Differential expression of nephrin in acquired human proteinuric diseases

Differential Expression of Nephrin in Acquired Human Proteinuric Diseases Byoung Kwon Kim, MD, Hye Kyoung Hong, MSc, Ji Hoon Kim, MD, and Hyun Soon Lee, MD ● Background: The slit-diaphragm protein nephrin is an essential component of the glomerular filtration barrier. It is not clear whether renal injury in patients with acquired proteinuric diseases is associated with altered regulation of the nephrin gene or protein. Methods: We examined expression patterns of nephrin protein and messenger RNA (mRNA) in renal biopsy specimens from patients with minimal lesion (n ⴝ 7), focal segmental glomerulosclerosis (FSGS; n ⴝ 14), or membranous nephropathy (MN; n ⴝ 7) and controls (n ⴝ 8) by immunohistochemistry, immunoelectron microscopy, in situ hybridization, and polymerase chain reaction (PCR) amplification of nephrin complementary DNA. Results: In normal kidney, nephrin staining showed a diffuse interrupted linear pattern along the glomerular basement membrane (GBM). Nephrin staining in minimal lesion specimens showed a finely granular pattern along the GBM and was positive in cell bodies of visceral glomerular epithelial cells. Nephrin staining was most disrupted in FSGS specimens. Immunoelectron microscopy showed that nephrin-specific gold particles were almost absent in effaced foot processes in proteinuric patients. An in situ hybridization study showed significantly decreased nephrin mRNA-expressing cells in cases of FSGS and MN compared with controls. Reversetranscription PCR showed significantly lower levels of nephrin mRNA in cases of FSGS and MN than controls, but no significant difference between minimal lesion cases and controls. Relative levels of glomerular nephrin mRNA correlated inversely with percentage of glomeruli with sclerosis in proteinuric diseases. Conclusion: These results suggest that nephrin-expression patterns in proteinuric diseases are different according to the specific glomerular disease or severity of glomerular damage. Am J Kidney Dis 40:964-973. © 2002 by the National Kidney Foundation, Inc. INDEX WORDS: Podocytes; immunohistology; reverse-transcription polymerase chain reaction (RT-PCR); glomerulosclerosis.

T

HE SLIT DIAPHRAGM spanning filtration slits between visceral glomerular epithelial cells (VGECs), podocytes, is essential for maintaining the glomerular filtration barrier. The molecular composition of the slit diaphragm is largely unknown.1 Monoclonal antibody 5-1-6, shown to induce proteinuria in vivo,2 reacts exclusively with the slit diaphragm.3,4 The congenital nephrotic syndrome (NPHS1) gene, which is mutated in congenital nephrotic syndrome of the Finnish type, recently was isolated and cloned.5 The NPHS1 gene product nephrin, which is identical to the monoclonal antibody 5-1-6 antigen,6 localizes at the slit diaphragm.7-9 In severe congenital nephrosis of the Finnish type10 and

From the Department of Pathology, Seoul National University College of Medicine, Seoul, Korea. Received May 16, 2002; accepted in revised form June 27, 2002. Supported in part by grants from Seoul National University Hospital and BK21 Project. Address reprint requests to Hyun Soon Lee, MD, Department of Pathology, Seoul National University College of Medicine, Chongno-gu, Yongon-dong 28, Seoul 110-799, Korea. E-mail: [email protected] © 2002 by the National Kidney Foundation, Inc. 0272-6386/02/4005-0010$35.00/0 doi:10.1053/ajkd.2002.36328 964

nephrin knockout mice,11 effacement of podocytes without a slit diaphragm commonly is seen. In rats with a nephrosis, such as puromycin aminonucleoside (PAN) nephrosis12 and passive Heymann’s nephritis,13,14 as well as in streptozotocin-diabetic rats,15,16 either downregulation12-15 or upregulation16 of nephrin gene or protein was shown. In human acquired proteinuric diseases, contradictory results also have been obtained. One study showed that glomerular expression patterns of nephrin protein and messenger RNA (mRNA) in proteinuric patients was not different compared with controls.17 Conversely, other investigators found a loss of nephrin staining along the glomerular basement membrane (GBM)18,19 or decreased glomerular nephrin mRNA expression20 in nephrotic individuals. It is not clear whether renal injury in patients with acquired proteinuric diseases is associated with altered regulation of the nephrin gene or protein. To address this issue, we attempted to evaluate expression patterns of nephrin mRNA and protein in renal biopsy samples obtained from proteinuric patients and controls by means of immunoperoxidase histochemistry, immunoelectron microscopy, digoxigenin (DIG)-labeled in situ hybridization, and polymerase chain reac-

American Journal of Kidney Diseases, Vol 40, No 5 (November), 2002: pp 964-973

NEPHRIN IN PROTEINURIC DISEASES Table 1.

Characteristics

Men/women Age (y) Systolic blood pressure (mm Hg) Serum creatinine (mg/dL)* Proteinuria (g/d) Glomerulosclerosis (%) Ratio of mRNA for nephrin-GAPDH

965

Characteristics of Patients With Proteinuric Diseases Minimal Lesion (N ⫽ 7)

FSGS (N ⫽ 14)

MN (N ⫽ 7)

Control (N ⫽ 5)

5/2 35.9 ⫾ 17.7 114.3 ⫾ 20.7 0.9 ⫾ 0.2 10.3 ⫾ 8† 2.7 ⫾ 4.8 0.66 ⫾ 0.3 (0.2-1)

10/4 33.7 ⫾ 20 132.9 ⫾ 17.7 1.29 ⫾ 0.74† 4.4 ⫾ 4.2† 32.5 ⫾ 29.3† 0.42 ⫾ 0.27† (0.1-0.8)

4/3 39.1 ⫾ 23.9 119.3 ⫾ 10.9 0.83 ⫾ 0.51 3.6 ⫾ 3.7† 23.8 ⫾ 30.9† 0.46 ⫾ 0.36† (0.1-0.9)

2/3 21 ⫾ 8 111 ⫾ 6.6 0.7 ⫾ 0.14 0.1 ⫾ 0.1 0.5 ⫾ 1.0 0.86 ⫾ 0.28 (0.53-1.2)

NOTE. Values are expressed as mean ⫾ SD. Values in parentheses refer to range of data. Abbreviations: FSGS, focal segmental glomerulosclerosis; MN, membranous nephropathy. *Conversion factor ⫽ 88.4. †P ⬍ 0.05 versus control by Wilcoxon’s rank-sum test.

tion (PCR) amplification of nephrin complementary DNA (cDNA). METHODS

Patients Twenty-eight patients with a diagnosis of minimal lesion (n ⫽ 7), focal segmental glomerulosclerosis (FSGS; n ⫽ 14), or membranous nephropathy (MN; n ⫽ 7) were selected for this study. Three nephrectomy specimens from patients with a diagnosis of renal cell carcinoma and five renal biopsy specimens from patients with microscopic hematuria, but no other detectable abnormalities, were used as controls. Renal biopsy specimens with more than 10 glomeruli were processed for light, electron, and immunofluorescence microscopy. For light microscopy, kidney tissues were fixed overnight in 4% paraformaldehyde at 4°C. The term glomerulosclerosis was used to describe both segmental sclerosis and global sclerosis. The man-woman ratio of patients with proteinuria was 19:9. Age ranged from 2 to 60 years, with a mean age of 37 ⫾ 21 years. Hypertension, defined as blood pressure greater than 140/90 mm Hg, was found in four cases. Twelve patients (43%) had nephrotic-range proteinuria, with 3.5 g/d or greater of protein at the time of biopsy. Renal insufficiency, defined as serum creatinine level greater than 1.5 mg/dL (132.6 ␮mol/L), was observed in four cases. Clinical characteristics of patients at the time of biopsy are listed in Table 1.

Immunohistochemistry A biotin-streptavidin-peroxidase procedure (Dakopatts, Glostrup, Denmark) was used for antibody localization. Paraffin-embedded kidney sections were deparaffinized serially and baked in a microwave oven for 15 minutes. Sections then were incubated overnight with mouse monoclonal antihuman extracellular nephrin (a gift from Dr V. Ruotsalainen, Oulu University, Oulu, Finland) at a dilution of 1 in 100. The antibody recognized the fibronectin type III–like motif. Endogenous peroxidase activity was quenched using a methanol–hydrogen peroxide solution. Biotinylated goat an-

timouse immunoglobulin (Dakopatts) was used as a secondary antibody. A streptavidin-conjugated horseradish peroxidase complex incubation was performed, followed by the addition of diaminobenzidine. Sections were counterstained with Mayer’s hematoxylin. Control experiments were performed by omitting the primary antibody or replacing it with the corresponding nonimmune serum. Distribution and expression patterns of nephrin in glomeruli were assessed by two pathologists (B.K.K. and H.S.L.) independently in a blinded manner.

Immunogold Electron Microscopy Immunoelectron microscopy was performed in four cases of FSGS, three cases of MN, three cases with minimal lesion, and four controls, essentially as described earlier.21 Samples were immersed in a periodate-lysine-paraformaldehyde solution for 2 hours at 4°C and dehydrated in a graded ethanol series at progressively lower temperatures to ⫺35°C. Tissue was transferred to a 1:1 mixture of 100% ethanol and Lowicryl K4M (Chemische Werke Lowi, Waldkraiburg, Germany) for 2 hours at ⫺35°C and transferred to 100% Lowicryl at ⫺35°C for 2 hours. Ultrathin sections were mounted on Formvar-coated 100-mesh nickel grids (Structure Probe, West Chester, PA). Grids were incubated overnight at 4°C with mouse monoclonal antihuman extracellular nephrin at a dilution of 1 in 120. Grids then were exposed to antimouse immunoglobulin G 10-nm gold (Amersham, Arlington Heights, IL) at a dilution of 1 in 30 for 3 hours at room temperature. Sections were stained with uranyl acetate and then with lead citrate. Control experiments were performed by omitting the primary antibody or replacing it with the corresponding nonimmune serum. For quantification, nephrin-specific gold particles at the slit diaphragm were counted from photographs.

Generation of Nephrin Riboprobe and In Situ Hybridization Total cellular RNA was isolated from human nephrectomy specimens and used to synthesize cDNA with SuperScript II (Gibco BRL, Paisley, UK) according to the manu-

966

facturer’s protocol. Using the cDNA mixture together with the sense (GGTATGAGGCCCTGGGGACT) and antisense primers (CACCAGATGTCCCCTCAGCT) of nephrin,22 PCR was performed. The 797-bp cDNA fragments that corresponded to exons 22 to 29 were produced by PCR. For amplification of cDNA templates, nested PCR was performed using a sense primer with the T7 promotor (GAGGTAATACGACTCACTATAGGGCATCTGCACTTCATCGTA) and an antisense primer with the T3 promoter (GAGGAATTAACCCTCACTAAAGGGGTCTCCACCAGCCTTCTG). The 533-bp and 413-bp cDNA fragments that corresponded to exons 23 to 28 were amplified. Target sequences were located in the putative transmembrane domain of nephrin. DIG-labeled riboprobes were generated using an RNA labeling in vitro transcription kit (DIG RNA labeling kit; Boehringer Mannheim, Mannheim, Germany), as previously described.23 In situ hybridization was performed using paraffinembedded renal tissues, as we have previously described.23 More than six glomeruli were scored to determine the number of mRNA-expressing cells observed within glomeruli.

Extraction and Reverse Transcription (RT) of mRNA From Single Glomeruli Single glomeruli were pulled out from fresh renal biopsy specimens, as described previously.20 Glomeruli were immediately dropped into 100 ␮L of lysis/binding buffer (100 mmol/L of Tris-HCl, pH 7.5; 500 mmol/L of LiCl; 10 mmol/L of EDTA, pH 8.0; 1% [wgt/vol] lithium dodecyl sulfate [LiDS]; and 5 mmol/L of dithiothreitol [DTT]). Glomerular mRNA was extracted and processed using oligo(dt)-linked Dynabeads (Dynal, Bromborough, UK) according to the manufacturer’s protocol. Glomeruli in lysis/ binding buffer were incubated with 50 ␮g/mL of proteinase K for 1 hour at 37°C. Lysate was centrifuged for 1 minute at 10,000g, and supernatant was mixed with oligo-(dt)-linked Dynabeads. mRNA was made to anneal to the Dynabeads for 10 minutes at room temperature. mRNA-annealed Dynabeads were washed twice with washing buffer A (10 mmol/L of Tris-HCl, pH 7.5; 0.15 mol/L of LiCl; 1 mmol/L of EDTA; and 0.1% LiDS) and once with washing buffer B (10 mmol/L of Tris-HCl, pH 7.5; 0.15 mol/L of LiCl; and 1 mmol/L of EDTA). Dynabeads finally were resuspended in 10 mmol/L of Tris-HCl (pH 7.5). Dynabead-linked mRNA was resuspended in reversetranscriptase buffer containing 0.4 mmol/L of diethylpyrocarbonate-treated deoxyribonucleoside-5⬘-triphosphates (dNTP; Gibco BRL), 0.4 U of RNAsin (Gibco BRL), 10 mmol/L of DTT, and 5 U of SuperScript reverse transcriptase (Gibco BRL). Priming was by oligo-(dt) Dynabeads, and incubation

KIM ET AL

was for 5 minutes at 50°C to disconnect oligo-(dt) from bead, then for 1 hour at 42°C. Resultant cDNA was stored at ⫺20°C before use.

PCR and Measurement of Nephrin cDNA Sequences specific for the nephrin gene were obtained from the EMBL database, and PCR primers were designed targeting exon 29. Primers for glyceraldehyde phosphate dehydrogenase (GAPDH) were used to control for sample cellularity and extraction efficiency. Sequences were as follows: nephrin, forward 5⬘-ATG GGA CCC TGG GAG CTC-3⬘, reverse 5⬘-CAC CAG ATG TCC CCT CAG-3⬘; and GAPDH, forward 5⬘-GCC AAA TTC GTT GTC ATA CC3⬘, reverse 5⬘-C TCC GTC CCT ACT ACA CGC-3⬘. cDNAlinked beads were resuspended in PCR preMix (1 U Taq polymerase; 250 ␮mol/L of dNTPs; 10 mmol/L of Tris-HCl, pH 8.0; 40 mmol/L of KCl; and 1.5 mmol/L of MgCl2; Bioneer, Seoul, Korea) containing 10 pmol of forward primer and 10 pmol of reverse primer. PCR products were electrophoresed on 10% polyacrylamide gel, visualized using ethidium bromide and UV light, and quantified using densitometry.

Statistics Results are expressed as mean ⫾ SD. Results were analyzed by two-way analysis of variance among three groups or Wilcoxon’s rank sum test or chi-square test between two groups. The significance of the association between continuous variables was determined using regression or correlation analysis. P less than 0.05 is considered significant.

RESULTS

Immunohistochemistry Normal adult human kidney specimens stained with antinephrin showed a diffuse interrupted linear pattern along the GBM (Fig 1A) and was not positive for cell bodies of VGECs (Fig 1B). In minimal lesion specimens, nephrin staining changed from a normal pseudolinear appearance to a finely granular pattern along the GBM (Fig 1C) and showed granular or dotted staining for nephrin within the cell bodies of VGECs (Fig 1D). Staining showed more dispersed and disrupted granular patterns along the GBM in MN specimens, with a patchy loss of nephrin from the GBM (Fig 1E). In addition, cytoplasm of

™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™3 Fig 1. Immunoperoxidase staining for nephrin. (A) Normal adult human kidney stained with antinephrin shows a diffuse linear pattern along the GBM and (B) is not positive in VGEC cell bodies (arrowheads). (C) Nephrin staining in minimal lesion specimen shows a finely granular pattern along the GBM and (D) granular staining within cytoplasm of VGEC cell bodies (arrows). (E) Nephrin staining in MN specimen shows dispersed and disrupted granular pattern along the GBM and (F) is not positive in VGEC cell bodies (arrowheads). (G) Nephrin staining in FSGS specimen shows segmental loss of nephrin along the GBM (arrow) and (H) distinct staining in microvilli (arrowheads), but not VGEC cell bodies (arrow). (Original magnification: [A, C, E, G] ⴛ200; [B, D, F, H] ⴛ1,000.)

Fig 1.

968

KIM ET AL

Fig 2. Electron micrographs of gold-labeled antibody to nephrin in (A) a normal glomerulus showing gold particles at interpodocyte filtration slit areas (arrowheads; original magnification ⴛ43,800); (B) a patient with minimal lesion showing scattered particles within the VGEC cell body (arrows); in intact slit diaphragm, gold particles are seen (arrowhead; original magnification ⴛ28,500); (C) a patient with MN showing a few gold particles at foot processes and cell body of VGECs (original magnification ⴛ20,300); and (D) a patient with FSGS showing no gold particle at the VGEC cell body (original magnification ⴛ23,000). Abbreviations: CB, cell body; CL, capillary lumen; US, urinary space; fp, foot process; d, electron-dense deposits.

NEPHRIN IN PROTEINURIC DISEASES Table 2.

969

Occurrence of Immunogold Particles for Nephrin at the Slit Diaphragm

Total no. of slit diaphragms Total no. of particles in slit diaphragms No. of particles per slit diaphragm

Minimal Lesion

FSGS

MN

Control

107 25 0.23

93 15 0.16

14 2 0.14

234 56 0.24

VGEC bodies was largely negative for nephrin (Fig 1F). Nephrin staining was most disrupted in the case of FSGS and showed a segmental loss of staining (Fig 1G). The extent of nephrin loss varied from glomerulus to glomerulus and affected up to half the total GBM length. Cell bodies of VGECs mostly were negative for nephrin in FSGS specimens. However, distinct nephrin staining was shown in microvilli (Fig 1H). In sclerotic lesions, nephrin staining was negative. Immunoelectron Microscopy In normal human adult glomeruli, nephrin antibodies mainly labeled interpodocyte areas at the level of filtration slits. One or two gold particles were detected in slits (Fig 2A). In diseased glomeruli, foot processes were widely effaced. Immunogold densities for nephrin were largely absent within effaced foot processes in minimal lesion specimens, but several gold particles were present scattered within VGEC bodies (Fig 2B). In areas with patent foot processes, concentration of gold particles was persistently present on filtration slits. The number of gold particles per slit diaphragm was not different between minimal lesion cases and controls (Table 2). Also, the plasma membrane, cytoplasm, and base of foot processes were labeled only rarely with these antibodies. In both FSGS and MN specimens, gold particles were almost absent within the effaced foot processes and cell bodies of VGECs, except for a few foci (Fig 2C and D). In areas in which foot processes were patent, the number of gold particles per slit diaphragm tended to be lower in FSGS and MN specimens than controls. However, the difference was not statistically significant (Table 2). In Situ Hybridization Study In situ hybridization was performed in four cases of minimal lesion, five cases of FSGS, four cases of MN, and four controls. Nephrin mRNA

was expressed mainly in VGECs in both controls (Fig 3A) and proteinuric patients (Fig 3B to D). Rarely, parietal epithelial cells expressed nephrin mRNA. Nonspecific extracellular binding of probe also was seen rarely in the interstitium. The mean number of nephrin mRNA-expressing cells per glomerular cross-section in minimal lesion specimens (20.7 ⫾ 4.8 [SD] cells) was not significantly different from controls (26.5 ⫾ 5.3 cells), whereas those in FSGS (16.4 ⫾ 7.6 cells) and MN specimens (18.2 ⫾ 3.8 cells) were significantly less than in controls (P ⬍ 0.05). No hybridization was detected in sections probed by the sense riboprobe for nephrin (Fig 3E). RT-PCR RT-PCR of GAPDH and nephrin mRNA was performed in 14 cases of FSGS, 7 cases of MN, 7 cases of minimal lesion, and 5 controls. When corrected for GAPDH expression, there was a significant decrease in glomerular expression of nephrin mRNA in FSGS and MN cases over controls (P ⬍ 0.05; Table 1; Fig 4). Conversely, glomerular expression of nephrin mRNA in minimal lesion cases was not significantly different compared with controls. Correlations Between Nephrin mRNA and Renal Injury Relative glomerular nephrin mRNA levels measured by densitometry correlated inversely with percentage of glomeruli with segmental sclerosis and global sclerosis (r ⫽ ⫺0.41; P ⬍ 0.05; Fig 5). There was a tendency (r ⫽ ⫺0.34), although statistically not significant, for glomerular nephrin mRNA to correlate inversely with serum creatinine level. No significant relationship was shown between nephrin mRNA and amount of proteinuria (r ⫽ 0.01; Fig 6). In addition, nephrin mRNA expression did not correlate with age (r ⫽ 0.103).

970

KIM ET AL

Fig 3. Detection of nephrin mRNA in renal biopsies of (A, E) healthy controls and (B-D) proteinuric patients. Renal biopsy sections hybridized with probes specific for nephrin mRNA showing VGEC production of nephrin mRNA (arrows) in specimens of (A) healthy control, (B) minimal lesion, (C) MN, and (D) FSGS. (E) Control in situ hybridization with sense nephrin probe. (Original magnification ⴛ200.)

DISCUSSION

These results document a spectrum of abnormal glomerular nephrin expression in human

proteinuric diseases, starting from the displacement of nephrin protein in minimal lesion specimens to its marked reduction in FSGS speci-

NEPHRIN IN PROTEINURIC DISEASES

971

Fig 4. Electrophoresis of RT-PCR products from single glomeruli of proteinuric patients. Quantitative expression of nephrin mRNA is corrected for the respective GAPDH signal. Quantitative results are listed in Table 1. Abbreviation: Min, minimal lesion.

mens. New findings on this study are that mRNA expression of nephrin is decreased in FSGS and MN cases measured by RT-PCR, and glomerular expression of nephrin mRNA is decreased according to extent of glomerulosclerosis in proteinuric diseases. Our peroxidase staining for nephrin on the GBM changed from a normal interrupted linear appearance to a finely granular pattern in the minimal lesion. GBM staining for nephrin showed more dispersed and disrupted granular patterns in MN specimens, and it was most disrupted in cases of FSGS. We also found granular cytoplasmic staining of nephrin in VGEC bodies in minimal lesion specimens, not found in control, MN, or FSGS specimens. No previous study has

Fig 5. Relationship between relative nephrin mRNA levels and percentage of glomerulosclerosis in proteinuric patients (r ⴝ ⴚ0.41; P < 0.05).

Fig 6. Relationship between relative nephrin mRNA levels and amounts of proteinuria (r ⴝ 0.01).

described such a difference in glomerular staining patterns for nephrin among minimal lesion, MN, and FSGS specimens. Foot-process effacement in nephrotic syndrome is an early sign of podocyte injury.24 During the development of foot-process effacement, proteins located in the slit diaphragm should be displaced to the apical portion.25 Displacement or loss of nephrin located in filtration slits might be a cause of the diffusely granular peroxidase staining for nephrin along the GBM that was observed in our minimal lesion specimens. In addition, the decrease in frequency of filtration slits, which are targeting sites for nephrin, might cause newly synthesized nephrin to accumulate in the cytoplasm of VGECs, resulting in granular cytoplasmic staining of nephrin in these cells in minimal lesion specimens. In accordance with immunohistochemistry results, several immunogold particles for nephrin were present, scattered within VGEC bodies in minimal lesion specimens. In MN or FSGS patients, dislocation of nephrin also might be a cause of the irregularly granular peroxidase staining for nephrin along the GBM. Nephrin also should be shifted away from filtration slits as a consequence of retraction of foot processes during microvillus formation, possibly resulting in staining of nephrin in microvilli, as shown in our patients with FSGS. Nonetheless, the patchy or segmental loss of

972

nephrin from GBM observed in MN or FSGS specimens, together with the lack of nephrin in cell bodies of VGECs, suggests that nephrin biosynthesis might be decreased in these diseases. Additional support for this hypothesis comes from our nephrin mRNA semiquantification study by RT-PCR. We show that glomerular nephrin mRNA expression was decreased significantly in FSGS and MN specimens compared with controls by RT-PCR. We also show that relative nephrin mRNA level correlated inversely with extent of glomerulosclerosis, whereas it was not related to amount of proteinuria. Thus, decreased nephrin expression in proteinuric diseases might reflect the severe structural damage of glomeruli, rather than heavy proteinuria. Several cases showed decreased mRNA expression of nephrin despite the low sclerotic score, suggesting that nephrin mRNA expression in relation to severity of structural damage is variable. Renal cortical nephrin mRNA determined by RT-PCR was markedly decreased in PAN nephrosis even before albuminuria,12 whereas it was increased in streptozotocindiabetic rats.16 Because PAN, but not high glucose level, is directly toxic to VGECs, these experimental data might support the hypothesis that decreased nephrin expression is attributed to severe damage to VGEC. In our study, no significant difference was shown in glomerular nephrin mRNA expression between minimal lesion specimens and controls by RT-PCR. However, Furness et al20 described decreased expression of nephrin mRNA in three patients with minimal lesion. Despite the small numbers, this difference between the two studies suggests that the severity of podocyte injury in relation to nephrin mRNA expression might be variable, even among cases of minimal lesion. Our in situ hybridization study shows that nephrin mRNA is expressed in VGECs. In parallel with our RT-PCR study, the number of nephrin mRNA-expressing cells per glomerular crosssection in FSGS and MN specimens was significantly decreased compared with controls. Decreased nephrin mRNA expression also was shown by in situ hybridization in glomeruli of rats with passive Heymann’s nephritis, which is an experimental model of MN.13 However, Patrakka et al17 did not find alterations in glomer-

KIM ET AL

ular nephrin mRNA expression in their proteinuric patients by in situ hybridization. In summary, the present study suggests a spectrum of abnormal glomerular nephrin expression in human proteinuric diseases, starting from the displacement of nephrin protein in minimal lesion specimens to its marked reduction in FSGS specimens, and that relative nephrin mRNA levels are decreased according to extent of glomerulosclerosis. This implies that nephrin expression patterns in proteinuric diseases might be different according to specific glomerular disease or severity of glomerular damage. ACKNOWLEDGMENT The authors thank Dr Vesa Ruotsalainen (Oulu University, Oulu, Finland) for providing antinephrin antibody.

REFERENCES 1. Mundel P, Kriz W: Structure and function of podocytes: An update. Anat Embryol 192:385-397, 1995 2. Orikasa M, Matsui K, Oite T, Shimizu F: Massive proteinuria induced in rats by a single intravenous injection of a monoclonal antibody. J Immunol 141:807-814, 1988 3. Kawachi H, Abrahamson DR, St John PL, et al: Developmental expression of the nephritogenic antigen of monoclonal antibody 5-1-6. Am J Pathol 147:824-833, 1995 4. Kawachi H, Koike H, Kurihara H, et al: Cloning of rat nephrin: Expression in developing glomeruli and in proteinuric states. Kidney Int 57:1949-1961, 2000 5. Kestila¨ M, Lenkkeri U, Ma¨nnikko¨ M, et al: Positionally cloned gene for a novel glomerular protein—nephrin—is mutated in congenital nephrotic syndrome. Mol Cell 1:575-582, 1998 6. Topham PS, Kawachi H, Haydar SA, et al: Nephritogenic mAb 5-1-6 is directed at the extracellular domain of rat nephrin. J Clin Invest 104:1559-1566, 1999 7. Ruotsalainen V, Ljungberg P, Wartiovaara J, et al: Nephrin is specifically located at the slit diaphragm of glomerular podocytes. Proc Natl Acad Sci U S A 96:79627967, 1999 8. Holtho¨fer H, Ahola H, Solin M-L, et al: Nephrin localizes at the podocyte filtration slit area and is characteristically spliced in the human kidney. Am J Pathol 155:16811687, 1999 9. Holzman LB, St John PL, Kovari IA, Verma R, Holthofer H, Abrahamson DR: Nephrin localizes to the slit pore of the glomerular epithelial cell. Kidney Int 56:14811491, 1999 10. Patrakka J, Kestila¨ M, Wartiovaara J, et al: Congenital nephrotic syndrome (NPHSI): Features resulting from different mutations in Finnish patients. Kidney Int 58:972980, 2000 11. Putaala H, Soininen R, Klipela¨inen P, Wartiovaara J, Tryggvason K: The murine nephrin gene is specifically expressed in kidney, brain and pancreas: Inactivation of the gene leads to massive proteinuria and neonatal death. Hum Mol Genet 10:1-8, 2001

NEPHRIN IN PROTEINURIC DISEASES

12. Luimula P, Ahola H, Wang S-X, et al: Nephrin in experimental glomerular disease. Kidney Int 58:1461-1468, 2000 13. Benigni A, Tomasoni S, Gagliardini E, et al: Blocking angiotensin II synthesis/activity preserves glomerular nephrin in rats with severe nephrosis. J Am Soc Nephrol 12:941948, 2001 14. Yuan H, Takeuchi E, Taylor GA, McLaughlin M, Brown D, Salant DJ: Nephrin dissociates from actin, and its expression is reduced in early experimental membranous nephropathy. J Am Soc Nephrol 13:946-956, 2002 15. Bonnet F, Cooper ME, Kawachi H, Allen TJ, Boner G, Cao Z: Irbesartan normalises the deficiency in glomerular nephrin expression in a model of diabetes and hypertension. Diabetologia 44:874-877, 2001 16. Aaltonen P, Luimula P, Astrom E, et al: Changes in the expression of nephrin gene and protein in experimental diabetic nephropathy. Lab Invest 81:1185-1190, 2001 17. Patrakka J, Ruotsalainen V, Ketola I, et al: Expression of nephrin in pediatric kidney diseases. J Am Soc Nephrol 12:289-296, 2001 18. Doublier S, Ruotsalainen V, Salvidio G, et al: Nephrin redistribution on podocytes is a potential mechanism for proteinuria in patients with primary acquired nephrotic syndrome. Am J Pathol 158:1723-1731, 2001 19. Wang S-X, Rastaldi MP, Patari A, Ahola H, Heikkila

973

E, Holthofer H: Patterns of nephrin and a new proteinuriaassociated protein expression in human renal diseases. Kidney Int 61:141-147, 2002 20. Furness PN, Hall LL, Shaw JA, Pringle JH: Glomerular expression of nephrin is decreased in acquired human nephrotic syndrome. Nephrol Dial Transplant 14:12341237, 1999 21. Zhang YZ, Lee HS: Quantitative changes in the glomerular basement membrane components in human membranous nephropathy. J Pathol 183:8-15, 1997 22. Putaala H, Sainio K, Sariola H, Tryggvason K: Primary structure of mouse and rat nephrin cDNA and structure and expression of the mouse gene. J Am Soc Nephrol 11:991-1001, 2000 23. Kim TS, Kim JY, Hong HK, Lee HS: mRNA expression of glomerular basement membrane proteins and TGF-␤1 in human membranous nephropathy. J Pathol 189:425-430, 1999 24. Gassler N, Elger M, Kra¨nzlin B, Kriz W, Gretz N: Podocyte injury underlies the progression of focal segmental glomerulosclerosis in the fa/fa Zucker rat. Kidney Int 60:106116, 2001 25. Smoyer WE, Mundel P: Regulation of podocyte structure during the development of nephrotic syndrome. J Mol Med 76:172-183, 1998