685–697. M. Kato, T. Paranjape, R.U. Müller, S. Nallur, E. Gillespie, K. Keane, A. EsquelaKerscher, J.B. Weidhaas, F.J. Slack, Oncogene 28 (2009) 2419–2424. R.E. Lee, R.A. Dommell, K.H. Joplin, D.L. Denlinger, Climate Res. 5 (1995) 61–67. C. Lema, M.J. Cunningham, Toxicol. Lett. 198 (2010) 100–105. B.P. Lewis, C.B. Burge, D.P. Bartel, Cell 120 (2005) 15–20. D.C. McMullen, K.B. Storey, J. Insect Physiol. 54 (2008) 1023–1027. D.C. McMullen, K.B. Storey, Physiol. Biochem. Zool. 8 (2010) 677–686. P. Morin Jr, D.C. McMullen, K.B. Storey, Mol. Cell. Biochem. 280 (2005) 99–106. P. Morin Jr, A. Dubuc, K.B. Storey, Biochim. Biophys. Acta 1779 (2008) 628–633. M.R. Nelson, A.M. Leidal, C.A. Smibert, EMBO J. 23 (2004) 150–159. Z. Pincus, T. Smith-Vikos, F.J. Slack, PLoS Genet. 7 (2011).
214
L.A. Courteau et al. / Cryobiology 65 (2012) 210–214
[28] U. Rauen, B. Polzar, H. Stephan, H.G. Mannherz, H. de Groot, FASEB J. 13 (1999) 155–168. [29] T. Smith-Vikos, F.J. Slack, J. Cell Sci. 125 (2012) 7–17. [30] A. Stark, J. Brennecke, R.B. Russell, S.M. Cohen, PLoS Biol. 1 (2003) 60. [31] J.M. Storey, K.B. Storey, J. Insect Physiol. 32 (1985) 549–556. [32] K.B. Storey, J.M. Storey, J. Comp. Physiol. B 144 (1981) 191–199. [33] K.B. Storey, J.M. Storey, in: R.E. Lee, D. Denlinger (Eds.), Insects at Low Temperature, Chapman and Hall, New York, 1991, pp. 64–93.
[34] K.B. Storey, J.M. Storey, Canadian, J. Zool. 90 (2012) 456–475. [35] M. Truscott, A.B. Islam, N. López-Bigas, M.V. Frolov, Genes Dev. 25 (2011) 1820–1834. [36] F. van Breukelen, G. Krumschnabel, J.E. Podrabsky, Apoptosis 15 (2010) 386– 399. [37] G. Zhang, J.M. Storey, K.B. Storey, J. Insect Physiol. 57 (2011) 1115–1122. [38] X. Zhang, R. Zabinsky, Y. Teng, M. Cui, M. Han, Proc. Nat. Acad. Sci. USA 108 (2011) 17997–18002.